EP1123408A1 - Facteur de croissance c derive des plaquettes, adn le codant et ses utilisations - Google Patents

Facteur de croissance c derive des plaquettes, adn le codant et ses utilisations

Info

Publication number
EP1123408A1
EP1123408A1 EP99952989A EP99952989A EP1123408A1 EP 1123408 A1 EP1123408 A1 EP 1123408A1 EP 99952989 A EP99952989 A EP 99952989A EP 99952989 A EP99952989 A EP 99952989A EP 1123408 A1 EP1123408 A1 EP 1123408A1
Authority
EP
European Patent Office
Prior art keywords
pdgf
polypeptide
vegf
nucleic acid
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP99952989A
Other languages
German (de)
English (en)
Inventor
Ulf c/o The Ludwig Inst.Cancer Research ERIKSSON
Karin c/o The Ludwig Inst.Cancer Research AASE
Xuri c/o The Ludwig Inst.Cancer Research LI
Annica c/o The Ludwig Inst.Cancer Researc PONTEN
Marko c/o Helsinki Univ.Licensing Ltd. UUTELA
Kari c/oHelsinki Univ. Licensing Ltd. ALITALO
Arne c/o The Ludwig Inst.Cancer Research OESTMAN
Carl-Henrik c/o The Ludwig Inst.Cancer Res HELDIN
Christer C/o Goeteborg University BETSHOLZ
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ludwig Institute for Cancer Research Ltd
Licentia Oy
Ludwig Institute for Cancer Research New York
Original Assignee
Ludwig Institute for Cancer Research Ltd
Licentia Oy
Ludwig Institute for Cancer Research New York
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ludwig Institute for Cancer Research Ltd, Licentia Oy, Ludwig Institute for Cancer Research New York filed Critical Ludwig Institute for Cancer Research Ltd
Publication of EP1123408A1 publication Critical patent/EP1123408A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K51/00—Preparations containing radioactive substances for use in therapy or testing in vivo
    • A61K51/02—Preparations containing radioactive substances for use in therapy or testing in vivo characterised by the carrier, i.e. characterised by the agent or material covalently linked or complexing the radioactive nucleus
    • A61K51/04—Organic compounds
    • A61K51/08—Peptides, e.g. proteins, carriers being peptides, polyamino acids, proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C07K14/49—Platelet-derived growth factor [PDGF]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00—Uses of viruses
    • C12N2799/02—Uses of viruses as vector
    • C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/026—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a baculovirus
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P20/00—Technologies relating to chemical industry
    • Y02P20/50—Improvements relating to the production of bulk chemicals
    • Y02P20/582—Recycling of unreacted starting or intermediate materials

