EP1044217A2 - Sag: gene sensible a l'apoptose - Google Patents

Sag: gene sensible a l'apoptose

Info

Publication number
EP1044217A2
EP1044217A2 EP98963962A EP98963962A EP1044217A2 EP 1044217 A2 EP1044217 A2 EP 1044217A2 EP 98963962 A EP98963962 A EP 98963962A EP 98963962 A EP98963962 A EP 98963962A EP 1044217 A2 EP1044217 A2 EP 1044217A2
Authority
EP
European Patent Office
Prior art keywords
seq
sag
cells
dna sequence
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP98963962A
Other languages
German (de)
English (en)
Inventor
Yi Sun
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Warner Lambert Co LLC
Original Assignee
Warner Lambert Co LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Warner Lambert Co LLC filed Critical Warner Lambert Co LLC
Publication of EP1044217A2 publication Critical patent/EP1044217A2/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4747—Apoptosis related proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P39/00—General protective or antinoxious agents
    • A61P39/06—Free radical scavengers or antioxidants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00—Uses of viruses
    • C12N2799/02—Uses of viruses as vector
    • C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/022—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from an adenovirus

Definitions

  • the present invention relates to a novel gene and polypeptides derived therefrom encoding a redox-sensitive protein that protects cells from apoptosis and promotes cell growth, as well as antibodies directed against the polypeptide.
  • the invention also describes methods for using the novel gene, polypeptides, and antibodies in the detection of genetic deletions of the gene, subcellular localization of the polypeptide, isolation of discrete classes of R . NA, inhibition of apoptosis, scavenging of oxygen radicals, reversion of tumor phenotype, and therapeutic applications by gene therapy.
  • Apoptosis also refeired to as programmed cell death, is a genetically programmed process for maintaining homeostasis under physiological conditions and for responding to various stimuli (Thompson (1995) Science 267, 1456-1462). This form of cell death is characterized by cell membrane blebbing, cytoplasmic shrinkage, nuclear chromatin condensation, and DNA fragmentation (Wyllie (1980) Int. Rev. Cytol. 68, 251-306). The process of apoptosis can be divided into three distinct phases: initiation, effector molecule stimulation and DNA degradation (.Kroemer et al. (1995) FASEB J. 9, 1277-1287; Vaux and Strasser (1996) Proc. Natl. Acad. Sci.
  • Apoptosis can be initiated in various cell types by a wide variety of physical, chemical, and biological stimuli (both internal and external), including diverse cancer therapeutic drugs, oxidative DNA damage reagents, and cytokines (Kroemer (1997) Nature Med. 3, 614-620, White (1996) Genes Dev. 10, 1-15; Sen and D'lncalci (1992) FEBS Lett. 307, 122-127; Dive and Hickman (1991) Br. J. Cancer 64, 192-196; Yuan et al. (1993) Cell 75, 641-652). These initiators trigger the effector molecules in cells leading to apoptotic signal transduction and amplification, which ultimately results in irreversible DNA degradation and cell death.
  • genes are involved in the apoptotic process. In general, the products of these genes are classified as either inducers or inhibitors of apoptosis. The balance between the activities of apoptosis inducers and inhibitors in a given cell determines whether that cell undergoes apoptosis.
  • ⁇ mong the growing list of apoptotic regulatory genes, the most well characterized are the p53 tumor suppressor gene, the Bcl-2 gene family (consisting of both inducers and inhibitors of apoptosis), the interleukin l ⁇ converting enzyme (ICE) gene family, and FAS/Fas ligand (Kroemer (1997), White (1996); Yuan et al.
  • OP is a typical metal chelating reagent in that it chelates Fe(II) and prevents Fe(II)-mediated hydroxyl radical formation through the Fenton reaction (Halliwell et al. (1989) in: Free Radicals in Biology and Medicine, 2 n ⁇ ed., Clarendon Press, Oxford; Auld (1988) in Methods in Enzymology, Vol. 158 (J. F. Riordan and B. L. Nalle, Eds.) PP. 110-114, Academic Press, New York). OP has been shown to prevent hydroxyl radical-induced DNA damage in a number of cellular systems (Sun, Y. Free Radic. Biol. Med.
  • the present invention provides novel genes and polypeptides derived therefrom encoding a redox-sensitive protein that protects cells from apoptosis, scavenges oxygen radicals, and can be used for the reversion of a tumor phenotype.
  • the present invention provides novel isolated and purified DNA sequences (refeixed to herein as "mouse SAG” and “human SAG”) as shown in SEQ ID 1 and SEQ ID 3, and their gene products (referred to herein as “mouse SAG protein” and "human SAG protein”) as shown in SEQ ID 2 and SEQ ID 4, that are induced during 1,10-phenanthroline (“OP")-induced apoptosis.
  • OP 1,10-phenanthroline
  • the present invention comprises a nucleotide sequence that hybridizes to the nucleotide sequence shown in SEQ ID 1 and SEQ ID 3 under high stringency hybridization conditions.
  • the isolated and purified DNA sequence consists essentially of the DNA sequence of SEQ ID 1 or SEQ ID 3.
  • the invention provides novel recombinant DNA molecules, comprising SAG subcloned into an extra-chromosomal vector.
  • the present invention provides recombinant host cells that are stably transfected with a recombinant DNA molecule comprising SAG subcloned into an extra-chromosomal vector.
  • the present invention provides a substantially purified recombinant protein comprising a polypeptide substantially similar to the SAG protein shown in SEQ ID 2 and SEQ ID 4.
  • the present invention provides a polyclonal antibody that selectively binds to proteins with an amino acid sequence substantially similar to the amino acid sequence shown in SEQ ID 2 and SEQ ID 4.
  • Additional aspects of the present invention provide a method of detecting the SAG protein in cells, comprising contacting cells with a polyclonal antibody that recognizes the SAG protein; a method of detecting cells containing SAG deletions, comprising isolating total genomic DNA from the cell and subjecting the genomic DNA to PCR amplification using primers derived from the DNA sequence of SEQ ID 1 and SEQ ID 3; and a method of detecting cells containing SAG deletions, comprising isolating total cell RNA and subjecting the RNA to reverse transcription-PCR amplification using primers derived from the DNA sequence of SEQ ID 1 and SEQ ID 3.
  • the present invention further provides methods of isolating RNA containing stretches of polyA, polyC, or polyU residues from cells, contacting the total cell RNA with the SAG protein, and incubating the .RNA-SAG protein mixture with an antibody that recognizes the SAG protein.
  • a method for isolating genes induced during cell apoptosis comprising treating cells with OP, subjecting the OP- induced RNA to the differential display procedure, and cloning the OP-induced genes.
  • a further aspect of the invention provides a method for protecting mammalian and/or non-mammalian cells from apoptosis induced by redox reagents, comprising introducing into mammalian and/or non-mammalian cells an expression vector comprising a DNA sequence substantially similar to the DNA sequence shown in SEQ ID 1 and SEQ ID 3, which is operatively linked to a DNA sequence that promotes the expression of the DNA sequence, wherein the isolated and purified DNA sequence of SEQ ID 1 and SEQ ID 3 will be expressed at high levels in the mammalian and/or non-mammalian cells.
  • An additional aspect of the present invention provides a method for treatment of mammalian and/or non-mammalian tumor cells, comprising introducing into mammalian and/or non-mammalian tumor cells an expression vector comprising a DNA sequence substantially similar to the DNA sequence shown in SEQ ID 1 and SEQ ID 3, which is operatively linked to a DNA sequence that promotes the expression of the antisense strand of the DNA sequence, wherein the antisense strand of the DNA sequence of SEQ ID 1 and SEQ ID 3 will be expressed at high levels in the mammalian and/or non-mammalian cells.
  • Another aspect of the present invention provides a method for oxygen radical scavenging in an organism, comprising administering an oxygen radical-reducing amount of a pharmaceutical composition comprising SAG protein and a pharmaceutically acceptable carrier.
  • a further aspect of the present invention provides for gene therapy applications of SAG, including but not limited to methods of promoting the closure (i.e., healing) of a wound in a patient.
  • Figure 1 A Predicted structural features of the deduced protein sequence of the mouse and human SAG cDNA.
  • Figure IB Description of human SAG protein mutants.
  • Figure 2 Bar graph depiction of soft agar colony growth of various SAG-transfected stable cell lines.
  • FIG. 1 Graphical representation of tumor mass in SCID mice per days post implant with SAG transfectants.
  • the present invention provides novel genes and polypeptides derived therefrom encoding a redox-sensitive protein that protects cells from apoptosis, scavenges oxygen radicals, and can be used for the reversion of a tumor phenotype.
  • the present invention also comprises genes and their gene products involved in OP-induced apoptosis. The isolation of such genes and their gene products permits a detailed analysis of the OP-induced apoptotic pathway, thus providing laboratory tools useful to identify the mechanisms of OP-induced apoptosis and enabling improved design of therapeutic drugs to regulate apoptosis.
  • the present invention provides novel isolated and purified DNA sequences, hereinafter referred to as Sensitive to Apoptosis Genes ("SAG”), encoding SAG proteins.
  • the invention comprises DNA sequences substantially similar to those shown in SEQ ID 1 (mouse SAG) or SEQ ID 2 (human SAG), respectively.
  • substantially similar includes identical sequences, as well as deletions, substitutions or additions to a DNA, RNA or protein sequence that maintain the function of the protein product and possess similar zinc-binding motifs.