Definitions

  • This invention relates to growth factors for connective tissue cells, fibroblasts, myofibroblasts and glial cells and/or to growth factors for endothelial cells, and in particular to a novel platelet-derived growth factor/vascular endothelial growth factor-like growth factor, a polynucleotide sequence encoding the factor, and to pharmaceutical and diagnostic compositions and methods utilizing or derived from the factor.
  • vasculogenesis the primary vascular network is established by in si tu differentiation of mesodermal cells in a process called vasculogenesis . It is believed that all subsequent processes involving the generation of new vessels in the embryo and neovascularization in adults, are governed by the sprouting or splitting of new capillaries from the pre-existing vasculature in a process called angiogenesis
  • Angiogenesis is not only involved in embryonic development and normal tissue growth, repair, and regeneration, but is also involved in the female reproductive cycle, establishment and maintenance of pregnancy, and in repair of wounds and fractures.
  • angiogenic events are involved in a number of pathological processes, notably tumor growth and metastasis, and other conditions in which blood vessel proliferation, especially of the microvascular system, is increased, such as diabetic retinopathy, psoriasis and arthropathies .
  • Inhibition of angiogenesis is useful in preventing or alleviating these pathological processes.
  • angiogenesis is desirable in situations where vascularization is to be established or extended, for example after tissue or organ transplantation, or to stimulate establishment of collateral circulation in tissue infarction or arterial stenosis, such as in coronary heart disease and thromboangitis obliterans .
  • the angiogenic process is highly complex and involves the maintenance of the endothelial cells in the cell cycle, degradation of the extracellular matrix, migration and invasion of the surrounding tissue and finally, tube formation. The molecular mechanisms underlying the complex angiogenic processes are far from being understood.
  • FGFs fibroblast growth factors
  • PDGF platelet-derived growth factor
  • TGF ⁇ transforming growth factor alpha
  • HGF hepatocyte growth factor
  • VEGFs vascular endothelial growth factors
  • RTKs endothelial receptor tyrosine kinases
  • VEGF-B described in International Patent Application PCT/US96/02957 (WO 96/26736) and in U.S. Patents 5,840,693 and 5,607,918 by Ludwig Institute for Cancer Research and The University of Helsinki
  • VEGF-C described in Joukov et al . , EMBO J., 1996 15 . 290-298 and Lee et al . , Proc. Natl. Acad. Sci. USA, 1996 93 1988-1992
  • VEGF-D described in International Patent Application No.
  • PCT/US97/14696 (WO 98/07832), and Achen et al . , Proc. Natl. Acad. Sci. USA, 1998 95 548-553; the placenta growth factor (P1GF) , described in Maglione et al . , Proc. Natl. Acad. Sci. USA, 1991 88 . 9267- 9271; VEGF2, described in International Patent Application No. PCT/US94/05291 (WO 95/24473) by Human Genome Sciences, Inc; and VEGF3, described in International Patent Application No. PCT/US95/07283 (WO 96/39421) by Human Genome Sciences, Inc.
  • Each VEGF family member has between 30% and 45% amino acid sequence identity with VEGF.
  • the VEGF family members share a VEGF homology domain which contains the six cysteine residues which form the cysteine knot motif.
  • Functional characteristics of the VEGF family include varying degrees of mitogenicity for endothelial cells, induction of vascular permeability and angiogenic and lymphangiogenic properties.
  • VEGF Vascular endothelial growth factor
  • VEGF Vascular endothelial growth factor
  • VEGF has important regulatory functions in the formation of new blood vessels during embryonic vasculogenesis and in angiogenesis during adult life (Carmeliet et al . , Nature, 1996 380 435-439; Ferrara et al . , Nature, 1996380 439-442; reviewed in Ferrara and Davis-Smyth, Endocrine Rev., 1997 . 18 . 4-25) .
  • the significance of the role played by VEGF has been demonstrated in studies showing that inactivation of a single VEGF allele results in embryonic lethality due to failed development of the vasculature
  • VEGF has strong chemoattractant activity towards monocytes, can induce the plasminogen activator and the plasminogen activator inhibitor in endothelial cells, and can also induce microvascular permeability. Because of the latter activity, it is sometimes referred to as vascular permeability factor (VPF) .
  • VPF vascular permeability factor
  • VEGF-B has similar angiogenic and other properties to those of VEGF, but is distributed and expressed in tissues differently from VEGF.
  • VEGF-B is very strongly expressed in heart, and only weakly in lung, whereas the reverse is the case for VEGF. This suggests that VEGF and VEGF-B, despite the fact that they are co-expressed in many tissues, may have functional differences.
  • VEGF-B was isolated using a yeast co-hybrid interaction trap screening technique by screening for cellular proteins which might interact with cellular resinoid acid-binding protein type I (CRABP-I). Its isolation and characteristics are described in detail in PCT/US96/02957 and in Olofsson et al . , Proc. Natl. Acad. Sci. USA, 1996 9! 2576-2581.
  • CRABP-I resinoid acid-binding protein type I
  • VEGF-C was isolated from conditioned media of the PC-3 prostate adenocarcinoma cell line (CRL1435) by screening for ability of the medium to produce tyrosine phosphorylation of the endothelial cell-specific receptor tyrosine kinase VEGFR-3
  • VEGF-C was purified using affinity chromatography with recombinant
  • VEGFR-3 VEGFR-3
  • PC-3 cDNA library was cloned from a PC-3 cDNA library. Its isolation and characteristics are described in detail in Joukov et al . , EMBO J., 1996 15 290-298.
  • VEGF-D was isolated from a human breast cDNA library, commercially available from Clontech, by screening with an expressed sequence tag obtained from a human cDNA library designated "Soares Breast 3NbHBst" as a hybridization probe (Achen et al . , Proc. Natl. Acad. Sci. USA, 1998 95 . 548-553). Its isolation and characteristics are described in detail in International Patent Application No. PCT/US97/14696 (WO98/07832) .
  • VEGF-D The VEGF-D gene is broadly expressed in the adult human, but is certainly not ubiquitously expressed. VEGF-D is strongly expressed in heart, lung and skeletal muscle. Intermediate levels of VEGF-D are expressed in spleen, ovary, small intestine and colon, and a lower expression occurs in kidney, pancreas, thymus, prostate and testis. No VEGF-D mRNA was detected in RNA from brain, placenta, liver or peripheral blood leukocytes . P1GF was isolated from a term placenta cDNA library. Its isolation and characteristics are described in detail in Maglione et al . , Proc. Natl. Acad. Sci. USA, 1991 8 . 8 9267- 9271.
  • VEGF2 was isolated from a highly tumorgenic, oestrogen- independent human breast cancer cell line. While this molecule is stated to have about 22% homology to PDGF and 30% homology to VEGF, the method of isolation of the gene encoding VEGF2 is unclear, and no characterization of the biological activity is disclosed.
  • VEGF3 was isolated from a cDNA library derived from colon tissue. VEGF3 is stated to have about 36% identity and 66% similarity to VEGF. The method of isolation of the gene encoding VEGF3 is unclear and no characterization of the biological activity is disclosed.
  • Similarity between two proteins is determined by comparing the amino acid sequence and conserved amino acid substitutions of one of the proteins to the sequence of the second protein, whereas identity is determined without including the conserved amino acid substitutions.
  • PDGF/VEGF family members act primarily by binding to receptor tyrosine kinases.
  • Five endothelial cell-specific receptor tyrosine kinases have been identified, namely VEGFR-1 (Flt-1), VEGFR-2 (KDR/Flk-1), VEGFR-3 (Flt4), Tie and Tek/Tie-2. All of these have the intrinsic tyrosine kinase activity which is necessary for signal transduction .
  • the essential, specific role in vasculogenesis and angiogenesis of VEGFR-1, VEGFR-2, VEGFR-3, Tie and Tek/Tie-2 has been demonstrated by targeted mutations inactivating these receptors in mouse embryos.
  • VEGFR-1 The only receptor tyrosine kinases known to bind VEGFs are VEGFR-1, VEGFR-2 and VEGFR-3.
  • VEGFR-1 and VEGFR-2 bind VEGF with high affinity, and VEGFR-1 also binds VEGF-B and P1GF.
  • VEGF-C has been shown to be the ligand for VEGFR-3, and it also activates VEGFR-2 (Joukov et al . , The EMBO Journal, 1996 15 290-298).
  • VEGF-D binds to both VEGFR-2 and VEGFR-3.
  • a ligand for Tek/Tie-2 has been described in International Patent Application No. PCT/US95/12935 (WO 96/11269) by Regeneron Pharmaceuticals, Inc. The ligand for Tie has not yet been identified.
  • VEGF vascular endothelial growth factor
  • the VEGF receptor was found to specifically bind the VEGF 165 isoform via the exon 7 encoded sequence, which shows weak affinity for heparin (Soker et al . , Cell, 1998 92 . 735-745) .
  • the receptor was shown to be identical to human neuropilin-1 (NP-1), a receptor involved in early stage neuromorphogenesis .
  • NP-1 human neuropilin-1
  • P1GF-2 also appears to interact with NP-1 (Migdal et al . , J. Biol.
  • VEGFR-1, VEGFR-2 and VEGFR-3 are expressed differently by endothelial cells. Both VEGFR-1 and VEGFR-2 are expressed in blood vessel endothelia (Oelrichs et al . , Oncogene, 1992 8 . 11-18; Kaipainen et al . , J. Exp. Med., 1993 178 2077-2088; Dumont et al . , Dev. Dyn . , 1995 203 80-92; Fong et al . , Dev.
  • VEGFR-3 is mostly expressed in the lymphatic endothelium of adult tissues (Kaipainen et al . , Proc. Natl. Acad. Sci. USA, 1995 9 3566-3570). VEGFR-3 is also expressed in the blood vasculature surrounding tumors. Disruption of the VEGFR genes results in aberrant development of the vasculature leading to embryonic lethality around midgestation . Analysis of embryos carrying a completely inactivated VEGFR-1 gene suggests that this receptor is required for functional organization of the endothelium (Fong et al . , Nature, 1995 376 66-70).
  • VEGFR-1 is mainly expressed in endothelial cells during development, it can also be found in hematopoetic precursor cells during early stages of embryogenesis (Fong et al . , Nature, 1995 376 66-70). In adults, monocytes and macrophages also express this receptor (Barleon et al . , Blood, 1996 8 3336-3343) .
  • VEGFR-1 is expressed by most, if not all, vessels (Breier et al . , Dev. Dyn., 1995 204 228-239; Fong et al . , Dev. Dyn., 1996 07 1-10).
  • the receptor VEGFR-3 is widely expressed on endothelial cells during early embryonic development but as embryogenesis proceeds becomes restricted to venous endothelium and then to the lymphatic endothelium (Kaipainen et al . , Cancer Res., 1994 5_4 6571-6577; Kaipainen et al . , Proc. Natl. Acad. Sci. USA, 1995 92 3566-3570) .
  • VEGFR-3 is expressed on lymphatic endothelial cells in adult tissues. This receptor is essential for vascular development during embryogenesis. Targeted inactivation of both copies of the VEGFR-3 gene in mice resulted in defective blood vessel formation characterized by abnormally organized large vessels with defective lumens, leading to fluid accumulation in the pericardial cavity and cardiovascular failure at post-coital day 9.5. On the basis of these findings it has been proposed that VEGFR-3 is required for the maturation of primary vascular networks into larger blood vessels. However, the role of VEGFR-3 in the development of the lymphatic vasculature could not be studied in these mice because the embryos died before the lymphatic system emerged.
  • VEGFR-3 plays a role in development of the lymphatic vasculature and lymphangiogenesis given its specific expression in lymphatic endothelial cells during embryogenesis and adult life.
  • VEGF-C a ligand for VEGFR- 3
  • VEGF-C may have a primary function in lymphatic endothelium, and a secondary function in angiogenesis and permeability regulation which is shared with VEGF (Joukov et al . , EMBO J., 1996 15 290-298).
  • VEGF/VEGF-receptor system Some inhibitors of the VEGF/VEGF-receptor system have been shown to prevent tumor growth via an anti-angiogenic mechanism; see Kim et al . , Nature, 1993 362 841-844 and Saleh et al . , Cancer Res., 1996 56 393-401.
  • the VEGF family of growth factors are members of the PDGF family.
  • PDGF plays a important role in the growth and/or motility of connective tissue cells, fibroblasts, myofibroblasts and glial cells (Heldin et al . , "Structure of platelet-derived growth factor: Implications for functional properties", Growth Factor, 1993 8 . 245-252) .
  • PDGF stimulates wound healing (Robson et al . , Lancet, 1992 339 23-25) .
  • PDGF isoforms are disulfide- bonded dimers of homologous A- and B-polypeptide chains, arranged as homodimers (PDGF-AA and PDGF-BB) or a heterodimer (PDGF-AB) .
  • PDGF isoforms exert their effects on target cells by binding to two structurally related receptor tyrosine kinases (RTKs) .
  • RTKs receptor tyrosine kinases
  • the alpha-receptor binds both the A- and B-chains of PDGF, whereas the beta-receptor binds only the B-chain.
  • RTKs receptor tyrosine kinases
  • the alpha-receptor binds both the A- and B-chains of PDGF, whereas the beta-receptor binds only the B-chain.
  • These two receptors are expressed by many in vi tro grown cell lines, and are mainly expressed by mesenchymal cells in vivo .
  • the PDGFs regulate cell proliferation, cell survival and chemotaxis of many cell types in vitro (reviewed in Heldin et al . , Biochim Biophys Acta., 1998 1378 F79-113) .
  • PDGF-A epithelial
  • PDGF-B endothelial cells
  • PDGFs have been observed in several pathological conditions, including maligancies, arteriosclerosis, and fibroproliferative diseases (reviewed in Heldin et al . , The Molecular and Cellular Biology of Wound Repair, New York: Plenum Press, 1996, 249-273) .
  • PDGFs as regulators of cell proliferation and survival are well illustrated by recent gene targeting studies in mice that have shown distinct physiological roles for the PDGFs and their receptors despite the overlapping ligand specificities of the PDGFRs .
  • Homozygous null mutations for either of the two PDGF ligands or the receptors are lethal.
  • Approximately 50% of the homozygous PDGF-A deficient mice have an early lethal phenotype, while the surviving animals have a complex postnatal phenotype with lung emphysema due to improper alveolar septum formation because of a lack of alveolar myofibroblasts (Bostr ⁇ m et al . , Cell, 1996 85 . 863-873).
  • the PDGF-A deficient mice also have a dermal phenotype characterized by thin dermis, misshapen hair follicles and thin hair (Karlsson et al . , Development, 1999 126 2611-2). PDGF-A is also required for normal development of oligodendrocytes and subsequent myelination of the central nervous system (Fruttiger et al . , Development, 1999 126 457-67) .