  • the DNA sequences according to the invention consist essentially of the DNA sequence of SEQ ID 1 or SEQ ID 3, or are selected from the group consisting of SEQ ID 11, SEQ ID 13, SEQ ID 21, SEQ ID 23, SEQ ID 25, SEQ ID 27, SEQ ID 29, SEQ ID 31, SEQ ID 33, SEQ ID 35, SEQ ID 37, SEQ ID 39, SEQ ID 41, SEQ ID 43, SEQ ID 45, SEQ ID 47 and SEQ ID 49.
  • SEQ ID 11 SEQ ID 13
  • the invention comprises a nucleotide sequence that hybridizes to SEQ ID 1 and/or SEQ ID 3 under high stringency hybridization conditions.
  • the term "high stringency hybridization conditions” refers to hybridization at 65 °C in a low salt hybridization buffer to the probe of interest at 2 x 10° cpm/ ⁇ g for between about 8 hours to 24 hours, followed by washing in 1% SDS, 20 mM phosphate buffer and 1 mM EDTA at 65°C, for between about 30 minutes to 4 hours, m a preferred embodiment, the low salt hybridization buffer comprises between, 0.5-10% SDS, and 0.05M and 0.5 M sodium phosphate. In a most prefeired embodiment, the low salt hybridization buffer comprises, 7% SDS, and 0.125M sodium phosphate. These DNA sequences can be used to direct expression of the SAG protein and for mutational analysis of SAG protein function, and are isolated via hybridization as described.
  • the invention provides novel recombinant DNA molecules, comprising SAG or a sequence substantially similar to it subcloned into an extra- chromosomal vector.
  • This aspect of the invention allows for in vitro expression of the SAG gene, thus permitting an analysis of SAG gene regulation and SAG protein structure and function.
  • extra-chromosomal vector includes, but is not limited to, plasmids, bacteriophages, cosmids, retroviruses and artificial chromosomes.
  • the extra-chromosomal vector comprises an expression vector that allows for SAG protein production when the recombinant DNA molecule is inserted into a host cell.
  • Such vectors are well .known in the art and include, but are not limited to, those with the T3 or T7 polymerase promoters, the SV40 promoter, the CMV promoter, or any promoter that either can direct gene expression, or that one wishes to test for the ability to direct gene expression.
  • These recombinant vectors are produced via standard recombinant DNA protocols as described in the references cited above. This aspect of the invention allows for high level expression of the SAG protein.
  • the present invention provides recombinant host cells that are stably transfected with a recombinant DNA molecule comprising SAG subcloned into an extra-chromosomal vector.
  • the host cells of the present invention may be of any type, including, but not limited to, non-eukaryotic (e.g., bacterial), and eukaryotic such as fungal (e.g., yeast), plant, non-human animal, non-human mammalian (e.g., rabbit, porcine, mouse, horse) and human cells. Transfection of host cells with recombinant DNA molecules is well
  • the present invention provides a substantially purified recombinant protein comprising a polypeptide substantially similar to the SAG polypeptides shown in SEQ ID 2 and SEQ ID 4. Furthermore, this aspect of the invention enables the use of SAG protein in several in vitro assays described below.
  • the term “substantially similar” includes deletions, substitutions and additions to the sequences of SEQ IDs 1 -4 (as appropriate) introduced by any in vitro means.
  • the term “substantially purified” means that the protein should be free from detectable contaminating protein, but the SAG protein may be co-purified with an interacting protein, or as an oligomer.
  • the protein sequences according to the invention comprise an amino acid sequence selected from the group consisting of SEQ ID 2, SEQ ID 4, SEQ ID 12, SEQ ID 14, SEQ ID 22, SEQ ID 24, SEQ ID 26, SEQ ID 28, SEQ ID 30, SEQ ID 32, SEQ ID 34, SEQ ID 36, SEQ ID 38, SEQ ID 40, SEQ ID 42, SEQ ID 44, SEQ ID 46, SEQ ID 48, and SEQ ID 50.
  • the protein sequences according to the invention comprise an amino acid sequence selected from the group consisting of SEQ ID 2 and SEQ ID 4. Mutated sequences according to the invention can be identified in a routine manner by those skilled in the art using the teachings provided herein and techniques well .known in the art.
  • This aspect of the invention provides a novel purified protein that can be used for in vitro assays, as described in Examples 12, infra, and as a component of a phaimaceutical composition for oxygen radical scavenging, described infra.
  • the present invention provides antibodies and methods for detecting antibodies that selectively bind polypeptides with an amino acid sequence substantially similar to the amino acid sequence of SEQ ID 2 and SEQ ID 4.
  • the antibody of the present invention can be a polyclonal or a monoclonal antibody, prepared by using all or part of the sequence of SEQ ID 2 or SEQ ID 4, or modified portions thereof, to elicit an immune response in a host animal according to standard techniques (Harlow and Lane (1988), eds. Antibody: A Laboratory Manual, Cold Spring Harbor Press).
  • the entire polypeptide sequence of SEQ ID 2 or SEQ ID 4 is used to elicit the production of polyclonal antibodies in a host animal.
  • the method of detecting SAG antibodies comprises contacting cells with an antibody that recognizes SAG protein and incubating the cells in a manner that allows for detection of the SAG protein-antibody complex.
  • Standard conditions for antibody detection of antigen can be used to accomplish this aspect of the invention (Harlow and Lane, 1988).
  • This aspect of the invention permits the detection of SAG protein both in vitro and in vivo, as described in Examples 12 and 14, infra.
  • the present invention provides a diagnostic assay for detecting cells containing SAG deletions, comprising isolating total genomic DNA from the cell and subjecting the genomic DNA to PCR amplification using primers derived from the DNA sequence of SEQ ID 1 SEQ ID 3, SEQ ID 11, SEQ ID 13, SEQ ID 21, SEQ ID 23, SEQ ID 25, SEQ ID 27, SEQ ID 29, SEQ ID 31, SEQ ID 33, SEQ ID 35, SEQ ID 37, SEQ ID 39, SEQ ID 41, SEQ ID 43, SEQ ID 45, SEQ ID 47 and SEQ ID 49.
  • PCR primers can be chosen in any manner that allows the amplification of a SAG gene fragment large enough to be detected by gel electrophoresis. Detection can be by any method, including, but not limited to ethidium bromide staining of agarose or polyacrylamide gels, autoradiographic detection of radio-labeled SAG gene fragments, Southern blot hybridization, and DNA sequence analysis. In a prefeired embodiment, detection is accomplished by polyacrylamide gel electrophoresis, followed by DNA sequence analysis to verify the identity of the deletions. PCR conditions are routinely determined based on the length and base-content of the primers selected according to techniques well .known in the art (Sambrook et al., 1989).
  • an additional aspect of the present invention provides a diagnostic assay for detecting cells containing SAG deletions, comprising isolating total cell .RNA and subjecting the RNA to reverse transcription-PCR amplification using primers derived from the DNA sequence of SEQ ID 1 SEQ ID 3, SEQ ID 11, SEQ ID 13, SEQ ID 21, SEQ ID 23, SEQ ID 25, SEQ ID 27, SEQ ID 29, SEQ ID 31, SEQ ID 33, SEQ ID 35, SEQ ID 37, SEQ ID 39, SEQ ID 41, SEQ ID 43, SEQ ID 45, SEQ ID 47 and SEQ ID 49.
  • This aspect of the invention enables the detection of SAG deletions in any type of cell, and can be used in genetic testing or as a laboratory tool.
  • Reverse transcription is routinely accomplished via standards techniques (Ausubel et al., in Current Protocols in Molecular Biology, ed. John Wiley and Sons, Inc., 1994) and PCR is accomplished as described above.
  • the present invention provides methods of isolating RNA containing stretches of polyA (adenine), polyC (cytosine) or polyU (uridine) residues, comprising contacting an RNA sample with SAG protein, incubating the RNA-SAG protein mixture with an antibody that recognizes the SAG polypeptide, isolating the antibody-SAG protein-RNA complexes, and purifying the RNA away from the antibody-SAG protein complex.
  • This aspect of the invention provides a novel in vitro method for isolating a discrete class of RNA.
  • the RNA sample is contacted with SAG protein in the presence (for preferential isolation of polyA and polyC-containing RNAs), or absence (for preferential isolation of polyU-containing RNAs), of a reducing agent.
  • a reducing agent for use in this aspect of the invention include, but are not limited to DTT and ⁇ -mercaptoethanol.
  • the reducing agents are preferably used at a concentration of between about 50 mM and 1 M. Isolation of antibody-SAG protein-.RNA complexes can be accomplished via standard techniques in the art, including, but not limited to the use of Protein-A conjugated to agarose or cellulose beads.
  • a method for isolating genes induced during cell apoptosis comprising treating one set of cells with OP and not treating a control set of cells, isolating RNA from each set of cells, subjecting the RNA from each set of cells to reverse transcription and PCR ("differential display"), identifying cDNAs that are expressed in the OP-treated set of cells and not in the control set of cells, and cloning the OP-induced cDNAs.
  • This aspect of the invention provides a tool for isolating other genes that control the OP-induced apoptotic pathway and is useful both as a way to enable the design of therapeutic drugs that regulate apoptosis and as a laboratory tool to identify the mechanisms of OP-induced apoptosis.
  • Details of the differential display technique, including selection of primers, are well known in the art (Liang and Pardee, Science 257:967-971, 1992). Reverse transcription and PCR conditions are routinely determined based on the length and base-content of the primers selected according to techniques well .known in the art (Sambrook et al., 1989).
  • OP is used at a concentration of between 50 ⁇ M and 300 ⁇ M.
  • OP is used at a concentration of between 100 ⁇ M and 150 ⁇ M.