  • the phenotype of PDGFR-alpha deficient mice is more severe with early embryonic death at E10, incomplete cephalic closure, impaired neural crest development, cardiovascular defects, skeletal defects, and odemas [Soriano et al .
  • mice develop similar phenotypes that are characterized by renal, hematological and cardiovascular abnormalities (Leveen et al . , Genes Dev., 1994 8 . 1875-1887; Soriano et al . , Genes Dev., 1994 8 1888-96; Lindahl et al .
  • the invention generally provides an isolated novel growth factor which has the ability to stimulate and/or enhance proliferation or differentiation and/or growth and/or motility of cells expressing a PDGF-C receptor including, but not limited to, endothelial cells, connective tissue cells, myofibroblasts and glial cells, an isolated polynucleotide sequence encoding the novel growth factor, and compositions useful for diagnostic and/or therapeutic applications.
  • a PDGF-C receptor including, but not limited to, endothelial cells, connective tissue cells, myofibroblasts and glial cells, an isolated polynucleotide sequence encoding the novel growth factor, and compositions useful for diagnostic and/or therapeutic applications.
  • the invention provides an isolated and purified nucleic acid molecule which comprises a polynucleotide sequence having at least 85% identity, more preferably at least 90%, and most preferably at least 95% identity to at least nucleotides 37-1071 of the sequence set out in Figure 1 (SEQ ID NO : 2 ) , at least nucleotides 6-956 of the sequence set out in Figure 3 (SEQ ID NO: 3) or at least nucleotides 196 to 1233 of the sequence set out in Figure 5 (SEQ ID NO: 6).
  • the sequence of at least nucleotides 37-1071 of the sequence set out in Figure 1 (SEQ ID NO: 2) or at least nucleotides 196 to 1233 of the sequence set out in Figure 5 (SEQ ID NO: 6) encodes a novel polypeptide, designated PDGF-C (formally designated "VEGF-F") , which is structurally homologous to PDGF-A, PDGF-B, VEGF, VEGF-B, VEGF-C and VEGF-D.
  • PDGF-C novel polypeptide
  • the nucleic acid molecule is a cDNA which comprises at least nucleotides 37-1071 of the sequence set out in Figure 1 (SEQ ID NO:2), at least nucleotides 6-956 of the sequence set out in Figure 3 (SEQ ID NO: 3) or at least nucleotides 196 to 1233 of the sequence set out in Figure 5 (SEQ ID NO: 6) .
  • This aspect of the invention also encompasses DNA molecules having a sequence such that they hybridize under stringent conditions with at least nucleotides 37-1071 of the sequence set out in Figure 1 (SEQ ID NO : 2 ) , at least nucleotides 6-956 of the sequence set out in Figure 3 (SEQ ID NO:3) or at least nucleotides 196 to 1233 of the sequence set out in Figure 5 (SEQ ID NO: 6) or fragments thereof.
  • the polypeptide of the invention has the ability to stimulate and/or enhance proliferation and/or differentiation and/or growth and/or motility of cells expressing a PDGF-C receptor including, but not limited to, endothelial cells, connective tissue cells, myofibroblasts and glial cells and comprises a sequence of amino acids corresponding to the amino acid sequence set out in Figure 2 (SEQ ID NO : 3 ) , Figure 4 (SEQ ID NO:5) or Figure 6 (SEQ ID NO: 7) , or a fragment or analog thereof which has the ability to stimulate and/or enhance proliferation and/or differentiation and/or growth and/or motility of cells expressing a PDGF-C receptor including, but not limited to, endothelial cells, connective tissue cells (such as fibroblasts), myofibroblasts and glial cells.
  • the polypeptides have at least 85% identity, more preferably at least 90%, and most preferably at least 95% identity to the amino acid sequence of in Figure 2 (SEQ ID NO : 3 ,
  • a preferred fragment is a truncated form of PDGF-C comprising a portion of the PDGF/VEGF homology domain (PVHD) of PDGF-C.
  • the minimal domain is residues 230-345. However, the domain can extend towards the N terminus up to residue 164.
  • the PVHD is defined as truncated PDGF-C.
  • the truncated PDGF-C is an activated form of PDGF-C.
  • percent sequence identity is determined by using the alignment tool of "MEGALIGN” from the Lasergene package (DNASTAR, Ltd. Abacus House, Manor Road, West Ealing, London W130AS United Kingdom) and using its preset conditions. The alignment is then refined manually, and the number of identities are estimated in the regions available for a comparison.
  • the polypeptide or the encoded polypeptide from a polynucleotide has the ability to stimulate one or more of proliferation, differentiation, motility, survival or vascular permeability of cells expressing a PDGF-C receptor including, but not limited to, vascular endothelial cells, lymphatic endothelial cells, connective tissue cells (such as fibroblasts), myofibroblasts and glial cells.
  • a PDGF-C receptor including, but not limited to, vascular endothelial cells, lymphatic endothelial cells, connective tissue cells (such as fibroblasts), myofibroblasts and glial cells.
  • the polypeptide or the encoded polypeptide from a polynucleotide has the ability to stimulate wound healing.
  • PDGF-C can also have antagonistic effects on cells, but are included in the biological activities of PDGF-C. These abilities are referred to hereinafter as "biological activities of PDGF-C" and can be readily tested by methods known in the
  • PDGF-C collectively refers to the polypeptides of Figure 2 (SEQ ID NO:3), Figure 4 (SEQ ID NO:5) or Figure 6 (SEQ ID NO:7), and fragments or analogs thereof which have the biological activity of PDGF-C as defined above, and to a polynucleotide which can code for PDGF-C, or a fragment or analog thereof having the biological activity of PDGF-C.
  • the polynucleotide can be naked and/or in a vector or liposome.
  • the invention provides a polypeptide possessing an amino acid sequence: PXCLLVXRCGGXCXCC (SEQ ID NO : 1 ) which is unique to PDGF-C and differs from the other members of the PDGF/VEGF family of growth factors because of the insertion of the three amino acid residues (NCA) between the third and fourth cysteines (see Figure 9 - SEQ ID NOs:8-17) .
  • Polypeptides comprising conservative substitutions, insertions, or deletions, but which still retain the biological activity of PDGF-C are clearly to be understood to be within the scope of the invention.
  • variant forms of the PDGF-C polypeptide which may result from alternative splicing, as are known to occur with VEGF and VEGF-B, and naturally-occurring allelic variants of the nucleic acid sequence encoding PDGF-C are encompassed within the scope of the invention.
  • Allelic variants are well known in the art, and represent alternative forms or a nucleic acid sequence which comprise substitution, deletion or addition of one or more nucleotides, but which do not result in any substantial functional alteration of the encoded polypeptide .
  • Such variant forms of PDGF-C can be prepared by targeting non-essential regions of the PDGF-C polypeptide for modification.
  • the growth factors of the PDGF family including VEGF, are di eric, and VEGF, VEGF-B, VEGF-C, VEGF-D, P1GF, PDGF-A and PDGF-B show complete conservation of eight cysteine residues in the N-terminal domains, i.e. the PDGF/VEGF-like domains (Olofsson et al . , Proc. Natl. Acad. Sci. USA, 1996 93 2576-2581; Joukov et al . , EMBO J., 1996 15 .
  • cysteines are thought to be involved in intra- and inter-molecular disulfide bonding. In addition there are further strongly, but not completely, conserved cysteine residues in the C-terminal domains. Loops 1, 2 and 3 of each subunit, which are formed by intramolecular disulfide bonding, are involved in binding to the receptors for the PDGF/VEGF family of growth factors (Andersson et al . , Growth Factors, 1995 12 159-164). Persons skilled in the art thus are well aware that these cysteine residues should be preserved in any proposed variant form, and that the active sites present in loops 1, 2 and 3 also should be preserved.
  • Modified polypeptides can readily be tested for their ability to show the biological activity of PDGF-C by routine activity assay procedures such as the fibroblast proliferation assay of Example 6. It is contemplated that some modified PDGF-C polypeptides will have the ability to bind to PDGF-C receptors on cells including, but not limited to, endothelial cells, connective tissue cells, myofibroblasts and/or glial cells, but will be unable to stimulate cell proliferation, differentiation, migration, motility or survival or to induce vascular proliferation, connective tissue development or wound healing.
  • modified polypeptides are expected to be able to act as competitive or non-competitive inhibitors of the PDGF-C polypeptides and growth factors of the PDGF/VEGF family, and to be useful in situations where prevention or reduction of the PDGF-C polypeptide or PDGF/VEGF family growth factor action is desirable.
  • receptor-binding but non- mitogenic, non-differentiation inducing, non-migration inducing, non-motility inducing, non-survival promoting, non- connective tissue development promoting, non-wound healing or non-vascular proliferation inducing variants of the PDGF-C polypeptide are also within the scope of the invention, and are referred to herein as "receptor-binding but otherwise inactive variant".
  • one monomer comprises the receptor-binding but otherwise inactive variant modified PDGF-C polypeptide and a second monomer comprises a wild-type PDGF-C or a wild-type growth factor of the PDGF/VEGF family.
  • These dimers can bind to its corresponding receptor but cannot induce downstream signaling.
  • modified PDGF-C polypeptides that can prevent binding of a wild-type PDGF-C or a wild-type growth factor of the PDGF/VEGF family to its corresponding receptor on cells including, but not limited to, endothelial cells, connective tissue cells (such as fibroblasts), myofibroblasts and/or glial cells.
  • endothelial cells such as fibroblasts
  • connective tissue cells such as fibroblasts
  • myofibroblasts myofibroblasts
  • glial cells glial cells.
  • these dimers will be unable to stimulate endothelial cell proliferation, differentiation, migration, survival, or induce vascular permeability, and/or stimulate proliferation and/or differentiation and/or motility of connective tissue cells, myofibroblasts or glial cells.
  • modified polypeptides are expected to be able to act as competitive or non- competitive inhibitors of the PDGF-C growth factor or a growth factor of the PDGF/VEGF family, and to be useful in situations where prevention or reduction of the PDGF-C growth factor or PDGF/VEGF family growth factor action is desirable.
  • Such situations include the tissue remodeling that takes place during invasion of tumor cells into a normal cell population by primary or metastatic tumor formation.
  • the PDGF- C or PDGF/VEGF family growth factor-binding but non-mitogenic, non-differentiation inducing, non-migration inducing, non- motility inducing, non-survival promoting, non-connective tissue promoting, non-wound healing or non-vascular proliferation inducing variants of the PDGF-C growth factor are also within the scope of the invention, and are referred to herein as "the PDGF-C growth factor-dimer forming but otherwise inactive or interfering variants".
  • a PDGF-C growth factor-dimer forming but otherwise inactive or interfering variant is where the PDGF-C has a mutation which prevents cleavage of CUB domain from the protein. It is further contemplated that a PDGF-C growth factor-dimer forming but otherwise inactive or interfering variant could be made to comprise a monomer, preferably an activated monomer, of VEGF, VEGF-B, VEGF-C, VEGF-D, PDGF-C, PDGF-A, PDGF-B or P1GF linked to a CUB domain that has a mutation which prevents cleavage of CUB domain from the protein.
  • Dimers formed with the above mentioned PDGF-C growth factor-dimer forming but otherwise inactive or interfering variants and the monomers linked to the mutant CUB domain would be unable to bind to their corresponding receptors.
  • a variation on this contemplation would be to insert a proteolytic site between an activated monomer of VEGF, VEGF-B, VEGF-C, VEGF-D, PDGF-C, PDGF-A, PDGF-B or P1GF and the mutant CUB domain linkage which is dimerized to an activated monomer of VEGF, VEGF-B, VEGF-C, VEGF-D, PDGF-C, PDGF-A, PDGF-B or P1GF.
  • the invention provides a purified and isolated nucleic acid encoding a polypeptide or polypeptide fragment of the invention as defined above.
  • the nucleic acid may be DNA, genomic DNA, cDNA or RNA, and may be single-stranded or double stranded.
  • the nucleic acid may be isolated from a cell or tissue source, or of recombinant or synthetic origin.
  • each sequence encodes the amino acid sequence shown in Figure 2 (SEQ ID NO:3), Figure 4 (SEQ ID NO:5) or Figure 6 (SEQ ID NO : 7 ) , a bioactive fragment or analog thereof, a receptor-binding but otherwise inactive or partially inactive variant thereof or a PDGF-C-dimer forming but otherwise inactive or interfering variants thereof.
  • a fourth aspect of the invention provides vectors comprising the cDNA of the invention or a nucleic acid molecule according to the third aspect of the invention, and host cells transformed or transfected with nucleic acids molecules or vectors of the invention. These may be eukaryotic or prokaryotic in origin. These cells are particularly suitable for expression of the polypeptide of the invention, and include insect cells such as Sf9 cells, obtainable from the American Type Culture Collection (ATCC SRL-171) , transformed with a baculovirus vector, and the human embryo kidney cell line 293-EBNA transfected by a suitable expression plasmid.
  • Preferred vectors of the invention are expression vectors in which a nucleic acid according to the invention is operatively connected to one or more appropriate promoters and/or other control sequences, such that appropriate host cells transformed or transfected with the vectors are capable of expressing the polypeptide of the invention.
  • Other preferred vectors are those suitable for transfection of mammalian cells, or for gene therapy, such as adenoviral-, vaccinia- or retroviral-based vectors or liposomes. A variety of such vectors is known in the art.
  • the invention also provides a method of making a vector capable of expressing a polypeptide encoded by a nucleic acid according to the invention, comprising the steps of operatively connecting the nucleic acid to one or more appropriate promoters and/or other control sequences, as described above.
  • the invention further provides a method of making a polypeptide according to the invention, comprising the steps of expressing a nucleic acid or vector of the invention in a host cell, and isolating the polypeptide from the host cell or from the host cell's growth medium.
  • the invention provides an antibody specifically reactive with a polypeptide of the invention or a fragment of the polypeptide.
  • This aspect of the invention includes antibodies specific for the variant forms, immunoreactive fragments, analogs and recombinants of PDGF-C. Such antibodies are useful as inhibitors or agonists of PDGF-C and as diagnostic agents for detecting and quantifying PDGF-C.