  • a further aspect of the invention provides a method for protecting mammalian and/or non-mammalian cells from apoptosis induced by redox reagents, comprising introducing into mammalian and/or non-mammalian cells an expression vector comprising a DNA sequence substantially similar to the DNA sequence shown in SEQ ID 1 or SEQ ID 3, that is operatively linked to a DNA sequence that promotes the expression of the DNA sequence and incubating the cells under conditions wherein the DNA sequence of SEQ ID 1 or SEQ ID 3 will be expressed at high levels in the mammalian and/or non-mammalian cells.
  • the DNA sequence consist essentially of SEQ ID 1 or SEQ ID 3.
  • Suitable expression vectors are as described above.
  • the coding region of the human SAG gene is subcloned into an expression vector under the transcriptional control of the cytomegalovirus (CMV) promoter to allow for constitutive SAG gene expression.
  • CMV cytomegalovirus
  • An additional aspect of the present invention provides a method for inhibiting the growth of mammalian and/or non-mammalian tumor cells, comprising introducing into mammalian and/or non-mammalian tumor cells an expression vector comprising a DNA that is antisense to a sequence substantially similar to the DNA sequence shown in SEQ ID 1 or SEQ ID 3 that is operatively linked to a DNA sequence that promotes the expression of the antisense DNA sequence. The cells are then grown under conditions wherein the antisense DNA sequence of SEQ ID 1 or SEQ ID 3 will be expressed at high levels in the mammalian and/or non-mammalian cells.
  • the DNA sequence consists essentially of SEQ ID 1, SEQ ID 3, SEQ ID 11, SEQ ID 13, SEQ ID 21, SEQ ID 23, SEQ ID 25, SEQ ID 27, SEQ ID 29, SEQ ID 31, SEQ ID 33, SEQ ID 35, SEQ ID 37, SEQ ID 39, SEQ ID 41, SEQ ID 43, SEQ ID 45, SEQ ID 47 and SEQ ID 49.
  • the DNA sequence consists essentially of SEQ ID 1 or SEQ ID 3.
  • the expression vector comprises an adenoviral vector wherein SAG cDNA is operatively linked in an antisense orientation to a cytomegalovirus (CMV) promoter to allow for constitutive expression of the SAG antisense cDNA in a host cell.
  • CMV cytomegalovirus
  • the SAG adenoviral expression vector is introduced into mammalian tumor cells by injection into a mammalian tumor cell mass.
  • An additional aspect of the present invention provides a method for oxygen radical scavenging in an organism, comprising introducing into mammalian and/or non-mammalian cells an expression vector comprising a DNA sequence substantially similar to the DNA sequence shown in SEQ ID 1 or SEQ ID 3 which is operatively linked to a DNA sequence that promotes the expression of the DNA sequence, and the cells are grown under conditions wherein the DNA sequence of SEQ ID 1 or SEQ ID 3 will be expressed at high levels in the mammalian and/or non-mammalian cells.
  • the DNA sequence consists essentially of SEQ ID 1 or SEQ ID 3.
  • the SAG cDNA is operatively linked to a cytomegalovirus (CMV) promoter, to allow for constitutive expression of the SAG cDNA in a host cell.
  • CMV cytomegalovirus
  • Another aspect of the present invention provides pharmaceutical compositions and methods for oxygen radical scavenging in an organism, comprising administering an oxygen- reducing amount of a pharmaceutical composition comprising the SAG protein of SEQ ID 2 or SEQ ID 4 and a pharmaceutically acceptable carrier.
  • Chimeric gene constructs of the present invention e.g., expression vectors
  • SAG polynucleotide sequences may be used in gene therapy applications to achieve expression of SAG or anti-sense SAG polynucleotide sequences in selected target cells, including non-eukaryotic cells (i.e., plant) and eukaryotic cells.
  • Gene therapy applications typically involve identifying target host cells or tissues in need of the therapy, designing vector constructs capable of expressing a desired gene product in the identified cells, and delivering the constructs to the cells in a manner that results in efficient transduction of the target cells.
  • the cells or tissues targeted by gene therapy are typically those that are affected by the disease that the vector construct is designed to treat.
  • the targeted tissues are malignant tumors.
  • the present invention provides a method of promoting the closure (i.e., healing) of a wound in a patient.
  • This method involves transfeiring exogenous SAG to the region of the wound whereby a product of SAG is produced in the region of the wound to promote the closure (i.e., healing) of the wound.
  • the present inventive method promotes closure (i.e., healing) of both external (e.g., surface) and internal wounds.
  • Wounds to which the present inventive method is useful in promoting closure (e.g., healing) include, but are not limited to, abrasions, avulsions, blowing wounds, burn wounds, contusions, gunshot wounds, incised wounds, open wounds, penetrating wounds, perforating wounds, puncture wounds, seton wounds, stab wounds, surgical wounds, subcutaneous wounds, tangential wounds, or traumatopneic wounds.
  • the present inventive methods are employed to close chronic open wounds, such as non-healing external ulcers and the like.
  • Exogenous SAG can be introduced into the region of the wound by any appropriate means, such as, for example, those means described herein.
  • SAG can be supplied exogenously by topical administration of SAG protein to the region of the wound.
  • exogenous SAG is provided to the wound by transferring a vector comprising an SAG expression cassette to cells associated with the wound.
  • a product of SAG is produced to promote wound closure (i.e., healing).
  • Transfeiring a vector comprising an SAG expression cassette to cells associated with the wound is preferred as such procedure is minimally invasive, supplies SAG products locally within the region of the wound, and requires no reapplication of salves, solutions, or other extrinsic media.
  • SAG activity remains expressed during wound closure and will inactivate following healing.
  • the vector comprising the SAG expression cassette can be transferred to the cells associated with the wound in any manner appropriate to transfer the specific vector type to the cells, such as those methods discussed herein.
  • the cells associated with the wound to which the vector is transferred are any cells sufficiently connected with the wound such that expression of SAG within those cells promotes wound closure (i.e., healing), such as cells within the wound or cells from other sources.
  • the cells are cells of the wound, and the present inventive method comprises transfer of the vector to the cells in situ.
  • the cells are not the cells of the wound, but can be cells in an exogenous tissue, such as a graft, or can be cells in vitro.
  • the cells associated with the wound can be cells within a graft, such as a skin graft. Transfer of the vector to the cells associated with the wound, thus involves transferring the vector to the cells within the graft ex vivo.
  • the cells associated with the wound are cells in vitro, and the cells are transferred to the region of the wound following transfer to them of a vector containing the SAG expression cassette.
  • the present inventive method applies to any patient having a wound.
  • the patient can be any animal, such as a mammal.
  • the patient is human.
  • the present invention provides a method of inhibiting or promoting plant cell growth.
  • the method involves the use of chimeric gene constructs to achieve expression of SAG, in the case of promoting growth of plants, or anti-sense SAG, in the case of inhibiting plants (i.e., weeds), polynucleotide sequences in selected target plant cells.
  • the SAG protein is based on a variety of factors, including the type of injury, the age, weight, sex, medical condition of the individual, the severity of the condition, the route of administration, and the particular compound employed. Thus, the dosage regimen may vary widely, but can be determined routinely using standard methods.
  • the pharmaceutical composition comprises between OJ and 100 mg of SAG protein. In a most prefeired embodiment, the pharmaceutical composition comprises between 1 and 10 mg of SAG protein.
  • the SAG protein may be made up in a solid form (including granules, powders or suppositories) or in a liquid form ⁇ e.g., solutions, suspensions, or emulsions).
  • the SAG protein may be subjected to conventional pharmaceutical operations such as sterilization and/or may contain conventional adjuvants, such as preservatives, stabilizers, wetting agents, emulsifiers, buffers etc.
  • the SAG protein can be administered as the sole active pharmaceutical agent, they can also be used in combination with one or more other agents.
  • the therapeutic agents can be fo ⁇ nulated as separate compositions that are given at the same time or different times, or the therapeutic agents can be given as a single composition.
  • the SAG protein is ordinarily combined with one or more adjuvants appropriate for the indicated route of administration.
  • the SAG protein may be admixed with lactose, sucrose, starch powder, cellulose esters of alkanoic acids, stearic acid, talc, magnesium stearate, magnesium oxide, sodium and calcium salts of phosphoric and sulphuric acids, acacia, gelatin, sodium alginate, polyvinylpyrrolidine, and/or polyvinyl alcohol, and tableted or encapsulated for conventional administration.
  • the SAG protein may be dissolved in saline, water, polyethylene glycol, propylene glycol, carboxymethyl cellulose colloidal solutions, ethanol, corn oil, peanut oil, cottonseed oil, sesame oil, tragacanth gum, and/or various buffers.
  • Other adjuvants and modes of administration are well .known in the pharmaceutical art.
  • the carrier or diluent may include time delay material, such as glyceryl monostearate or glyceryl distearate alone or with a wax, or other materials well known in the art.
  • the SAG protein pharmaceutical composition is administered intramuscularly (IM) or intravenously (IV).
  • IM intramuscularly
  • IV intravenously
  • a suitable IM or IV dose of active ingredient of SAG protein is 5 mg/mL administered daily.
  • the active ingredient may comprise from 0.001% to 10% w/w, e.g., from 1% to 2% by weight of the formulation, although it may comprise as much as 10% w/w, but preferably not more than 5% w/w, and more preferably from 0.1% to 1% of the formulation.