  • Polyclonal or monoclonal antibodies may be used. Monoclonal and polyclonal antibodies can be raised against polypeptides of the invention or fragment or analog thereof using standard methods in the art.
  • the polypeptide can be linked to an epitope tag, such as the FLAG ® octapeptide (Sigma, St.
  • a monoclonal antibody is to be used to inhibit effects of PDGF-C in a clinical situation, it may be desirable to use humanized or chimeric monoclonal antibodies.
  • Such antibodies may be further modified by addition of cytotoxic or cytostatic drugs. Methods for producing these, including recombinant DNA methods, are also well known in the art.
  • This aspect of the invention also includes an antibody which recognizes PDGF-C and is suitably labeled.
  • Polypeptides or antibodies according to the invention may be labeled with a detectable label, and utilized for diagnostic purposes. Similarly, the thus-labeled polypeptide of the invention may be used to identify its corresponding receptor in si tu .
  • the polypeptide or antibody may be covalently or non-covalently coupled to a suitable supermagnetic, paramagnetic, electron dense, ecogenic or radioactive agent for imaging.
  • radioactive or non-radioactive labels may be used. Examples of radioactive labels include a radioactive atom or group, such as 125 I or 32 P.
  • non-radioactive labels include enzymatic labels, such as horseradish peroxidase or fluorimetric labels, such as fluorescein-5-isothiocyanate (FITC) . Labeling may be direct or indirect, covalent or non- covalent.
  • enzymatic labels such as horseradish peroxidase or fluorimetric labels, such as fluorescein-5-isothiocyanate (FITC) . Labeling may be direct or indirect, covalent or non- covalent.
  • Clinical applications of the invention include diagnostic applications, acceleration of angiogenesis in tissue or organ transplantation, or stimulation of wound healing, or connective tissue development, or to establish collateral circulation in tissue infarction or arterial stenosis, such as coronary artery disease, and inhibition of angiogenesis in the treatment of cancer or of diabetic retinopathy and inhibition of tissue remodeling that takes place during invasion of tumor cells into a normal cell population by primary or metastatic tumor formation.
  • Quantitation of PDGF-C in cancer biopsy specimens may be useful as an indicator of future metastatic risk.
  • PDGF-C may also be relevant to a variety of lung conditions. PDGF-C assays could be used in the diagnosis of various lung disorders. PDGF-C could also be used in the treatment of lung disorders to improve blood circulation in the lung and/or gaseous exchange between the lungs and the blood stream. Similarly, PDGF-C could be used to improve blood circulation to the heart and 0 2 gas permeability in cases of cardiac insufficiency. In a like manner, PDGF-C could be used to improve blood flow and gaseous exchange in chronic obstructive airway diseases.
  • the invention provides a method of stimulation of angiogenesis, lymphangiogenesis, neovascularization, connective tissue development and/or wound healing in a mammal in need of such treatment, comprising the step of administering an effective dose of PDGF-C, or a fragment or an analog thereof which has the biological activity of PDGF-C to the mammal.
  • the PDGF-C, or fragment or analog thereof may be administered together with, or in conjunction with, one or more of VEGF, VEGF-B, VEGF-C, VEGF-D, P1GF, PDGF- A, PDGF-B, FGF and/or heparin.
  • PDGF-C antagonists e.g.
  • antibodies and/or competitive or noncompetitive inhibitors of binding of PDGF-C in both dimer formation and receptor binding could be used to treat conditions, such as congestive heart failure, involving accumulation of fluid in, for example, the lung resulting from increases in vascular permeability, by exerting an offsetting effect on vascular permeability in order to counteract the fluid accumulation.
  • PDGF-C can also be used to treat fibrotic conditions including those found in the lung, kidney and liver.
  • Administrations of PDGF-C could be used to treat malabsorptive syndromes in the intestinal tract, liver or kidneys as a result of its blood circulation increasing and vascular permeability increasing activities .
  • the invention provides a method of inhibiting angiogenesis, lymphangiogenesis, neovascularization, connective tissue development and/or wound healing in a mammal in need of such treatment, comprising the step of administering an effective amount of an antagonist of PDGF-C to the mammal.
  • the antagonist may be any agent that prevents the action of PDGF-C, either by preventing the binding of PDGF-C to its corresponding receptor on the target cell, or by preventing activation of the receptor, such as using receptor-binding PDGF-C variants.
  • Suitable antagonists include, but are not limited to, antibodies directed against PDGF-C; competitive or non-competitive inhibitors of binding of PDGF-C to the PDGF-C receptor (s), such as the receptor- binding or PDGF-C dimer-forming but non-mitogenic PDGF-C variants referred to above; compounds that bind to PDGF-C and/or modify or antagonize its function, and anti-sense nucleotide sequences as described below.
  • a method for determining agents that bind to an activated truncated form of PDGF-C comprises contacting an activated truncated form of PDGF-C with a test agent and monitoring binding by any suitable means.
  • Agents can include both compounds and other proteins .
  • the invention provides a screening system for discovering agents that bind an activated truncated form of PDGF-C.
  • the screening system comprises preparing an activated truncated form of PDGF-C, exposing the activated truncated form of PDGF- C to a test agent, and quantifying the binding of said agent to the activated truncated form of PDGF-C by any suitable means.
  • This screening system can also be used to identify agents which inhibit the proteolytic cleavage of the full length PDGF-C protein and thereby prevent the release of the activated truncated form of PDGF-C. For this use, the full length PDGF-C must be prepared.
  • This screen system provides a means to determine compounds that may alter the biological function of PDGF-C.
  • This screening method may be adapted to large-scale, automated procedures such as a PANDEX ® (Baxter-Dade Diagnostics) system, allowing for efficient high-volume screening of potential therapeutic agents.
  • an activated truncated form of PDGF-C or full length PDGF-C is prepared as described herein, preferably using recombinant DNA technology.
  • a test agent e.g. a compound or protein
  • Binding of the test agent to the activated truncated form of or full length PDGF-C is determined by any suitable means which include, but is not limited to, radioactively- or chemically-labeling the test agent. Binding of the activated truncated form of or full length PDGF-C may also be carried out by a method disclosed in U.S.
  • Patent 5,585,277 which is incorporated by reference.
  • binding of the test agent to the activated truncated form of or full length PDGF-C is assessed by monitoring the ratio of folded protein to unfolded protein. Examples of this monitoring can include, but are not limited to, monitoring the sensitivity of the activated truncated form of or full length PDGF-C to a protease, or amenability to binding of the protein by a specific antibody against the folded state of the protein.
  • IC 50 values are dependent on the selectivity of the agent tested. For example, an agent with an IC 50 which is less than 10 nM is generally considered an excellent candidate for drug therapy. However, an agent which has a lower affinity, but is selective for a particular target, may be an even better candidate. Those skilled in the art will recognize that any information regarding the binding potential, inhibitory activity or selectivity of a particular agent is useful toward the development of pharmaceutical products.
  • a PDGF-C or a PDGF-C antagonist is to be used for therapeutic purposes
  • the dose(s) and route of administration will depend upon the nature of the patient and condition to be treated, and will be at the discretion of the attending physician or veterinarian. Suitable routes include oral, subcutaneous, intramuscular, intraperitoneal or intravenous injection, parenteral, topical application, implants etc .
  • Topical application of PDGF-C may be used in a manner analogous to VEGF.
  • an effective amount of the truncated active form of PDGF-C is administered to an organism in need thereof in a dose between about 0.1 and 1000 ⁇ g/kg body weight.
  • the PDGF-C or a PDGF-C antagonist may be employed in combination with a suitable pharmaceutical carrier.
  • the resulting compositions comprise a therapeutically effective amount of PDGF-C or a PDGF-C antagonist, and a pharmaceutically acceptable non-toxic salt thereof, and a pharmaceutically acceptable solid or liquid carrier or adjuvant.
  • Such a carrier or adjuvant examples include, but are not limited to, saline, buffered saline, Ringer's solution, mineral oil, talc, corn starch, gelatin, lactose, sucrose, microcrystalline cellulose, kaolin, mannitol, dicalcium phosphate, sodium chloride, alginic acid, dextrose, water, glycerol, ethanol, thickeners, stabilizers, suspending agents and combinations thereof.
  • Such compositions may be in the form of solutions, suspensions, tablets, capsules, creams, salves, elixirs, syrups, wafers, ointments or other conventional forms . The formulation to suit the mode of administration.
  • Compositions which comprise PDGF-C may optionally further comprise one or more of PDGF-A, PDGF-B, VEGF, VEGF-B, VEGF-C, VEGF-D, PlGF and/or heparin.
  • Compositions comprising PDGF-C will contain from about 0.1% to 90% by weight of the active compound (s) , and most generally from about 10% to 30%.
  • a sterile formulation preferably a suitable soluble salt form of the truncated active form of PDGF-C, such as hydrochloride salt
  • a pharmaceutical diluent such as pyrogen-free water (distilled) , physiological saline or 5% glucose solution.
  • a suitable insoluble form of the compound may be prepared and administered as a suspension in an aqueous base or a pharmaceutically acceptable oil base, e.g. an ester of a long chain fatty acid such as ethyl oleate.
  • the invention provides diagnostic/prognostic devices typically in the form of test kits.
  • a diagnostic/prognostic test kit comprising an antibody to PDGF-C and a means for detecting, and more preferably evaluating, binding between the antibody and PDGF- C.
  • a second antibody directed against antibodies of the same isotype and animal source of the antibody directed against PDGF-C (the primary antibody) is provided.
  • the secondary antibody is coupled to a detectable label, and then either an unlabeled primary antibody or PDGF-C is substrate-bound so that the PDGF-C/primary antibody interaction can be established by determining the amount of label bound to the substrate following binding between the primary antibody and PDGF-C and the subsequent binding of the labeled secondary antibody to the primary antibody.
  • the diagnostic/prognostic device may be provided as a conventional enzyme-linked immunosorbent assay (ELISA) kit.
  • a diagnostic/prognostic device may comprise polymerase chain reaction means for establishing sequence differences of a PDGF-C of a test individual and comparing this sequence structure with that disclosed in this application in order to detect any abnormalities, with a view to establishing whether any aberrations in PDGF-C expression are related to a given disease condition.
  • a diagnostic/prognostic device may comprise a restriction length polymorphism (RFLP) generating means utilizing restriction enzymes and genomic DNA from a test individual to generate a pattern of DNA bands on a gel and comparing this pattern with that disclosed in this application in order to detect any abnormalities, with a view to establishing whether any aberrations in PDGF-C expression are related to a given disease condition.
  • RFLP restriction length polymorphism
  • the invention relates to a method of detecting aberrations in PDGF-C gene in a test subject which may be associated with a disease condition in the test subject.
  • This method comprises providing a DNA or RNA sample from said test subject; contacting the DNA sample or RNA with a set of primers specific to PDGF-C DNA operatively coupled to a polymerase and selectively amplifying PDGF-C DNA from the sample by polymerase chain reaction, and comparing the nucleotide sequence of the amplified PDGF-C DNA from the sample with the nucleotide sequences shown in Figure 1 (SEQ ID NO: 2) or Figure 3 (SEQ ID NO: 5) .
  • the invention also includes the provision of a test kit comprising a pair of primers specific to PDGF-C DNA operatively coupled to a polymerase, whereby said polymerase is enabled to selectively amplify PDGF-C DNA from a DNA sample.
  • the invention also provides a method of detecting PDGF-C in a biological sample, comprising the step of contacting the sample with a reagent capable of binding PDGF-C, and detecting the binding.
  • a reagent capable of binding PDGF-C is an antibody directed against PDGF-C, particularly preferably a monoclonal antibody.
  • the binding and/or extent of binding is detected by means of a detectable label; suitable labels are discussed above.
  • the invention in another aspect, relates to a protein dimer comprising the PDGF-C polypeptide, particularly a disulfide-linked dimer.
  • the protein dimers of the invention include both homodimers of PDGF-C polypeptide and heterodimers of PDGF-C and VEGF, VEGF-B, VEGF-C, VEGF-D, P1GF, PDGF-A or PDGF-B.
  • a method for isolation of PDGF-C comprising the step of exposing a cell which expresses PDGF-C to heparin to facilitate release of PDGF-C from the cell, and purifying the thus-released PDGF-C.
  • Another aspect of the invention involves providing a vector comprising an anti-sense nucleotide sequence which is complementary to at least a part of a DNA sequence which encodes PDGF-C or a fragment or analog thereof that has the biological activity of PDGF-C.
  • the anti-sense nucleotide sequence can be to the promoter region of the PDGF- C gene or other non-coding region of the gene which may be used to inhibit, or at least mitigate, PDGF-C expression.
  • such a vector comprising an anti-sense sequence may be used to inhibit, or at least mitigate, PDGF-C expression.
  • a vector of this type to inhibit PDGF-C expression is favored in instances where PDGF-C expression is associated with a disease, for example where tumors produce PDGF-C in order to provide for angiogenesis, or tissue remodeling that takes place during invasion of tumor cells into a normal cell population by primary or metastatic tumor formation. Transformation of such tumor cells with a vector containing an anti-sense nucleotide sequence would inhibit or retard growth of the tumor or tissue remodeling.
  • Another aspect of the invention relates to the discovery that the full length PDGF-C protein is likely to be a latent growth factor that needs to be activated by proteolytic processing to release an active PDGF/VEGF homology domain.
  • a putative proteolytic site is found in residues 231-234 in the full length protein, residues -RKSR- . This is a dibasic motif. This site is structurally conserved in the mouse PDGF- C.
  • the -RKSR- putative proteolytic site is also found in PDGF-A, PDGF-B, VEGF-C and VEGF-D. In these four proteins, the putative proteolytic site is also found just before the minimal domain for the PDGF/VEGF homology domain. Together these facts indicate that this is the proteolytic site.
  • Preferred proteases include, but are not limited, to plasmin, Factor X and enterokinase .
  • the N-terminal CUB domain may function as an inhibitory domain which might be used to keep PDGF-C in a latent form in some extracellular compartment and which is removed by limited proteolysis when PDGF-C is needed.
  • a method for producing an activated truncated form of PDGF-C or for regulating receptor-binding specificity of PDGF-C comprise the steps of expressing an expression vector comprising a polynucleotide encoding a polypeptide having the biological activity of PDGF-C and supplying a proteolytic amount of at least one enzyme for processing the expressed polypeptide to generate the activated truncated form of PDGF-C.
  • This aspect also includes a method for selectively activating a polypeptide having a growth factor activity.
  • This method comprises the step expressing an expression vector comprising a polynucleotide encoding a polypeptide having a growth factor activity, a CUB domain and a proteolytic site between the polypeptide and the CUB domain, and supplying a proteolytic amount of at least one enzyme for processing the expressed polypeptide to generate the activated polypeptide having a growth factor activity.
  • this aspect includes the isolation of a nucleic acid molecule which codes for a polypeptide having the biological activity of PDGF-C and a polypeptide thereof which comprises a proteolytic site having the amino acid sequence
  • RKSR or a structurally conserved amino acid sequence thereof.
  • this aspect includes an isolated dimer comprising an activated monomer of PDGF-C and an activated monomer of
  • VEGF, VEGF-B, VEGF-C, VEGF-D, PDGF-C, PDGF-A, PDGF-B or P1GF linked to a CUB domain or alternatively, an activated monomer of VEGF, VEGF-B, VEGF-C, VEGF-D, PDGF-C, PDGF-A, PDGF-B or P1GF and an activated monomer of PDGF-C linked to a CUB domain.
  • the isolated dimer may or may not include a proteolytic site between the activator monomer and the CUB domain linkage.
  • Polynucleotides of the invention such as those described above, fragments of those polynucleotides, and variants of those polynucleotides with sufficient similarity to the non- coding strand of those polynucleotides to hybridize thereto under stringent conditions all are useful for identifying, purifying, and isolating polynucleotides encoding other, non- human, mammalian forms of PDGF-C.
  • Exemplary stringent hybridization conditions are as follows: hybridization at 42°C in 5X SSC, 20 mM NaP0 4 , pH 6.8, 50% formamide; and washing at 42°C in 0.2X SSC.
  • purified and isolated polynucleotides encoding other, non-human, mammalian PDGF-C forms also are aspects of the invention, as are the polypeptides encoded thereby and antibodies that are specifically immunoreactive with the non- human PDGF-C variants.
  • the invention includes a purified and isolated mammalian PDGF-C polypeptide and also a purified and isolated polynucleotide encoding such a polypeptide .
  • nucleic acids and polypeptides of the invention may be prepared by synthetic means or by recombinant means, or may be purified from natural sources .
  • Figure 1 shows the complete nucleotide sequence of cDNA encoding a human PDGF-C (hPDGF-C) (2108 bp) ;
  • Figure 2 shows the deduced amino acid sequence of full-length hPDGF-C which consists of 345 amino acid residues (the translated part of the cDNA corresponds to nucleotides 37 to 1071 of Figure 1) ;
  • Figure 3 shows a cDNA sequence encoding a fragment of human PDGF-C (hPDGF-C) (1536 bp) ;
  • Figure 4 shows a deduced amino acid sequence of a fragment of hPDGF-C (translation of nucleotides 3 to 956 of the nucleotide sequence of Figure 3);
  • Figure 5 shows a nucleotide sequence of a murine PDGF-C (mPDGF-C) cDNA
  • Figure 6 shows the deduced amino acid sequence of a fragment of mPDGF-C(the translated part of the cDNA corresponds to nucleotides 196 to 1233 of Figure 5);
  • Figure 7 shows a comparative sequence alignment of the hPDGF-C amino acid sequence of Figure 2 (SEQ ID NO: 3) with the mPDGF-C amino acid sequence of Figure 6 (SEQ ID NO:7);
  • Figure 8 shows a schematic structure of mPDGF-C with a signal sequence (striped box), a N-terminal Clr/Cls/embryonic sea urchin protein Uegf/bone morphogenetic protein 1 (CUB) domain and the C-terminal PDGF/VEGF-homology domain (open boxes) ;
  • Figure 9 shows a comparative sequence alignment of the PDGF/VEGF-homology domains in human and mouse PDGF-C with other members of the VEGF/PDGF family of growth factors (SEQ ID NOs:8-17, respectively);
  • Figure 10 shows a phylogenetic tree of several growth factors belonging to the VEGF/PDGF family;
  • Figure 11 provides the amino acid sequence alignment of the CUB domain present in human and mouse PDGF-Cs (SEQ ID NO: 1
  • Figure 12 shows a Northern blot analysis of the expression of PDGF-C transcripts in several human tissues
  • Figure 13 shows the regulation of PDGF-C mRNA expression by hypoxia; and Figure 14 shows the expression of PDGF-C in human tumor cell lines.
  • Figure 15 shows the results of immunoblot detection of full length human PDGF-C in transfected COS-1 cells.
  • Figure 16 shows isolation and partial characterization of full length PDGF-C.
  • Figure 17 shows isolation and partial characterization of a truncated form of human PDGF-C containing the PDGF/VEGF homology domain only.
  • Figure 18 provides a standard curve for the binding of labeled PDGF-BB homodimers to PAE-1 cells expressing PDGF alpha receptor.
  • Figure 19 provides a graphic representation of the inhibition of binding of labeled PDGF-BB to PAE-1 cells expressing PDGF alpha receptor by increasing amounts of purified full length and truncated PDGF-CC proteins.
  • Figure 20 shows the effects of the full length and truncated PDGF-CC homodimers on the phosphorylation of PDGF alpha-receptor .
  • Figure 21 shows the mitogenic activities of the full length and truncated PDGF-CC homodimers on fibroblasts.
  • Figure 22 graphically presents the results of the binding assay of truncated PDGF-C to the PDGF receptors.
  • Figure 23 shows the immunoblot of the undigested full length PDGF-C protein and the plasmin-generated 26-28 kDa species.
  • Figure 24 graphically presents the results of the competitive binding assay of full-length PDGF-C and truncated PDGF-C for PDGFR-alpha receptors .
  • Figure 25 shows the analyses by SDS-PAGE of the human PDGF-C CUB domain under reducing and non-reducing conditions .
  • Figures 26A-26V show PDGF-C expression in the developing mouse embryo.
  • Figures 27A-27F show PDGF-C, PDGF-A and PDGFR-alpha expression in the developing kidney.
  • Figures 28A-28F show histology of E 16.5 kidneys from wildtype ( Figures 28A and 28C) , PDGFR-alpha -/- ( Figures 28B and 28F, PDGF-A -/- ( Figure 28D) and PDGF-A/PDGF-B double -/- ( Figure 28E) kidneys.
  • Figure 1 shows the complete nucleotide sequence of cDNA encoding a human PDGF-C (hPDGF-C) (2108 bp) , which is a new member of the VEGF/PDGF family.
  • hPDGF-C human PDGF-C
  • encoding hPDGF-C was not full length and lacked approximately 80 base pairs of coding sequence when compared to the mouse protein (corresponding to 27 amino acids). Additional cDNA clones were isolated from a human fetal lung cDNA library to obtain an insert which included this missing sequence. Clone #10 had a longer insert than clone #4. The insert of clone #10 was sequenced in the 5' region and it was found to contain the missing sequence. Clone #10 was found to include the full sequence of human PDGF-C.
  • Figure 1 SEQ ID NO:2
  • a stop codon in frame is located 21 bp upstream of the initiation ATG (the initiation ATG is underlined in Figure
  • oligonucleotides were used to amplify by polymerase chain reaction (PCR) a polynucleotide of 348 bps from a Human Fetal Lung 5' -STRETCH PLUS ⁇ gtlO cDNA library, which was obtained commercially from Clontech.
  • the PCR product was cloned into the pCR 2.1-vector of the Original TA Cloning Kit (Invitrogen) . Subsequently, the 348 bps cloned PCR product was used to construct a hPDGF-C probe according to standard techniques.
  • the translated portion of this cDNA includes nucleotides 6 to 956.
  • the deduced amino acid sequence of the translated portion of the insert is illustrated in Figure 4 (SEQ ID NO:5) .
  • a polypeptide of this deduced amino acid sequence would lack the first 28 amino acid residues found in the full length hPDGF-C polypeptide. However, this polypeptide includes a proteolytic fragment which is sufficient to activate the PDGF alpha receptors. It should be noted that the first glycine (Gly) of SEQ ID NO: 5 is not found in the full length hPDGF-C.
  • a mouse EST sequence (AI020581) was identified in a database search of the dbEST database at the NCBI in Washington, DC, which appears to encode part of a new mouse PDGF, PDGF-C. Large parts of the mouse cDNA was obtained by PCR amplification using DNA from a mouse embryo ⁇ gtlO cDNA library as the template.
  • a sense primer derived from the mouse EST sequence was used (the sequence of this primer was 5' -CTT CAG TAC CTT GGA AGA G, primer 1 (SEQ ID NO:27))
  • an antisense primer derived from the mouse EST was used (the sequence of this primer was 5' -CGC TTG ACC AGG AGA CAA C, primer 2 (SEQ ID NO:28)) .
  • the ⁇ gtlO vector primers were sense 5' -ACG TGA ATT CAG CAA GTT CAG CCT GGT TAA (primer 3 (SEQ ID NO:29)) and antisense 5'-ACG TGG ATC CTG AGT ATT TCT TCC AGG GTA (primer 4 (SEQ ID NO:30)). Combinations of the vector primers and the internal primers obtained from the mouse EST were used in standard PCR reactions. The sizes of the amplified fragments were approx. 750 bp (3' -fragment ) and 800 bp (5' -fragment ) , respectively.
  • Figure 7 shows a comparative sequence alignment of the mouse and human amino acid sequences of PDGF-C (SEQ ID NOS : 6 and 2, respectively).
  • the alignment shows that human and mouse PDGF-Cs display an identity of about 87% with 45 amino acid replacements found among the 345 residues of the full length proteins. Almost all of the observed amino acid replacements are conservative in nature.
  • the predicted cleavage site in mPDGF-C for the signal peptidase is between residues G19 and T20. This would generate a secreted mouse peptide of 326 amino acid residues.
  • Figure 8 provides a schematic domain structure of mouse PDGF-C with a signal sequence (striped box) , a N-terminal CUB domain and the C-terminal PDGF/VEGF-homology domain (open boxes) .
  • the amino acid sequences denoted by the lines have no obvious similarities to CUB domains or to VEGF-homology domains .
  • PDGF-C have an almost identical domain structure. Amino acid sequence comparisons revealed that both mouse and human PDGF-C display a novel domain structure. Apart from the PDGF/VEGF- homology domain located in the C-terminal region in both proteins (residues 164 to 345), the N-terminal region in both PDGF-Cs have a domain referred to as a CUB domain (Bork and Beckmann, J. Mol. Biol., 1993 231, 539-545).
  • This domain of about 110 amino acids was originally identified in complement factors Clr/Cls, but has recently been identified in several other extracellular proteins including signaling molecules such as bone morphogenic protein 1 (BMP-1) (Wozney et al . , Science, 1988 242 , 1528-1534) as well as in several receptor molecules such as neuropilin-1 (NP-1) (Soker et al . , Cell, 1998 92 735-745).
  • BMP-1 bone morphogenic protein 1
  • NP-1 neuropilin-1
  • PDGF-C has the expected pattern of invariant cysteine residues, a hallmark of members of this family, with one exception. Between cysteine 3 and 4, normally spaced by 2 residues there is an insertion of three extra amino acids (NCA) . This feature of the sequence in PDGF-C was highly unexpected.
  • Figure 12 shows a Northern blot analysis of the expression of PDGF-C transcripts in several human tissues. The analysis shows that PDGF-C is encoded by a major transcript of approximately 3.8-3.9 kb, and a minor of 2.8 kb . The numbers to the right refer to the size of the mRNAs (in kb) .
  • the tissue expression of PDGF-C was determined by Northern blotting using a commercial Multiple Tissue Northern blot (MTN, Clontech) .
  • the blots were hybridized at according to the instructions from the supplier using ExpressHyb solution at 68°C for one hour (high stringency conditions), and probed with a 353 bp hPDGF-C EST probe from the fetal lung cDNA library screening as described above.
  • the blots were subsequently washed at 50°C in 2X SSC with 0.05% SDS for 30 minutes and at 50°C in 0. IX SSC with 0.1% SDS for an additional 40 minutes.
  • the blots were then put on film and exposed at -70°C.
  • PDGF-C transcripts are most abundant in heart, liver, kidney, pancreas and ovary while lower levels of transcripts are present in most other tissues, including placenta, skeletal muscle and prostate.
  • PDGF-C transcripts were below the level of detection in spleen, colon and peripheral blood leucocytes.
  • Figure 13 shows the regulation of PDGF-C mRNA expression by hypoxia. Size markers (in kb) are indicated to the left in the lower panel. The estimated sizes of PDGF-C mRNAs is indicated to the left in the upper panel (2.7 and 3.5 kbs, respectively) .
  • Poly (A) + mRNA was isolated from cells using oligo-dT cellulose affinity purification. Isolated mRNAs were electrophoresed through 12% agarose gels using 4 ⁇ g of mRNA per line. A Northern blot was made and hybridized with a probe for PDGF-C.
  • the sizes of the two bands were determined by hybridizing the same filter with a mixture of hVEGF, hVEGF-B and hVEGF-C probes (Enholm et al . Oncogene, 1997 14 . 2475-2483), and interpolating on the basis of the known sizes of these mRNAs.
  • the results shown in Figure 13 indicate that PDGF-C is not regulated by hypoxia in human skin fibroblasts.
  • Figure 14 shows the expression of PDGF-C mRNA in human tumor cells lines.
  • poly (A) - mRNA was isolated from several known tumor cell lines, the mRNAs were electrophoresed through a 12% agarose gel and analyzed by Northern blotting and hybridization with the PDGF-C probe.
  • PDGF-C mRNA is expressed in several types of human tumor cell lines such as JEG3 (a human choriocarcinoma, ATCC #HTB-36) , G401 (a Wilms tumor, ATCC #CRL-1441) , DAMI (a megakaryoblastic leukemia) , A549 (a human lung carcinoma, ATCC #CCL-185) and HEL (a human erythroleukemia, ATCC #TID-180) . It is contemplated that further growth of these PDGF-C expressing tumors can be inhibited by inhibiting PDGF-C. As well as using PDGF-C expression as a means of identifying specific types of tumors.