  • the differential display (DD) technique was employed to isolate genes responsible for or associated with OP-induced apoptosis in two murine tumor lines. Since OP induced- apoptosis can be visually detected at 12 hours post exposure (Sun, (1997) FEBS Lett. 408:16- 20), it was reasoned that gene(s) responsible for apoptosis induction should be up- or down- regulated prior to the appearance of apoptosis. Six hours of OP treatment was conducted, therefore, in one of these tumor lines followed by the DD analysis.
  • Mouse JB6 tumor line L-RT101 (an epidermal originated tumor cell line) was cultured in Minimal Essential Medium with Earle's salts (BRL) containing 5% fetal calf serum (Sigma).
  • H-Tx cells a spontaneously transformed mouse liver line, were cultured in
  • Dulbecco's Modified Eagle Medium containing 10% fetal calf serum and 1 mM sodium pyruvate. Human colon carcinoma line DLD-1 was grown in 10% DMEM.
  • L-RT101 cells were treated with 150 uM OP for 6 hours and subjected to differential display analysis using DMSO-treated cells as a control. Briefly, total RNA was isolated from both OP-treated and control cells using RNAzol solution (Tel-Test) according to the manufacturer's instructions, and subjected to reverse transcription (RT), performed as previously described (Sun et al. (1993) Mol. Carcinogenesis 8, 49-57), followed by the polymerase chain reaction (PCR).
  • the primer used for reverse transcription (PI) consisted of the sequence 5 AAGCTTTTTTTTTTTTTTTR (SEQ ID 5), wherein R consists of either adenine, guanine or cytosine.
  • PI was used as the downstream primer in the subsequent PCR while the upstream primer consisted of the sequence AAGCTTNNNNNNN (SEQ ID 6), wherein N consists of adenine, cytosine, guanine, or thymine.
  • Primers PI and P2 reproducibly detected differential expression between the control and OP-treated cells.
  • the fragments reproducibly showing differential expression were PCR amplified using the same primers and used as probes for Northern analysis (Sun et al. (1992) Cancer Res. 52:1907-1915) of both L-RT101 and H-Tx cells treated with OP (Sun (1997) FEBS Letters 408:16-20).
  • Those fragments that were induced by OP were then subcloned into TA cloning vectors (In Vitrogen) according to the manufacturer's instructions, and sequenced by DNA Sequenase Version 2.0, according to the manufacturer's instructions (Amersham).
  • the resulting clones comprise OP-inducible cDNA fragments.
  • One of the OP-inducible clones was used as a probe to screen a mouse lung cDNA library to clone the full length mouse SAG cDNA. Briefly, 1 x ⁇ recombinant plaques were plated onto 1% NZY in 150 mm plates (a total of 20). The recombinant phage DNA was transferred to nitrocellulose membrane and hybridized with mouse SAG probe (2X10 cpm/ ⁇ g) in a hybridization solution containing 5X SSC, 5X Denhardt solution, 50 mM sodium phosphate, and 100 ⁇ g/mL denatured DNA at 60°C for 16-18 hours. The filter was then washed once for 5 min in a solution of 2XSSC/0J% SDS, once for 5 min in 0.5XSSC/0.1% SDS, and twice O.lXSSC/0.1% SDS for 15 min.
  • the longest clone isolated was a 1.0 kilobase ("kb") fragment consisting of a partial open reading frame and the entire 3 '-end untranslated region.
  • kb 1.0 kilobase
  • a mouse brain Marathon- Ready cDNA (ClonTech) was screened via PCR amplification using a primer derived from the 1 kb fragment and another primer derived from the vector sequence, according to the protocol supplied with the cDNA library. This yielded a further 100 bp fragment consisting of 5'-end untranslated sequence and some of the coding sequence.
  • the derived cDNA clone consists of 1140 base pairs (“bp") (SEQ ID 1) that encode a novel deduced protein of 113 amino acids, containing 12 cysteine residues (SEQ ID 2).
  • the open reading frame was preceded by 17 bp upstream sequence.
  • the start codon was located in a context that conformed 100% to the Kozak consensus sequence (Kozak,M. (1991) J. Biol. Chem. 266, 19867-19870).
  • An in-frame stop codon was identified 72 bp upstream of the start codon in the 5' untranslated region in one genomic clone (not shown).
  • the 3'-end untranslated region consists of 792 bp sequence with two polyadenylation signals (AATAAA).
  • the mouse cDNA was used as a probe to screen a human HeLa cell cDNA library (Strategene) as described above. One positive clone was isolated and purified through two more cycle of screening. In this manner, a 754 bp clone containing a polyadenylation signal at the 3' end was isolated (SEQ ID 3).
  • the human cDNA also contains an open reading frame encoding a novel predicted 113 amino acid polypeptide containing 12 cysteine residues (SEQ ID 4).
  • the sequence identity between the isolated mouse and human cDNAs is 82% in overall sequence and 94% in the coding region. At the protein level, they shared 96.5% identity, with all 12 cysteine residues being conserved.
  • Computer analysis of protein databases using the GCG program revealed that the encoded proteins share 70% identity with hypothetical proteins from yeast (accession #Z74876) and C-elegans (accession #80449).
  • the second potential heme binding domain contains a substitution of arginine to histidine (amino acid 54). Since these two amino acids are structurally similar, this may constitute an authentic heme binding site.
  • the zinc ring finger domain mismatch involves substitution of cysteine by histidine at amino acid 85.
  • the ring finger domain in this protein is a C3H2C3 structure, rather than the consensus C3HC4 structure.
  • cysteine and histidine residues are interchangeable in zinc binding (Berg and Shi, Science 271 : 1081, 1996; Inouye et al., Science 278:103-106, 1997), the C3H2C3 domain in these proteins may comprise authentic zinc-binding sites.
  • these heme and zinc ring finger domains are 100% conserved among C. elegans, mouse and human. In yeast, only the last cysteine residue in C3H2C3 motif was not conserved. This evolutionary conservation of the heme and zinc-binding domains suggest their functional importance.
  • motifs identified in the deduced sequence of the SAG protein when allowing for a single mismatch, include an aminoacyl-transfer .RNA synthetase class II motif
  • Example 3 SAG is inducible by OP in both mouse and human tumor cells
  • SAG Sensitive to Apoptosis Genes
  • Example 4 Tissue distribution and embryonic expression of SAG SAG expression was next examined in multiple human tissues. The assays were performed as detailed previously (Sun et al. (1993) Mol. Carcinogenesis 8, 49-57; Sun et al., Proc. Natl. Acad. Sci. USA 90:2827-2831, 1993). Briefly, total RNA was isolated from multiple human tissues (ClonTech) and then subjected to Northern blot analysis using the mouse or human SAG cDNA as probes.
  • SAG SAG .RNA was detected in all tissue examined including heart, brain, pancreas, lung, liver, skeletal muscle, kidney, pancreas, spleen, thymus, prostate, testis, ovary, small intestine, colon, and peripheral blood leukocytes.
  • a very high expression level was detected in heart, skeleton muscle and testis, which consume high levels of oxygen. Its tissue distribution and high level expression in oxygen-consuming tissues, and its induction by a redox sensitive compound (OP), implies that SAG encodes a redox sensitive protein.
  • OP redox sensitive compound
  • SAGTA.Ol 5'-CGGGATCCCCATGGCCGACGTGAGG- 3' (SEQ ID 7) and SAGT.02 5'-CGGGATCCTCATTTGCCGATTCTTTG-3' (SEQ ID 8), which flank the entire SAG coding region.
  • the PCR reaction mixture for 11 samples contained 55 ⁇ L of 10X buffer, 22 ⁇ L of 1.25 mM dNTP, 1.1 ⁇ L of SAGTA.Ol and
  • SAGT.02 respectively, 5.5 ⁇ L of Taq DNA polymerase, 5.5 ⁇ L of 32p_dCTP and sterile water up to 495 ⁇ l.
  • NIH3T3 cells ATCC CRL 1658 were plated on coverslips in 24-well culture dishes and transfected by the calcium phosphate method according to standard techniques (Sambrook et al, 1989) with the following constructs: pcDNA3J (Invitrogen vector pcDNA 3 with a myc-his-tag); pcDNA3J-SAG (human SAG cDNA subcloned into the BamHI site of pcDNA3J, downstream from the CMV promoter and upstream and in-frame with the myc-his-tag, such that upon expression, the resulting fusion protein consists of the SAG protein followed by the myc-his tag at the carboxy-end of SAG); or pcDNA3J-LacZ (Invitrogen).
  • pcDNA3J Invitrogen vector pcDNA 3 with a myc-his-tag
  • pcDNA3J-SAG human SAG cDNA subcloned into the BamHI site of pc
  • SAG fusion protein was detected in both the cytoplasm and nucleus, while the ⁇ - galactosidase control was expressed predominately in the cytoplasm. No immunofluorescence staining was detected with the vector-only control. The cytoplasmic/ nuclear localization of SAG was confirmed also in a SAG stable transfectant using both SAG and myc-tag antibodies.
  • Example 6 Expression and purification of SAG protein in bacteria
  • the entire open reading frame of the human SAG cDNA was PCR amplified as described above and subcloned into the pETl 1 expression vector (Novogen) under control of the T7 promoter, yielding construct pETl la-hSAG.
  • the sequence and orientation of the SAG DNA insert were confirmed by DNA sequencing.
  • pETl la-hSAG was used to transform E. coli strain BL21 (Novagen, Inc.). Transfoimed cells were grown in LB media containing ampicillin (50 ⁇ g/mL). SAG expression was induced by 0.5 mM IPTG and SAG protein was found in inclusion bodies, which were subsequently isolated as follows.
  • the pellet was seen to have 2 layers.
  • the white layer on the top was carefully blown loose with TN buffer and removed.
  • the remaining dark brown layer on the bottom was resuspended thoroughly in 15 mL of urea buffer (7 M urea, 20 mM Tris-HCl, pH 7.5, 200 mM NaCl) and allowed to sit overnight at room temperature.
  • the resuspended cell pellet was vigorously homogneized with a serological pipette and then centrifuged at 40,000 rpm for 40 minutes using an SW50 ultracentrifuge rotor.
  • the supernatant was collected and concentrated using a Centricon-10 concentrator to a volume of 5 mL and loaded onto a Sephacryl-100 column (100 cm long with a diameter of 2.5 cm) that had been equilibrated with urea buffer.
  • the column was run at a rate of 0.25 mL/min and fractions were collected.
  • the early fractions containing a brownish color consisted of mostly the large molecular weight protein, as expected. They also contained a protein with the same size of SAG protein (approximately 13 lcDa). Since SAG protein contains 12 cysteine residues, it follows that SAG protein may form oligomers when expressed in bacteria and thus may elute as a SAG protein oligomer.
  • SAG is a redox-sensitive protein
  • DTT present in SDS sample buffer reduces SAG protein oligomers to monomer, leading to the detection of a fast migrating band.
  • 13 kDa SAG protein band disappeared, and a 260 kDa band was detected, representing a SAG protein 20-mer. This unique feature helped us to purify SAG protein.
  • Early fractions were pooled and loaded on the same Sephacryl-100 column pre-equilibrated with 7M urea and 5mM DTT.
  • SAG protein oligomer was reduced to monomer by using DTT in the loading buffer and was eluted in the later fractions, thus separating it from .high molecular weight contaminant proteins (eluted earlier).
  • the brownish fractions were pooled and concentrated using a Centricon-10 to a volume of 5 mL. DTT was added to a concentration of 5 mM.
  • the combined fractions were loaded onto an S-100 column (100 cm long with a diameter of 2.5 cm), that had been equilibrated with urea buffer plus 5 mM DTT. The column was run at a rate of 0.25 mL/min and fractions were collected.
  • the fractions containing SAG protein are brownish in color, highly suggesting that SAG is a heme-containing protein.
  • the SAG protein containing fractions and their sensitivity to DTT were confirmed by Western blot using SAG antibody.
  • the brownish fractions were pooled and concentrated using a Centricon-10 concentrator to a volume of 2 mL.
  • the resulting sample was dialyzed against 4 liters of dialysis buffer (150 mM KC1, 20 mM Tris-HCl, pH 7.5) at 4°C overnight to remove urea and DTT to yield refolded SAG protein.
  • the dialyzed sample was loaded onto an S-100 column (100 cm long with a diameter of 2.5 cm), that had been equilibrated with dialysis buffer.
  • the brownish fractions were pooled and concentrated using a Centricon-10 to a volume of 1 mL.
  • the resulting sample was stored at 4°C.
  • the protein concentration was determined by a BioRad protein assay. The purity of the samples was demonstrated in 10-20% SDS-PAGE.
  • DTT (1 M, 300 mM, 100 mM, or 30 mM) or H 2 O2 (15 mM, 50 mM, 150 mM or 450 mM) for 10 min before being separated by polyacrylamide gel electrophoresis (PAGE), followed by Western blot analysis.
  • PAGE polyacrylamide gel electrophoresis
  • 10 ⁇ g of SAG protein was incubated with 50 mM H2O2 for 10, 30, 60 or 120 minutes followed by PAGE separation and Coomassie Blue staining.
  • Dimers of SAG protein are rather resistant to reducing reagent DTT since no significant dimer was reduced to monomer after DTT treatment.
  • H2O2 induces oligomerization of SAG protein, possibly through the formation of intermolecular disulfide bonds.
  • the oligomerization is incubation-time dependent, as higher order SAG protein oligomers were detected upon increased incubation time.
  • a band migrating faster than the monomer form is observed upon H2O2 treatment, and the monomer form of SAG protein becomes a doublet, possibly due to the formation of intramolecular disulfide bonds.
  • H2 ⁇ 2Jnduced SAG protein oligomerization can be reversed by DTT treatment
  • 1 ⁇ g of purified SAG protein was incubated with 50 mM H2O2 for 10 minutes, followed by a 10 minute incubation with either H2O2, 50 mM DTT, 100 mM,
  • SAG protein (1 ⁇ g) was pre-incubated with 50 mM NEM or DMSO, or buffer only, for 10 minutes prior to H2O2 treatment. The samples were separated via PAGE, followed by Western blot analysis. Pre-incubation of SAG protein with DMSO did not affect H2 ⁇ 2Jnduced oligomerization and doublet formation, whereas NEM pre-treatment abolished H2O2 activity. Neither inter-
  • PCR products were digested with restriction enzymes Nhe I and Bam HI and subcloned into the pETl la vector, which was digested with the same restriction enzymes.
  • a QuickChange site-directed mutagenesis kit was purchased from Strategene (La Jolla, CA) and used as instructed. All SAG mutants generated were verified by DNA sequencing (SEQ ID 21, SEQ ID 23, SEQ ID 25, SEQ ID 27, SEQ ID 29, SEQ ID 31, SEQ ID 33, SEQ ID 35, SEQ ID 37, SEQ ID 39, SEQ ID 41, SEQ ID 43, SEQ ID 45, SEQ ID 47 and SEQ ID 49).
  • the predicted mutant SAG proteins encoded by these mutant SAGs are shown in SEQ ID 22, SEQ ID 24, SEQ ID 26, SEQ ID 28, SEQ ID 30, SEQ ID 32, SEQ ID 34, SEQ ID 36, SEQ ID 38, SEQ ID 40, SEQ ID 42, SEQ ID 44, SEQ ID 46, SEQ ID 48, and SEQ ID 50.
  • SAG mutant-expressing vectors were used to transform E.coli strain BL21 (Novagen, Inc.). Mutant SAG protein was expressed and purified as detailed in Example 6. The fractions after a Sephacryl-100 column were collected and analyzed on 8-25% Phast gels followed by Coomassie blue protein staining. The pure fraction containing mutant SAG protein was dialyzed in 4 liters of 20 mM Tris-HCl, pH 7.5 and used for SAG protein oligomerization studies. Purified wildtype SAG protein is a heme-containing brownish protein (See
  • Example 9 Some of the purified SAG protein mutants were found to have either lost the brownish color (MM3 and MM13) or had decreased brownish color (MM1) compared to wildtype SAG protein. This color change indicates the loss or decrease of heme binding (Table 1).
  • each mutant SAG protein as well as wildtype SAG was treated with 50 mM H2O2 for 10 min. All of the SAG mutants, except
  • MM 14 can be oligomerized upon exposure to H2O2.
  • Heme content in SAG protein was measured as previously described (.Rieske (1967) Methods in Enzymol. 76, 488-493). Briefly, 1 mg of purified SAG protein, along with cytochrome C, catalase, and BSA as controls, was extracted with cold acetone (0.5 mLs) After centrifugation the pellet was extracted sequentially with 0.5 mL of chlorofo ⁇ m:methanol (2:1); 0.5 mL of cold acetone, and finally 0.5 mL of cold acetone containing 5 ⁇ L of 2.4 N HC1. The acetone extracts were dried under speed-vac and dissolved in 0.5 mL of pyridine.
  • SAG-Pepl QNNRCPLCQQDWVVQR
  • SEQ ID 10 A 16-amino- acid peptide located in the C terminus of SAG protein (codons 95-110) was synthesized and purified via standard techniques. The purified peptide was conjugated to keyhole limpet hemocyanin (KLH) via cysteine residues.
  • KLH keyhole limpet hemocyanin
  • the conjugated peptide (0.5 mg) was emulsified with equal volume of Complete Freund Adjuvant (CFA) and subcutaneously injected into rabbit, followed by 4 boosts with 0.5 mg each in Incomplete Freund Adjuvant (IF A) at 3 week intervals. Rabbits were bled 10 days after the final boost and antiserum was collected. The same protocol was used for protein antibody production using purified human SAG protein as the antigen, prepared as described above.
  • CFA Complete Freund Adjuvant
  • IF A Incomplete Freund Adjuvant
  • SAG protein belongs to the zinc ring finger protein families by virtue of its C3H2C3 motif (Saurin et al. (1996) TIBS 21, 208-214). Some zinc ring finger proteins have been shown to bind to DNA and function as transcriptional repressors (for example, RfNGl) (Satijn et al. (1997) Mol. Cell. Biol. 17, 4105-4113), whereas others function as transcriptional activators (Chapman and Verma (1996) Nature 382, 678-679; Monteiro et al. (1996) Proc. Natl. Acad. Sci. USA 93, 13595-13599).
  • the cDNA encoding the entire open reading frame of human SAG was PCR amplified and fused both in frame and as an antisense fusion, downstream of the Gal-4 DNA binding domain (encoding amino acids 1-147) in the pG4 vector (Sadowski et al., Nature 335:563-564, 1988).
  • the resulting construct was sequenced to confirm in frame fusion and freedom from PCR-generated mutation.
  • the construct was co-transfected along with a chloramphenicol acetyltransferase (CAT)-reporter-expressing vector (Sadowski et al., Nature 335:563-564, 1988) as well as a ⁇ -galactosidase reporter whose expression is driven by a CMV promoter for normalization of transfection efficiency into human kidney 293 cells (ATCC accession number CRL1573) by the calcium phosphate method.
  • CAT activity was measured 36 hours post-transfection using a CAT assay kit (Quan-T-CAT; Amersham) according to the manufacturer's instructions.
  • PG4-VP16 a .known transcription factor (Triezenberg et al., Genes and Develop.
  • SAG constructs both sense and antisense were co-transfected with pG4-VP16. Again, neither orientation of SAG induced significant expression of VP16-induced transactivation. These results demonstrated that SAG protein lacks transcriptional regulatory activity when fused downstream Gal-4 DNA binding domain.
  • SAG is an RNA binding protein
  • the zinc-ring finger domain of the MDM2 protein has been shown to bind to RNA (Elenbaas et al. (1996) Mol. Med. 2, 439-445). Since SAG protein showed no transcriptional regulatory activity, it was tested whether SAG protein could bind to RNA or DNA. Binding of purified SAG protein to different nucleic acid cellulose conjugates was performed as described (Elenbaas et al. (1996)).
  • RNA binding buffer consisted of 20 mM Tris, pH 7.5, 150 mM NaCl, 5 mM MgCl 2 , 0.1% nonidet P-40, 50 ⁇ M ZnCl2, 2% glycerol, and 1 mM DTT.
  • RNA binding buffer 3 mL RNA binding buffer to remove non-specifrcally bound protein from the beads, which were then boiled in SDS sample buffer.
  • the protein so eluted from the beads was separated by SDS-PAGE, transferred to nitrocellulose for Western blot analysis using the polyclonal antibody directed against SAG protein described previously detected by ECL chemiluminescence (Amersham) according to the manufacturer's instructions.
  • Purified SAG bound to polyU, polyA, and polyC RNA respectively. No binding was seen with polyG RNA or ssDNA. A band showing dsDNA binding did not agree with SAG molecular weigh.
  • Oligomeric SAG protein bound to polyU RNA, whereas the monomeric form of SAG binds to polyA and polyC ⁇ RNA.
  • Purified SAG protein was run as a marker.
  • SAG mutant 1 SEQ ID 11
  • SAG mutant 2 SEQ ID 13