  • JEG3 a human choriocarcinoma, ATCC #HTB-36
  • G401 a Wilms tumor, ATCC #CRL-1441
  • DAMI a megakaryoblastic leukemia
  • A549 a human lung carcinoma
  • HEL a human ery
  • Example 1 Generation of specific antipeptide antibodies to human PDGF-C
  • the first synthetic peptide corresponds to residues 29-48 of the N-terminus of full length PDGF-C and includes an extra cysteine residue at the N- and C-terminus: CKFQFSSNKEQNGVQDPQHERC (SEQ ID NO: 31) .
  • the second synthetic peptide corresponds to residues 230-250 of the internal region of full length PDGF-C and includes an extra cysteine residue at the C-terminus : GRKSRVVDLNLLTEEVRLYSC (SEQ ID NO: 32) .
  • the two peptides were each conjugated to the carrier protein keyhole limpet hemocyanin (KLH, Calbiochem) using N-succinimidyl 3- (2-pyridyldithio) propionate (SPDP) (Pharmacia Inc.) according to the instructions of the supplier.
  • SPDP N-succinimidyl 3- (2-pyridyldithio) propionate
  • 200-300 micrograms of the conjugates in phosphate buffered saline (PBS) were separately emulsified in Freunds Complete Adjuvant and injected subcutaneously at multiple sites in rabbits.
  • the rabbits were boostered subcutaneously at biweekly intervals with the same amount of the conjugates emulsified in Freunds Incomplete Adjuvant. Blood was drawn and collected from the rabbits .
  • the sera were prepared using standard procedures known to those skilled in the art.
  • Example 2 Expression of full length human PDGF-C in mammalian cells
  • the full length cDNA encoding human PDGF-C was cloned into the mammalian expression vector, pSG5 (Stratagene, La Jolla, CA) that has the SV40 promoter.
  • COS-1 cells were transfected with this construct and in separate transfections, with a pSG5 vector without the cDNA insert for a control, using the DEAE-dextran procedure. Serum free medium was added to the transfected COS-1 cells 24 hours after the transfections and aliquots containing the secreted proteins were collected for a 24 hour period after the addition of the medium.
  • the sample was only partially reduced and the monomer of the human PDGF-C migrated as a 55 kDa species (the lower band) and the dimer migrated as a 100 kDa species (upper band) . This indicates that the protein is secreted intact and that no major proteolytic processing occurs during secretion of the molecule in mammalian cells.
  • Example 3 Expression of full length and truncated human PDGF-C in baculovirus infected Sf9 cells
  • the full length coding part of the human PDGF-C cDNA (970 bp) was amplified by PCR using Deep Vent DNA polymerase
  • the full length PDGF-C was amplified for 30 cycles, where each cycle consisted of one minute denaturization at 94°C, one minute annealing at 56°C and two minutes extension at 72°C.
  • the forward primer used was 5 ' CGGGATCCCGAATCCAACCTGAGTAG ' (SEQ ID NO: 33) . This primer includes a BamHI site (underlined) for in frame cloning.
  • the reverse primer used was 5 ' GGAATTCCTAATGGTGATGGTGATGATGTTTGTCATCGTCATCTCCTCCTGTGCTCTC
  • PVHD PDGF/VEGF homology domain
  • Biolabs Deep Vent DNA polymerase
  • the residues 230- 345 of the PVHD of PDGF-C were amplified for 25 cycles, where each cycle consisted of one minute denaturization at 94°C, four minutes annealing at 56°C and four minutes extension at 72 °C.
  • the forward primer used was 5 ' CGGATCCCGGAAGAAAATCCA GAGTGGTG3 ' (SEQ ID NO: 35) . This primer includes a BamHI site (underlined) for in frame cloning.
  • the reverse primer used was 5 ' GGAATTCCTAATGGTGATGGTGATGATGTTTGTCATCGTCATCTCCTCCTGTG CTCCCTCT-3' (SEQ ID NO:36).
  • This primer includes an EcoRI site (underlined) and sequences coding for a C-terminal 6X His tag preceded by an enterokinase site.
  • the PCR products were digested with BamHI and EcoRI and subsequently cloned into the baculovirus expression vector, pAcGP67A. Verification of the correct sequence of the PCR products cloned into the constructs was by nucleotide sequencing.
  • the expression vectors were then co-transfected with BaculoGold linearized baculovirus DNA into Sf9 insect cells according to the manufactures protocol (Pharmingen) . Recombined baculovirus were amplified several times before beginning large scale protein production and protein purification according to the manual (Pharmingen) .
  • Sf9 cells adapted to serum free medium, were infected with recombinant baculovirus at a multiplicity of infection of about 7.
  • Media containing the recombinant proteins were harvested 4 days after infection and were incubated with Ni-NTA-Agarose beads (Qiagen) .
  • the beads were collected in a column and after extensive washing with 50 mM sodium phosphate buffer pH 8, containing 300 mM NaCl (the washing buffer) , the bound proteins were eluted with increasing concentrations of imidazole (from 100 mM to 500 mM) in the washing buffer.
  • the eluted proteins were analyzed by SDS- PAGE using 12.5% polyacrylamide gels under reducing and non-reducing conditions.
  • FIGS 16A-C show the isolation and partial characterization of full length human PDGF-C protein.
  • the recombinant full length protein was visualized on the blot using antipeptide antibodies against the N-terminal peptide (described above).
  • Figure 16B the recombinant full length protein was visualized on the blot using antipeptide antibodies against the internal peptide (described above) .
  • the separated proteins were visualized by staining with Coomassie Brilliant Blue (Figure 16C) .
  • Figures 16A-C refer to the concentration of imidazole used to elute the protein from the Ni-NTA column and are expressed in molarity (M) .
  • Figures 16A-C also show that the full length protein migrates as a 90 kDa species under non-reducing conditions and as a 55 kDa species under reducing conditions. This indicates that the full length protein was expressed as a disulfide-linked dimer.
  • Figures 17A-C show the analysis of the isolation and partial characterization of a truncated form of human PDGF- C containing the PDGF/VEGF homology domain only.
  • the immunoblot analysis of fractions eluted from the Ni-agarose column demonstrates that the protein could be eluted at imidazole concentrations ranging between 100-500 mM.
  • the eluted fractions were analyzed under non-reducing conditions, and the truncated human PDGF-C was visualized on the blot using antipeptide antibodies against the internal peptide (described above) .
  • Figure 17B shows the Coomassie Brilliant Blue staining of the same fractions as in Figure 17A. This shows that the procedure generates highly purified material migrating as a 36 kDa species.
  • Figure 17C shows the Coomassie Brilliant Blue staining of non-reduced (non-red.) and reduced (red.) truncated human PDGF-C protein.
  • the data show that the protein is a secreted dimer held together by disulfide bonds and that the monomer migrates as a 24 kDa species.
  • full length and truncated PDGF-C were tested for their capacity to bind to soluble Ig-fusion proteins containing the extracellular domains of human VEGFR-1, VEGFR-2 and VEGFR-3 (Olofsson et al . , Proc. Natl. Acad. Sci. USA, 1998 95 11709-11714).
  • the fusion proteins designated VEGFR-1-Ig, VEGFR-2-Ig and VEGFR-3-Ig, were transiently expressed in human 293 EBNA cells. All Ig fusion proteins were human VEGFRs .
  • DMEM Dulbecco's Modified Eagle Medium
  • bovine serum albumin 0.2% bovine serum albumin
  • the fusion proteins were then precipitated from the clarified conditioned medium using protein A-Sepharose beads (Pharmacia) .
  • the beads were combined with 100 microliters of 10X binding buffer (5% bovine serum albumin, 0.2% Tween 20 and 10 ⁇ g/ml heparin) and 900 microliter of conditioned medium from 293 cells that had been transfected with mammalian expression plasmids encoding full length or truncated PDGF-C or control vector, then metabolically labeled with 35 S-cysteine and methionine (Promix, Amersham) for 4 to 6 hours. After 2.5 hours, at room temperature, the Sepharose beads were washed 3 times with binding buffer at 4°C, once with phosphate buffered saline and boiled in SDS-PAGE buffer. Labeled proteins that were bound to the
  • Ig-fusion proteins were analyzed by SDS-PAGE under reducing conditions. Radiolabeled proteins were detected using a phosphorimager analyzer. In all these analyses, radiolabeled PDGF-C failed to show any interaction with any of the VEGF receptors.
  • PDGF-C full length and truncated PDGF-C were tested for their capacity to bind to human PDGF receptors alpha and beta by analyzing their abilities to compete with PDGF-BB for binding to PDGF receptors .
  • the binding experiments were performed on porcine aortic endothelial-1 (PAE-1) cells stably expressing the human PDGF receptors alpha and beta (Eriksson et al . , EMBO J, 1992, _ ⁇ _, 543-550). Binding experiments were performed essentially as in Heldin et al . (EMBO J, 1988, 1 1387-1393) .
  • FIG. 18 A standard curve for the binding of 125 I-labeled PDGF BB homodimers to PAE-1 cells expressing PDGF alpha-receptor is shown in Figure 18. An increasing excess of the unlabeled protein added to the incubations competed efficiently with cell association of the radiolabeled tracer.
  • Figure 19 graphically shows that the truncated PDGF-C efficiently competed for binding to the PDGF alpha- receptor, while the full length protein did not. Both the full length and truncated proteins failed to compete for binding to the PDGF beta-receptor.
  • PDGF-C causes increased phosphorylation of the PDGF alpha-receptor
  • full length and truncated PDGF-C were tested for their capacity to bind to the PDGF alpha- receptor and stimulate increased phosphorylation.
  • Serum- starved porcine aortic endothelial (PAE) cells stably expressing the human PDGF alpha-receptor were incubated on ice for 90 minutes with PBS supplemented with 1 mg/ml BSA and lOng/ml of PDGF-AA, lOOng/ l of full length human PDGF- CC homodimers (flPDGF-CC), lOOng/ml of truncated PDGF-CC homodimers (cPDGF-CC) , or a mixture of lOng/ml of PDGF-AA and lOOng/ml of truncated PDGF-CC.
  • PBS Serum- starved porcine aortic endothelial
  • PDGF-CC homodimers were produced as described above. Sixty minutes after the addition of the polypeptides, the cells were lysed in lysis buffer (20 mM tris-HCl, pH 7.5, 0.5% Triton X-100, 0.5% deoxycholic acid, 10 mM EDTA, 1 mM orthovanadate, 1 M PMSF 1% Trasylol) .
  • the PDGF alpha-receptors were immunoprecipitated from cleared lysates with rabbit antisera against the human PDGF alpha-receptor (Eriksson et al . , EMBO J, 1992 1_1 543-550).
  • the precipitated receptors were applied to a SDS-PAGE gel. After SDS gel electrophoresis, the precipitated receptors were transferred to nitrocellulose filters, and the filters were probed with anti-phosphotyrosine antibody PY-20, (Transduction Laboratories) . The filters were then incubated with horseradish peroxidase-conjugated anti-mouse antibodies. Bound antibodies were detected using enhanced chemiluminescence (ECL, Amersham Inc) . The filters were then stripped and reprobed with the PDGF alpha-receptor rabbit antisera, and the amount of receptors was determined by incubation with horseradish peroxidase-conjugated anti- rabbit antibodies.
  • Bound antibodies were detected using enhanced chemiluminescence (ECL, Amersham Inc) .
  • ECL enhanced chemiluminescence
  • the probing of the filters with PDGF alpha-receptor antibodies confirmed that equal amounts of the receptor were present in all lanes.
  • PDGF-AA is included in the experiment as a control.
  • Figure 20 shows that truncated, but not full length PDGF-CC, efficiently induced PDGF alpha-receptor tyrosine phosphorylation. This indicates that truncated PDGF-CC is a potent PDGF alpha-receptor agonist.
  • Figure 21 shows the mitogenic activities of truncated and full length PDGF-CC on fibroblasts.
  • the assay was performed essentially as described in Mori et al . , J. Biol. Chem., 1991 266 21158-21164. Serum starved human foreskin fibroblasts were incubated for 24 hours with 1 ml of serum- free medium supplemented with 1 mg/ml BSA and 3ng/ml, lOng/ml or 30ng/ml of full length PDGF-CC (flPDGF-CC), truncated PDGF-CC (cPDGF-CC) or PDGF-AA in the presence of 0.2 ⁇ mCi [3H] thymidine .
  • trichloroacetic acid (TCA) precipitation After trichloroacetic acid (TCA) precipitation, the incorporation of [3H] thymidine into DNA was determined using a beta-counter. The results show that truncated PDGF-CC, but not full length PDGF-CC, is a potent mitogen for fibroblasts. PDGF-AA is included in the experiment as a control.
  • PDGF-C does not bind to any of the known VEGF receptors.
  • PDGF-C is the only VEGF family member, thus far, which can bind to and increase phosphorylation of the PDGF alpha-receptor.
  • PDGF-C is also the only VEGF family member, thus far, to be a potent mitogen of fibroblasts.
  • the truncated form of PDGF-C may not be a VEGF family member, but instead a novel PDGF.
  • the full length protein is likely to be a latent growth factor that needs to be activated by proteolytic processing to release the active PDGF/VEGF homology domain.
  • a putative proteolytic site is the dibasic motif found in residues 231-234 in the full length protein, residues -R-K-S-R- . This site is structurally conserved in a comparison between mouse and human PDGF-Cs ( Figure 7) .
  • Preferred proteases include, but are not limited to, Factor X and enterokinase .
  • the N-terminal CUB domain may be expressed as an inhibitory domain which might be used to localize this latent growth factor in some extracellular compartment (for example the extracellular matrix) and which is removed by limited proteolysis when need, for example during embryonic development, tissue regeneration, tissue remodelling including bone remodelling, active angiogenesis, tumor progression, tumor invasion, metastasis formation and/or wound healing.
  • truncated PDGF-C was tested for its capacity to bind to porcine aortic endothelial-1 (PAE-1) cells expressing PDGF alpha or beta receptors, respectively (Eriksson et al . , EMBO J, 1992, 11 . 543-550).
  • PAE-1 porcine aortic endothelial-1
  • the binding experiments were performed essentially as described in Heldin et al . (EMBO J, 1988, 1_ 1387-1393) .
  • truncated PDGF-C protein Five micrograms of truncated PDGF-C protein in ten microliters of sodium borate buffer was radiolabeled using the Bolton-Hunter reagent (Amersham) to a specific activity of 4 x 10 5 cpm/ng. Different concentrations of radiolabeled truncated PDGF-C, with or without added unlabeled protein, in binding buffer (PBS containing 1 mg/ml of bovine serum albumin) was added to the receptor expressing PAE-1 cells plated in 24-well culture dishes on ice for 90 minutes.
  • binding buffer PBS containing 1 mg/ml of bovine serum albumin