  • the primers used for PCR were hSAG.Ml, 5' GCCATCTGCAGGGTCCAG-3' (SEQ ID 15), starting at nt 151 of hSAG cDNA, and SAGT.02-1 5'-GGATCCTCATTTGCCGATTCTTTGGAC-3' (SEQ ID 16), including stop codon (underlined).
  • the resulting fragment is 200 bp for wildtype SAG.
  • the PCR was conducted in the presence of and PCR products were resolved in 6% denaturing sequencing gels, as described previously (Sun et al. (1995) Cancer Epidemiology, Biomarkers & Prevention, 4, 261-267). The bands corresponding to wildtype as well as the two deletion mutants were cut out from the gel, PCR amplified using the same set of primers, and sequenced to verify the DNA sequence of the resulting PCR fragments.
  • RNA from only the CATES-1B cell line a testicular carcinoma line obtained from ATCC (accession number HTB104). This tumor line also contains the wildtype SAG DNA sequence. The identity of these three bands was confirmed by DNA sequencing after PCR amplification and TA cloning. HONE-1, a nasopharyngeal carcinoma line which only contains wildtype SAG was included for comparison.
  • DLD-1 cells were transfected with the following plasmids: the neo control pcDNA-3 (Invitrogen) (identical to pcDNA3J described above, except that it lacks the myc-his tag), pcDNA-SAG, pcDNA-SAG-mutant-1, and pcDNA-SAG-mutant-2 (pcDNA3 with SAG, SAG 1 or SAG 2 subcloned into the BamHI site, respectively, using methods well .known in the art).
  • the SAG mutant constructs were generated by RT-PCR as follows.
  • the primers used were SAG.TAOl (SEQ ID 7) and SAGT.02 (SEQ ID 8), which flank the entire coding region of SAG gene.
  • the PCR products were digested with restriction enzyme Bam HI, and subcloned into pcDNA3 (In Vitrogen, San Diego), a mammalian expression vector under the transcriptional control of the CMV promoter, which drives gene expression constitutively.
  • the resultant clones were sequenced to confirm both sense and antisense orientation and freedom of PCR-generated mutations.
  • DLD-1 cells were transfected by lipofectamine (BRL) with plasmids expressing wildtype (both sense and antisense orientation), SAG mutant- 1, and SAG mutant-2, along with the neo control vector.
  • Neomycin resistant colonies were identified by G418 selection (600 ⁇ g/mL) for 18 days.
  • Stable clones were ring-isolated by well .known methods (Sun et al. (1993) Proc. Natl. Acad. Sci. USA. 90: 2827-2831) and SAG expression was monitored by Northern analysis. Selected clones were examined for SAG protein expression by immunoprecipitation, as described below.
  • Cell lines transfected with the following constructs were analyzed: vector controls Dl-3 and Dl-6; SAG-wildtype D12-1 and D12-8; SAG-mutant-1 D3-3 and D3-4; and SAG-mutant-2 D4-2 and D4-5.
  • Subconfluent SAG transfectants were subjected to methionine starvation for 1 hour and then metabolically labeled with 35s- ranslabel (0.2 mCi/mL) for 3 hours. Cells were then lysed on ice for 30 minutes in a lysis buffer comprising 2% Nonidet P40, 0.2% SDS,
  • Example 15 Morphological appearance of SAG transfectants after exposure to redox reagents
  • the neo-control cells were shrunken and detached, a sign of apoptosis, while SAG-expressing cells appeared morphologically noimal.
  • SAG production protects cells from apoptosis induced by redox compounds.
  • Expression of SAG did not offer the protection against copper. No difference in morphological signs of apoptosis was observed with CUSO4 treatment (up to 750 ⁇ M) between the vector controls and SAG transfectants.
  • SAG-transfected cells were seeded at 3.5 x 10 ⁇ per 100 mm dish and exposed after 16-24 hours to 150 ⁇ M OP, 125 ⁇ M zinc sulfate, or 200 ⁇ M H2O2 for 24 hours. Both detached and attached cells in 2 x 100 mm dishes were harvested and subjected to DNA fragmentation analysis as follows.
  • SAG protein contains a zinc ring finger motif
  • Zinc induced apoptosis in DLD-1 cells transfected with the vector only. Induction of apoptosis was limited by SAG overexpression, which showed much less DNA fragmentation than the control lines. This data suggests that the SAG protein binds to and chelates zinc through the zinc ring finger domain and thus provides increased resistance to zinc toxicity compared to non-transfected cells.
  • Another feature of SAG is the formation of oligomers after exposure to H2O2. Cells may be protected from H2O2 induced toxicity by SAG oligomerization.
  • SAG-transfected cells were, therefore, treated with H2O2 followed by assays for DNA fragmentation.
  • H2O2 induced apoptosis in DLD-1 cells.
  • SAG protein overexpression partially protected cells from H2 ⁇ 2-induced apoptosis, as evidenced by a reduction in DNA fragmentation.
  • DLD-1 cells were transfected with the neo control vector, or vectors expressing SAG, SAG mutants 1 or 2, or antisense SAG, as described above.
  • Neomycin resistant colonies were selected with G418 (600 ⁇ g/mL) for 18 days and stained with 50% methanol/10% acetic acid/0.25% Coomassie Blue.
  • D15-1 A stable DLD-1 transfectant expressing antisense SAG mRNA (D15-1) was cloned after G418 selection in order to examine potential changes in tumor cell phenotype caused by decreased SAG expression.
  • SAG transfected cells (D15-1) exhibited a 60% reduction in endogenous SAG protein. Monolayer growth of DLD-1 cells was significantly inhibited by antisense SAG transfection. None of the other transfectants were growth-inhibited, as compared to the neo control. It was next examined whether antisense SAG-transfected cells would exhibit growth inhibition in soft agar. D15-1 cells, along with transfectants expressing wildtype SAG (D12-8), SAG mutant-1 (D3-3), SAG mutant-2 (D4-2), as well as the neo control (Dl-3) were grown in 0.25% agar medium for 14 days. Colonies containing greater than 16 cells were counted. Three independent experiments, each run in duplicate, were performed.
  • Example 18 Cancer gene therapy using adenovirus expressing antisense SAG
  • SAG can be used as a target for cancer gene therapy.
  • Methods for conducting cancer gene therapy are well .known in the art (see Zhang and Fang, Exp. Opin,
  • Tumor cell lines with endogenous SAG expression including, but not limited to
  • tumor cells from tissue culture are suspended in PBS at a concentration of 5 x 10 ⁇ /mL and stored on ice.
  • 0.2 mL of the cell suspension (containing approximately ten million cells) is subcutaneously injected into the flank of 6- to 8-week-old athymic nude mice and tumors are allowed to grow for 30-40 days or until the average tumor size reaches 5 mm.
  • Recombinant adenoviral vectors expressing antisense human SAG, driven by the CMV promoter were produced by co-transfecting a shuttle plasmid (pJM17, circularized Ad5 genome) and a recombinant plasmid (pEC-SAG; a CMV driven plasmid containing left arm of Ad5 genome) into 293 cells. Tumors are injected with either OJ mL of recombinant adenoviral solution (1-5 x
  • the treated group is subdivided into three sub-groups (10 mice per subgroup): group A receives adenovirus alone (see above); group B receives adenovirus and at the same time receives an intraperitoneal injection of adriamycin (3 nig/T g) an oxygen radical-generating reagent, and group C receives adenovirus plus irradiation at 350cGy of cesium-137.
  • group A receives adenovirus alone (see above);
  • group B receives adenovirus and at the same time receives an intraperitoneal injection of adriamycin (3 nig/T g) an oxygen radical-generating reagent, and group C receives adenovirus plus irradiation at 350cGy of cesium-137.
  • antisense SAG blocks endogenous SAG synthesis, which renders tumor cells supersensitive to oxygen radicals.
  • the tumors in both control and treated groups can be further examined histologically.
  • Samples can be immediately embedded in optimal cutting temperature compound (Miles, Inc. Ellchart, Indiana) and snap-frozen in liquid nitrogen for frozen section preparation (3-5 ⁇ m) for enzymatic staining (e.g., terminal deoxynucleotidyl transferase (Boehringer Manheim, Indianapolis, Indiana) staining for apoptosis) or immunohistochemical staining for expression of the antisense SAG.
  • the samples may be fixed in 10% formalin for histologic sectioning and analyze with hematoxylin-eosin (Sigma, St. Louis, Missouri) staining.
  • Example 19 SAG functions as a oxygen radical scavenger to prevent oxygen radical induced damages
  • SAG protein contains 12 cysteine residues and foims disulfide bonds both intermolecularly and intramolecularly after exposure to hydrogen peroxide. SAG protein also binds to heme, which can modulate oxidants by oxidation/reduction of Fe(++). This oxidative buffering activity may qualify SAG as an oxygen radical scavenger.
  • Example 20 Prevention of IL-l ⁇ induced brain injury during ischemia by SAG administration
  • RSV promoter AdRSV-SAG
  • the adenoviral suspension is injected stereotactically into the lateral ventricle to ensure SAG expression in brain.
  • Five days after administration of adenovirus, middle cerebral artery is occluded in animals for 24 hours as described (Yang et al., Brain Research 751:181-188, (1997)).
  • Brain edema (as measured by brain water content) and cerebral infarct size, measured by histological techniques (Yang et al., Stroke 23:1331-1336, (1992)) is determined.
  • any reduction of brain edema and infarction size indicates SAG protection against free radical induced damage.
  • middle cerebral artery occlusion is perfoimed with the rat suture model, allowing either permanent (6 hours) or temporary occlusion (3 hours of occlusion and 3 hours of reperfusion) (Yang and Betz, Stroke, 25:1658-1665, (1994)).
  • Rats then receive an injection of purified SAG protein at the size of occlusion.
  • Brain water, ion contents, and infarct volume are measured to determine brain infarction and blood-brain barrier disruption.
  • reduction in brain infarction size and blood-brain barrier disruption indicates a SAG protective effect.
  • Example 21 Human cancer diagnosis using SAG as a marker:
  • SAG deletion mutants in human cancer cell lines originating from colon and testis have been identitifed. Twelve pairs of colon carcinomas and adjacent normal tissues were collected from 12 patients. Genomic DNA and total RNA are isolated from these samples and subjected to PCR amplification. The resulting amplification products are analyzed for detection of SAG deletion mutations by methods well known in the art, including but not limited to RNA protection assays, DNA sequencing, hybridization, and gel electrophoresis for deletion mutants. Mutations detected in tumor tissues but not in normal adjacent tissues indicate that they are tumor specific mutations and can be used as a diagnostic tool in the clinic for colon as well as testicular carcinomas.
  • yeast homolog of human SAG gene is essential for yeast growth
  • yeast SAG knock-out mutants were constructed by homologous recombination.
  • the construct used to knockout yeast SAG was made by PCR of a kanamycin cassette from kanMX4 plasmid (Wach et al., Yeast 10:1793-
  • the primers used for PCR were SAGKanMX4-5:
  • CGTACGCTGCAGGTCGAC-3' SEQ ID 17
  • SAGKanMX4-3 5'-ACCTCGGTA TGATTTAAATGTTTACGGGCAATTCATTTTT
  • the primer SAGKanMX4-5 consists of yeast SAG DNA sequence (ATCC Accession number Z74876) immediately upstream of the initiation codon ATG (underlined) and the upstream kanamycin cassette sequence at its 3'- end.
  • Primer SAGKanMX4-3 consists of yeast SAG DNA sequence immediately downstream of the stop codon TGA (underlined) and the downstream kanamycin cassette sequence at its 3'-end.
  • PCR was conducted for 5 cycles at 94°C 1 min, 50°C, 1.5 min, 72°C 2 min, followed by 25 cycles at 94°C, 1 min, 56°C, 1.5 min, 72°C 2 min, followed by a 10 min extension at 72°C.
  • the resulting PCR product (1.5 kb) was gel-purified using Qiaex II gel-purification kit (Qiagen) according to the manufacturer's instruction, and was used to transfect the diploid yeast strain Y21 using the YEASTMAKER yeast Transformation System (ClonTech Laboratory, Inc.) according to the manufacturer's instruction.
  • yeast cells were grown in YPD media (Difco) containing G418 (200 ⁇ g/mL, BRL) to select transfectants containing the kanamycin cassette, which have had the yeast SAG deleted by homologous recombination.
  • SAGPCR- 5 5'-TTCTCCAGTGGCAGAGAAC-3' (SEQ ID 19) and SAGPCR-3: 5'- ATGATTTAAATGTTTACGGGC-3' (SEQ ID 20). These primers constitute fragments of SAGKanMX4-5 and SAGKanMX4-3, respectively, and flank the entire yeast SAG coding region.
  • PCR of wildtype yeast SAG produces a 0.35 kb band
  • PCR of SAG deletion mutants give rise to 1.5kb band, consisting of the kanamycin cassette.
  • yeast SAG is essential for growth.
  • 12 individual heterozygous yeast strains y21- ySAG/ySAG::Kan
  • the strains were inoculated into minimal potassium acetate sporulation media, supplemented with uracil, lysine, adenine and tryptophan (Kassir, and Simchen, G. Method Enzymol. 194, 94- 110, 1991) and grown at 30°C for 7 days. Tetrads was dissected into 4 haploid offspring from each strain.
  • a clamp of cells from the sporulation plate was suspended in 100 ⁇ L of 1 M glycerol containing 0.5 mg/mL zymolase T20. After 30 min at 37°C, the suspension was diluted with 800 ⁇ L sterile water and put on ice. A loop of suspension was struck across a YPD plate and examined under a Zeiss Tetrad microscope for tetrads. The glass microneedle of the scope was used to dissect 4 tetrads from each strain. Two of these four haploid cell should contain wildtype SAG, while the other two should contain a yeast SAG deletion.
  • hSAG was cloned into a yeast expression vector with URA3 selectable marker.
  • the hSAG-URA plasmid was then transfoimed into heterozygous ySAG .knockout cells, and transformants were selected on URA-minus plates. Clones expressing hSAG (measured by Western blot analysis) were sporulated and tetrads were dissected.
  • wildtype human SAG along with the SAG mutants (MM3, sequence ID 25; MM10, sequence ID 39; and MM14, sequence ID 47, Figure 1A) were constructed into a plasmid with Trp selection marker and transfected into heterozygous yeast strain (y21-SAG/ySAG::Kan) as described above.
  • the clones grown in Trp-minus/G418-plus plates were examined by Western blot analysis for SAG expression.
  • the clones expressing human SAG were sporulated and dissected. In 10 wildtype human SAG clones, 3 or 4 haploids are viable.
  • yeast SAG Some of them contain yeast SAG, whereas the others contain ySAG K/O plus human SAG, indicating human wildtype SAG can complement yeast SAG knockout. All three mutant clones (total of 41 tested) gave rise to 1 or 2 haploids and all survival haploids contains yeast SAG, indicating that human SAG mutants cannot complement yeast SAG .knockout.
  • SAG contains a zinc-ring finger domain, it has the potential to bind with metals.
  • electrospray ionization mass spectrometry (ESI-MS) (Fenn et al., 1989) was used to compare the molecular mass of SAG under denaturing and non-denaturing solution conditions (Loo, 1997; Witkowska et al., 1995).
  • ESI-MS was performed with a double focusing hybrid mass spectrometer (Finnigan MAT 900Q, Bremen, Germany) with a mass-to-charge (m/z) range of 10,000 at 5 kV full acceleration potential.
  • a position-and-time-resolved-ion-counting (PATRIC) scanning array detector was used.
  • n ESI interface based on a heated metal capillary inlet and a low flow micro-EsI source 150 nL/min analyte flowrate) were used (Sannes-Lowery et al., 1997). The metal capillary temperature was maintained around 150-200°C for metal-protein complex studies.
  • Recombinant protein under 7 M urea-denaturing solution was refolded by dialyzing in 50 ⁇ M ZnCl2 for 3 days with three changes of buffer.
  • the SAG solution was washed with a solution of lO mM ammonium bicarbonate (pH 7) and 1 mM DTT, and excess zinc was removed by centrifugal ultrafiltration by passing through a 10 kDa molecular weight cut-off centrifugal filtration cartridge (Microcon-10 microconcentrator, .Amicon, Beverly, MA).
  • a small portion of the filtered SAG protein solution was diluted into either a denaturing solvent (80:15:5 acetonitrile:water:acetic acid v/v/v, pH 2.5) or a non-denaturing solution (10 mM ammonium bicarbonate and 1 mM DTT, pH 7).
  • Zinc binding of SAG was first measured. Under a denaturing acidic solution (pH 2.5 and high organic concentration) where the protein is not expected to retain metal-binding characteristics even in the presence of zinc, the molecular mass of SAG was measured to be 12550, in close agreement with the expected mass for the apo-protein (12552 Da).
  • the ESI-MS analysis of the SAG protein in a non-denaturing aqueous solution (pH 7) resulted in an increase in mass to 12733 and 12800 Da. These masses are consistent for the holo-protein binding 3 and 4 zinc metal ions, respectively.
  • Example 25 SAG minimizes or prevents LDL oxidation induced by copper ion or a free radical generator Due to its H2O2 buffering and metal binding, it was reasoned that SAG may prevent oxidation of macromolecules induced by metal or free radical generator.
  • AAPH low density lipoprotein
  • Lipoproteins (100 ⁇ g of protein/mL, Intraocel) were incubated with 10 ⁇ M CUSO4 or with 5 mM .AAPH for 4 hours at 37°C in the presence of various concentrations of purified SAG protein.
  • AAPH is a water-soluble azo compound that thermally decomposes and generates water soluble peroxyl radicals at a constant rate (Frei et al., 1988). Oxidation was terminated by the addition of 10 ⁇ M butylated hydrozytoluence (BHT) and refrigeration at 4°C.
  • BHT butylated hydrozytoluence
  • Inhibitory activity was, however, completely or partially abolished by pretreatment of SAG with alkylating reagents NEM and p-hydroxy mercury benzoate (PHMB), respectively.
  • metallothionein a small metal binding protein consisting of 20 cysteine residues out of 61 amino acids (Nordberg & Kojima, 1979) showed a similar inhibitory curve as SAG.
  • Glutathion (GSH) an additional cysteine containing peptide showed a 25% inhibition at a concentration of 100 ⁇ M.
  • Example 26 SAG protects cytochrome C release and caspase activation induced by metal ions
  • cytochrome C A significant amount of cytochrome C started to release 6 hours post CUSO4 (2.0 mM) treatment and lasted up to 12 hours. Expression of SAG delayed cytochrome C release for up to 16 hours. Activation of caspase 7 was seen in the vector control cells 12 hours and 16 hours post copper treatment. No significant activation was seen in SAG transfectants. The similar result was seen with CPP32 antibody. For zinc treatment, no difference was detected in cytochrome C release and caspase activation between control cells and SAG transfectants, consistent with the lack of difference in mo ⁇ hological signs of apoptosis.
  • Example 27 SAG protects against neuronal apoptosis SAG was transfected into HY5Y human neuroblastoma cells and a few stable lines were selected which expressed exogenous SAG as determined by Western blot.
  • SYW-20 SAG- transfectant
  • SYV-3 vector control
  • TUNEL assay a fluorescein labelling assay of free 3'-OH termini generated from cleavage of genomic DNA during apoptosis.
  • TUNEL assay In situ cell death assay (TUNEL assay) was perfo ⁇ ned according to the manufacturer's instructions (Boehringer Mannheim). Briefly, 5 x 10 ⁇ cells were plated into the 8-well glass slides. After treatment with 1.25 mM copper (CUSO4) or 200 ⁇ M zinc
  • SAG protects neuronal cells from apoptosis.
  • SAG RNA 8 ⁇ g/mL or 25 ⁇ g/mL
  • control ⁇ -galactosidase 25 ⁇ g/mL
  • SAG-expressing cells have 10-fold more 3H-thymidine inco ⁇ oration in both conditions (serum-free or 1% serum), indicating that SAG stimulates cell proliferation/growth.
  • yeast homolog of human SAG gene is essential for yeast growth.
  • hSAG expressing plasmid was constructed under control of Gal promoter. The plasmid was transfo ⁇ ned into heterozygous ySAG knockout and transformants were sporulated and dissected. Haploid ySAG knockout clone that contained hSAG plasmid was identified and analyzed. In the uninduced condition, little SAG expression due to the leakness of the promoter led to formation a tiny clone compared to the full size wildtype clone. Under induced condition, SAG expression level increased and clone size also increased. This experiment clearly demonstrated that SAG promotes cell growth in a dose-dependent manner.