  • cell-bound 125 I-labeled PDGF-C was extracted by lysis of cells in 20 mM Tris-HCl, pH 7.5, 10% glycerol, 1% Triton X-100. The amount of cell-bound radioactivity was determined in a gamma-counter. Non-specific binding was estimated by including a 100-fold molar excess of truncated PDGF-C in some experiments. All binding data represents the mean of triplicate analyses and the experimental variation in the experiment varied between 10-15%. As seen in Figure 22, truncated PDGF-C binds to cells expressing PDGF alpha receptors, but not to beta receptor expressing cells. The binding was specific as radiolabeled PDGF-C was quantitatively displaced by a 100-fold molar excess of unlabeled protein.
  • Example 8 Protease Effects on Full length PDGF-C
  • full length PDGF-C was digested with different proteases.
  • full length PDGF-C was digested with plasmin in 20 mM Tris-HCl (pH 7.5) containing 1 mM CaCl 2 , 1 mM MgCl 2 and 0.01% Tween 20 for 1.5 to 4.5 hours at 37°C using two to three units of plasmin (Sigma) per ml.
  • the released domain essentially corresponded in size to the truncated PDGF-C species previously produced in insect cells. Plasmin-digested PDGF-C and undigested full length PDGF-C were applied to a SDS-PAGE gel under reducing conditions.
  • FIG. 23 shows the immunoblot with a 55 kDa undigested full length protein and the plasmin-generated 26-28 kDa species .
  • Example 9 PDGF alpha Receptors Binding of Plasmin-digested PDGF-C
  • plasmin-digested PDGF-C was tested for its capacity to bind to porcine aortic endothelial-1 (PAE-1) cells expressing PDGF alpha receptors (Eriksson et al . , EMBO J, 1992, 11 543-550).
  • PAE-1 porcine aortic endothelial-1
  • the receptor binding analyses were performed essentially as in Example 7 using 30 ng/ml of 125 I-labeled truncated PDGF-C as the tracer.
  • increasing concentrations of plasmin-digested PDGF-C efficiently competed for binding to the PDGF alpha receptors.
  • full length PDGF-C is a latent growth factor unable to interact with PDGF alpha receptors and that limited proteolysis, which releases the C-terminal PDGF/VEGF homology domain, is necessary to generate an active PDGF alpha receptor ligand/agonist .
  • a human PDGF-C 430 bp cDNA fragment encoding the CUB domain was amplified by PCR using Deep Vent DNA polymerase (Biolabs) using standard conditions and procedures.
  • the forward primer used was 5 ' cgggatcccgaatccaacctgagtag3 ' (SEQ ID NO:38). This primer includes a BamHI site (underlined) for in clone frame cloning.
  • the reverse primer used was 5 ' ccggaattcctaatggtgatggtgatgatgtttgtcatcgtcgtcgacaatgttgta gtg3' (SEQ ID NO:39).
  • This primer includes an EcoRI site (underlined) and sequences coding for a C-terminal 6x His tag preceded by an enterokinase site.
  • the amplified PCR fragment was subsequently cloned into a pACgp67A transfer vector. Verification of the correct sequence of the expression construct, CUB-pACgp67A, was by automatic nucleotide sequencing.
  • the expression vectors were then co-transfected with BaculoGold linearized baculovirus DNA into Sf9 insect cells according to the manufacture's protocol (Pharmingen) . Recombined baculovirus were amplified several times before beginning large scale protein production and protein purification according to the manual (Pharmingen).
  • Sf9 cells adapted to serum free medium, were infected with recombinant baculovirus at a multiplicity of infection of about 7.
  • Media containing the recombinant proteins were harvested 72 hours after infection and were incubated with Ni-NTA-Agarose beads (Qiagen) overnight at 4°C.
  • the beads were collected in a column and after extensive washing with 50 mM sodium phosphate buffer pH 8, containing 300 mM NaCl (the washing buffer) , the bound proteins were eluted with increasing concentrations of imidazole (from 100 mM to 400 mM) in the washing buffer.
  • the eluted proteins were analyzed by SDS-PAGE using a polyacrylamide gel under reducing and non-reducing conditions.
  • Figure 25 shows the results from Coomassie blue staining of the gel.
  • the human PDGF-C CUB domain is a disulfide-linked homodimer with a molecular weight of about 55 KD under non-reducing conditions, while two monomers of about 25 and 30 KD respectively are present under reducing conditions.
  • the heterogeneity is probably due to heterogenous glycosylation of the two putative N-linked glycosylation sites present in the CUB domain at amino acid positions 25 and 55.
  • a protein marker lane is shown to the left in the figure.
  • PDGF-C expression in mouse embryos was localized by non- radioactive in si tu hybridization in tissue sections from the head ( Figures 26A-26S) and urogenital tract ( Figures 26T-26V) regions.
  • the non-radioactive in si tu hybridization employed protocols and PDGF-A and PDGFR-alpha probes are described in Bostr ⁇ m et al . , Cell, 1996 __5 863- 873, which is hereby incorporated by reference.
  • the PDGF-C probe was derived from a mouse PDGF-C cDNA.
  • the hybridization patterns shown in Figures 26A-26V are for embryos aged E16.5, but analogous patterns are seen at E14.5, E15.5 and E17.5. Sense probes were used as controls and gave no consistent pattern of hybridization to the sections.
  • Figure 26A shows the frontal section through the mouth cavity at the level of the tooth anlagen (t) .
  • the arrows point to sites of PDGF-C expression in the oral ectoderm.
  • Figures 26B-26D show PDGF-C expression in epithelial cells of the developing tooth canal . Individual cells are strongly labeled in this area (arrow in Figure 26D) , as well as in the developing palate ectoderm (right arrow in Figure 26C) .
  • Figure 26E shows the frontal section through the eye, where PDGF-C expression is seen in the hair follicles (double arrow) and in the developing eyelid. Also shown is the retina (r) .
  • the PDGF-C expression is found in the outer root sheath of the developing hair follicle epithelium.
  • PDGF-C expression is shown in the developing eyelid. There is an occurrence of individual strongly PDGF-C positive cells in the developing opening. Also shown is the lens (1).
  • PDGF- C expression in the developing lacrimal gland is shown by the arrow.
  • PDGF-C expression in the developing external ear is shown. Expression is seen in the external auditory meatus (left arrow) and in the epidermal cleft separating the prospective auricle (e) .
  • Figures 26K and 26L show PDGF-C expression in the cochlea.
  • FIG. 26A shows the expression of PDGF-C in the urethra (ua) and in epithelium surrounding the developing penis.
  • Figure 26V shows the PDGF-C expression in the developing ureter (u) .
  • Example 12 PDGF-C, PDGF-A and PDGFR-alpha Expression in the Developing Kidney
  • Figures 27A-27F show the results of non-radioactive in si tu hybridization demonstrating the expression (blue staining in unstained background visualized using DIC optics) of mRNA for PDGF-C ( Figures 27A and 27B) , PDGF-A ( Figures 27C and 27D) and PDGFR-alpha ( Figures 27E and 27F) in E16.5 kidneys.
  • the white hatched line in Figures 27B, 27D and 27F outlines the cortex border.
  • 27C and 27E represents 250 ⁇ m, and in Figures 27B, 27D and 27F represents 50 ⁇ m.
  • PDGF-C expression is seen in the metanephric mesenchyme (mm in Figure 27A) , and appears to be upregulated in the condensed mesenchyme (arrows in Figure 27B) undergoing epithelial conversion as a prelude to tubular development, which is situated on each side of the ureter bud (ub) .
  • PDGF-C expression remains at lower levels in the early nephronal epithelial aggregates (arrowheads in B) , but is absent from mature glomeruli (gl) and tubular structures .
  • PDGF-A expression is not seen in these early aggregates, but is strong in later stages of tubular development ( Figures 24C and 24D) .
  • PDGF-A is expressed in early nephronal epithelial aggregates (arrowheads in Figure 27D) , but once the nephron is developed further, PDGF-A expression becomes restricted to the developing Henle ' s loop (arrow in Figure 27D) .
  • the strongest expression is seen in the Henle 's loops in the developing marrow (arrows in Figure 27C) .
  • the branching ureter (u) and the ureter bud (ub) is negative for PDGF-A.
  • the PDGF-C and PDGF-A expression patterns in the developing nephron are spatially and temporally distinct.
  • PDGF-C is expressed in the earliest stages (mesenchymal aggregates) and PDGF-A in the latest stages (Henle ' s loop formation) of nephron development.
  • PDGFR-alpha is expressed throughout the mesenchyme of the developing kidney ( Figures 27E and 27F) and may hence be targeted by both PDGF-C and PDGF-A.
  • PDGF-B expression is also seen in the developing kidney, but occurs only in vascular endothelial cells.
  • PDGFR-beta expression takes place in perivascular mesenchyme, and its activation by PDGF-B is critical for mesangial cell recruitment into glomeruli .
  • PDGF-C expression occurs in close spatial relationship to sites of PDGFR- alpha expression, and are distinct from the expression sites of PDGF-A or PDGF-B. This indicates that PDGF-C may act through PDGFR-alpha in vivo, and may have functions that are not shared with PDGF-A and PDGF-B.
  • Heterozygote mutants of PDGF-A, PDGF-B and PDGFR-alpha (Bostr ⁇ m et al . , Cell, 1996 ____ 863-873; Leveen et al . , Genes Dev., 1994 8 . 1875-1887; Soriano et al . , Development, 1997 121 2691-70) were bred as C57B16/129sv hybrids and intercrossed to produce homozygous mutant embryos.
  • PDGF- A/PDGF-B heterozygote mutants were crossed to generate double PDGF-A/PDGF-B knockout embryos.
  • PDGFR-alpha knockouts have a kidney phenotype, which is not seen in PDGF-A or PDGF- A/PDGF-B knockouts, hence potentially reflecting loss of signaling by PDGF-C.
  • the phenotype consists of the marked loss of interstitial mesenchyme in the developing kidney cortex.
  • the cells lost in PDGFR-alpha -/- kidneys are thus normally PDGFR-alpha positive cells adjacent to the site of expression of PDGF-C.
  • Assays are conducted to evaluate whether PDGF-C has similar activities to PDGF-A, PDGF-B, VEGF, VEGF-B, VEGF-C and/or VEGF-D in relation to growth and/or motility of connective tissue cells, fibroblasts, myofibroblasts and glial cells; to endothelial cell function; to angiogenesis; and to wound healing. Further assays may also be performed, depending on the results of receptor binding distribution studies.
  • the PDGF-C polypeptide is introduced into cell culture medium containing 5% serum and applied to bovine aortic endothelial cells (BAEs) propagated in medium containing 10% serum.
  • BAEs bovine aortic endothelial cells
  • the BAEs are previously seeded in 24-well dishes at a density of 10,000 cells per well the day before addition of the PDGF-C. Three days after addition of this polypeptide the cells were dissociated with trypsin and counted. Purified VEGF is included in the experiment as positive control.
  • Endothelial cell growth assays are performed by methods well known in the art, e . g. those of Ferrara & Henzel, Nature, 1989 380 439-443, Gospodarowicz et al . , Proc. Natl. Acad. Sci. USA, 1989 £6 7311-7315, and/or Claffey et al . , Biochem. Biophys. Acta, 1995 1246 1-9.
  • the standard Boyden chamber chemotaxis assay is used to test the effect of PDGF-C on chemotaxis.
  • Endothelial cells are tested for the effect of PDGF-C on plasminogen activator and plasminogen activator inhibitor production, using the method of Pepper et al . , Biochem. Biophys. Res. Commun., 1991 181 902-906.
  • PDGF-C ability of PDGF-C to induce an angiogenic response in chick chorioallantoic membrane is tested as described in Leung et al . , Science, 1989 24_6 1306-1309.
  • the rat cornea assay of Rastinejad et al . , Cell, 1989 5j5 345-355 may be used; this is an accepted method for assay of in vivo angiogenesis, and the results are readily transferrable to other in vivo systems.
  • mice capable of repopulating the bone marrow of lethally irradiated mice, and have the Lin-, Rh hl , Ly-6A/E + , c-kit + phenotype.
  • PDGF-C is tested on these cells either alone, or by co-incubation with other factors, followed by measurement of cellular proliferation by 3 H- thymidine incorporation.
  • PDGF-C is incubated with these cells for a period of time, injected into lethally irradiated recipients, and the number of D13 spleen colonies enumerated.
  • Atherosclerosis Smooth muscle cells play a crucial role in the development or initiation of atherosclerosis, requiring a change of their phenotype from a contractile to a synthetic state. Macrophages, endothelial cells, T lymphocytes and platelets all play a role in the development of atherosclerotic plaques by influencing the growth and phenotypic modulations of smooth muscle cell.
  • An in vi tro assay using a modified Rose chamber in which different cell types are seeded on to opposite cover slips measures the proliferative rate and phenotypic modulations of smooth muscle cells in a multicellular environment, and is used to assess the effect of PDGF-C on smooth muscle cells.
  • PDGF-C ability of PDGF-C to inhibit metastasis is assayed using the Lewis lung carcinoma model, for example using the method of Cao et al . , J. Exp. Med., 1995 182 2069-2077.
  • PDGF-C in Other Cell Types
  • the effects of PDGF-C on proliferation, differentiation and function of other cell types, such as liver cells, cardiac muscle and other cells, endocrine cells and osteoblasts can readily be assayed by methods known in the art, such as H-thymidine uptake by in vi tro cultures.
  • Expression of PDGF-C in these and other tissues can be measured by techniques such as Northern blotting and hybridization or by in situ hybridization.
  • PDGF-C is a member of the PDGF family of growth factors which exhibits a high degree of homology to the other members of the PDGF family.
  • PDGF-C contains eight conserved cysteine residues which are characteristic of this family of growth factors. These conserved cysteine residues form intra-chain disulfide bonds which produce the cysteine knot structure, and inter-chain disulfide bonds that form the protein dimers which are characteristic of members of the PDGF family of growth factors.
  • PDGF-C interacts with a protein tyrosine kinase growth factor receptor .
  • a person skilled in the biotechnology arts can design PDGF-C mutants with a very high probability of retaining PDGF-C activity by conserving the eight cysteine residues responsible for the knotted folding arrangement and for dimerization, and also by conserving, or making only conservative amino acid substitutions in the likely receptor sequences in the loop 1, loop 2 and loop 3 region of the protein structure.
  • the formation of desired mutations at specifically targeted sites in a protein structure is considered to be a standard technique in the arsenal of the protein chemist (Kunkel et al . , Methods in Enzymol., 1987 154 367-382) . Examples of such site-directed mutagenesis with VEGF can be found in P ⁇ tgens et al . , J.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Optics & Photonics (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Toxicology (AREA)
  • Pulmonology (AREA)
  • Urology & Nephrology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Dermatology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
EP99952989A 1998-09-30 1999-09-30 Facteur de croissance c derive des plaquettes, adn le codant et ses utilisations Withdrawn EP1123408A1 (fr)

Applications Claiming Priority (13)

Application Number Priority Date Filing Date Title
US10246198P 1998-09-30 1998-09-30
US102461P 1998-09-30
US10810998P 1998-11-12 1998-11-12
US108109P 1998-11-12
US11074998P 1998-12-03 1998-12-03
US110749P 1998-12-03
US11300298P 1998-12-18 1998-12-18
US113002P 1998-12-18
US13542699P 1999-05-21 1999-05-21
US135426P 1999-05-21
US14402299P 1999-07-15 1999-07-15
US144022P 1999-07-15
PCT/US1999/022668 WO2000018212A2 (fr) 1998-09-30 1999-09-30 Facteur de croissance c derive des plaquettes, adn le codant et ses utilisations

Publications (1)

Publication Number Publication Date
EP1123408A1 true EP1123408A1 (fr) 2001-08-16

Family

ID=27557649

Family Applications (1)

Application Number Title Priority Date Filing Date
EP99952989A Withdrawn EP1123408A1 (fr) 1998-09-30 1999-09-30 Facteur de croissance c derive des plaquettes, adn le codant et ses utilisations

Country Status (5)

Country Link
EP (1) EP1123408A1 (fr)
JP (1) JP2002525086A (fr)
CN (1) CN1330664A (fr)
CA (1) CA2344561A1 (fr)
WO (1) WO2000018212A2 (fr)

Families Citing this family (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU758353B2 (en) 1998-03-17 2003-03-20 Genentech Inc. Polypeptides homologous to VEGF and BMP1
JP4739526B2 (ja) * 1998-12-07 2011-08-03 ザイモジェネティクス， インコーポレイテッド 成長因子相同体ｚｖｅｇｆ３
US6432673B1 (en) 1998-12-07 2002-08-13 Zymogenetics, Inc. Growth factor homolog ZVEGF3
AU4008500A (en) * 1999-04-06 2000-10-23 Eli Lilly And Company Platelet-derived growth factor related gene and protein
US6893637B1 (en) 1999-10-21 2005-05-17 Zymogenetics, Inc. Method of treating fibrosis
CA2426384A1 (fr) * 2000-10-19 2003-04-17 Kyowa Hakko Kogyo Co., Ltd. Anticorps inhibant l'activite vplf
KR20080083072A (ko) 2001-03-09 2008-09-12 얀센 파마슈티카 엔.브이. Ｖｅｇｆ-ｘ 또는 그의 길항제에 의한 평활근 세포 증식의 조절
US20060104978A1 (en) * 2003-10-24 2006-05-18 Ludwig Institute For Cancer Research Methods and compositions for PDGF-C activation and inhibition
WO2005087177A2 (fr) 2004-03-05 2005-09-22 Ludwig Institute For Cancer Research Anticorps chimeriques anti-vegf-d et anticorps humanises anti-vegf-d et leurs procedes d'utilisation
WO2005092921A2 (fr) * 2004-03-22 2005-10-06 Eli Lilly And Company Variants d'epissage du facteur de croissance placentaire, utilisations de ces derniers
ES2363758T3 (es) 2005-08-15 2011-08-16 Vegenics Pty Ltd Vegf y pdgf modificados con propiedades angiogénicas mejoradas.
DK2548578T3 (da) 2006-05-17 2014-10-06 Ludwig Inst Cancer Res Målretning af VEGF-B-regulering af fedtsyretransportører til modulering af humane sygdomme
CN101392026B (zh) 2008-10-09 2011-11-09 黄岚 用于预防和治疗纤维化类疾病以及肝癌的多肽
WO2013160359A1 (fr) 2012-04-24 2013-10-31 Thrombogenics N.V. Anticorps anti-pdgf-c
CN104693285A (zh) * 2015-04-06 2015-06-10 苏州普罗达生物科技有限公司 血管内皮生长因子c拮抗多肽及其应用
CN104744565A (zh) * 2015-04-06 2015-07-01 苏州普罗达生物科技有限公司 一种血管内皮生长因子c拮抗多肽及其应用
CN104693286A (zh) * 2015-04-06 2015-06-10 苏州普罗达生物科技有限公司 关于血管内皮生长因子c拮抗多肽及其应用
CN105175546A (zh) * 2015-05-27 2015-12-23 连祺周 人血管内皮生长因子与表皮生长因子样结构域7的融合蛋白
CN109843918B (zh) * 2016-07-01 2023-08-25 旁分泌疗法公司 用于pdgf-cc抑制的方法和组合物

Also Published As

Publication number Publication date
CA2344561A1 (fr) 2000-04-06
WO2000018212A8 (fr) 2007-11-22
WO2000018212A2 (fr) 2000-04-06
JP2002525086A (ja) 2002-08-13
CN1330664A (zh) 2002-01-09
WO2000018212A9 (fr) 2000-09-08

Similar Documents

Publication Publication Date Title
US6706687B1 (en) Platelet-derived growth factor D
EP2107109B1 (fr) Facteur D recombinant de croissance de cellules vasculaires endotheliales
EP1126863B1 (fr) Proteine du facteur de croissance endothelial vasculaire (vegf) isolee de la souche nz10 du virus orf se liant au recepteur du vegf, vegfr-2, de mammifere et l'activant
WO2000018212A2 (fr) Facteur de croissance c derive des plaquettes, adn le codant et ses utilisations
US7408040B2 (en) Antibodies to PDGF-D
US20070042413A1 (en) Platelet-derived growth factor D, DNA coding therefor, and uses thereof
US20020164687A1 (en) Platelet-derived growth factor C, DNA coding therefor, and uses thereof
US20070172423A1 (en) Composition and method for modulating vasculogenesis for angiogenesis
US20030211994A1 (en) Composition and method for modulating vasculogenesis or angiogenesis
WO2002007514A2 (fr) Vegf-b glycosylees et methode d'augmentation de la quantite de vegf-b solubles
US20030082670A1 (en) Platelet-derived growth factor C, DNA coding therefor, and uses thereof
AU6502999A (en) Platelet-derived growth factor c, dna coding therefor, and uses thereof
WO2000044903A9 (fr) Facteur de croissance h de type facteur de croissance d'origine plaquettaire/facteur de croissance de l'endothelium vasculaire et ses utilisations

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20010417

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: LT;LV;MK;RO;SI

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20050401

REG Reference to a national code

Ref country code: HK

Ref legal event code: WD

Ref document number: 1037885

Country of ref document: HK