Abstract

Cette invention se rapporte à de nouveaux gènes et à des polypeptides dérivés de ces gènes codant une protéine sensible à l'oxydoréduction qui favorise la croissance cellulaire, protège les cellules contre l'apoptose, séquestre les radicaux d'oxygène et peut servir à inverser les phénotypes des tumeurs. Dans une tentative d'identifier un ou des gènes responsables de l'apoptose induite par 1,10-phénanthroline (OP) dans les cellules tumorales, nous avons utilisé la technique de présentation différentielle et cloné un gène induisible par OP, le SAG (gène sensible à l'apoptose). Le SAG code une nouvelle protéine sensible à l'oxydoréduction, se fixant à l'hème, à l'aide d'un domaine de protéines à doigt de zinc. La protéine de SAG se compose de 113 acides aminés, avec un poids moléculaire calculé de 12,7 kDa. Les recherches sur l'homologie des séquences ont révélé que le SAG est fortement conservé parmi les espèces, ce qui suggère son importance fonctionnelle. Cette suggestion est prouvée par la découverte selon laquelle la dislocation du SAG dans la levure est létale. Deux mutants de délétion du SAG ont été détectés dans des lignées cellulaires de cancer humain prenant naissance dans le colon et dans les testicules, ce qui suggère son possible rôle dans la carcinogenèse humaine. La surexpression de la protéine de SAG dans une lignée de carcinomes de colon humain, DLD1, et dans une lignée de neuroblastomes humains, SY5Y, protège les cellules contre l'apoptose induite par OP, par le zinc et par des ions de cuivre. En outre, la transfection de SAG anti-sens inhibe certains phénotypes de cellules tumorales dans les lignées de cellules humaines DLD1 et la micro-injection d'ARN de SAG stimule la croissance cellulaire. Nous proposons que la protéine de SAG soit une molécule de protection cellulaire fonctionnant comme un capteur d'oxydoréduction pour faire tampon aux dommages induits par des contraintes oxydatives, ainsi qu'un facteur de croissance destiné à stimuler la croissance cellulaire. La protéine de SAG peut être une cible moléculaire idéale dans l'élaboration de médicaments contre les maladies neurodégénératives, les cancers et les dystrophies musculaires, et pour favoriser la cicatrisation.
EP98963962A 1997-12-19 1998-12-15 Sag: gene sensible a l'apoptose Withdrawn EP1044217A2 (fr)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US6817997P 1997-12-19 1997-12-19
US68179P 1997-12-19
US9984098P 1998-09-11 1998-09-11
US99840P 1998-09-11
PCT/US1998/026705 WO1999032514A2 (fr) 1997-12-19 1998-12-15 Sag: gene sensible a l'apoptose

Publications (1)

Publication Number Publication Date
EP1044217A2 true EP1044217A2 (fr) 2000-10-18

Family

ID=26748669

Family Applications (1)

Application Number Title Priority Date Filing Date
EP98963962A Withdrawn EP1044217A2 (fr) 1997-12-19 1998-12-15 Sag: gene sensible a l'apoptose

Country Status (8)

Country Link
EP (1) EP1044217A2 (fr)
JP (1) JP2001526063A (fr)
KR (1) KR20010033299A (fr)
AU (1) AU765741B2 (fr)
BR (1) BR9813757A (fr)
CA (1) CA2303483A1 (fr)
NZ (1) NZ503417A (fr)
WO (1) WO1999032514A2 (fr)

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7078203B1 (en) 1999-03-31 2006-07-18 The University Of North Carolina At Chapel Hill Isolated DNA encoding cullin regulators ROC1 and ROC2, isolated proteins encoded by the same, and methods utilizing the same
CA2364305A1 (fr) * 1999-03-31 2000-10-05 The University Of North Carolina At Chapel Hill Adn isole codant pour des regulateurs cullin roc1 et roc2, proteines isolees codees par ledit adn. procedes d'utilisation associes
AU2872501A (en) * 1999-12-21 2001-07-03 Eirx Therapeutics Limited Screening method
US6979551B2 (en) 2000-04-03 2005-12-27 Rigel Pharmaceuticals, Inc. Assays for identifying ubiquitin agents and for identifying agents that modify the activity of ubiquitin agents
US6740495B1 (en) 2000-04-03 2004-05-25 Rigel Pharmaceuticals, Inc. Ubiquitin ligase assay
AU2001269326A1 (en) * 2000-07-07 2002-01-21 Eirx Therapeutics Limited Screening method
US7101990B2 (en) 2000-12-22 2006-09-05 Janssen Pharmaceutica N.V. Bax-responsive genes for drug target identification in yeast and fungi
CN115345122B (zh) * 2022-08-31 2023-03-17 沐曦科技(北京)有限公司 一种用于仿真的非标准总线协议的芯片验证装置

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9932514A2 *

Also Published As

Publication number Publication date
NZ503417A (en) 2002-12-20
AU1918099A (en) 1999-07-12
WO1999032514A2 (fr) 1999-07-01
CA2303483A1 (fr) 1999-07-01
AU765741B2 (en) 2003-09-25
WO1999032514A3 (fr) 1999-09-10
JP2001526063A (ja) 2001-12-18
BR9813757A (pt) 2000-10-03
KR20010033299A (ko) 2001-04-25

Similar Documents

Publication Publication Date Title
US7064193B1 (en) Therapeutic molecules
JPH09504959A (ja) 哺乳動物細胞周期蛋白質
JPH09502088A (ja) 細胞死レギュレータ
US6545128B1 (en) Anti-bax inhibitor protein antibodies
AU765741B2 (en) Sag: sensitive to apoptosis gene
EP0932674B1 (fr) NOUVEAU GENE DE MAMMIFERE bcl-w APPARTENANT A LA FAMILLE bcl-2 DE GENES LUTTANT CONTRE L'APOPTOSE
MXPA01008626A (es) Inhibidor novedoso de muerte programada de celula.
JP2001509018A (ja) Ｐ５３応答マウス遺伝子ｅｉ１２４に類似なｄｎａがコードするヒトアポトーシス関連タンパク質
US6600024B1 (en) Blk genes, gene products and uses thereof in apoptosis
CA2266427A1 (fr) Molecules d'acide nucleique codant les proteines de destruction tumorale et procede pour isoler ces molecules
US7256321B2 (en) Intracellular modulators of apoptopic cell death pathways
EP1180525B1 (fr) Proteine inhibitrice d'activation transcriptionnelle
EP1007672B1 (fr) Glissieres a leucine induites par un glucocorticoide servant de modulateurs intracellulaires des mecanismes d'apoptose cellulaire
MXPA00003201A (en) Sag:sensitive to apoptosis gene
CA2376382A1 (fr) Gene codant pour "nade" ou activateur de mort cellulaire associe a p75ntr et procede de son utilisation
AU752360B2 (en) Novel therapeutic molecules
JP2005287418A (ja) 細胞殺傷性と細胞死防御性とを併せもつペプチド
WO2004037857A1 (fr) Proteines bfk comme molecules therapeutiques

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20000719

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL PAYMENT 20000719;LT PAYMENT 20000719;LV PAYMENT 20000719;MK PAYMENT 20000719;RO PAYMENT 20000719;SI PAYMENT 20000719

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: WARNER-LAMBERT COMPANY LLC

17Q First examination report despatched

Effective date: 20060717

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20060701