Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
  • C12N9/80—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in linear amides (3.5.1)
  • C12N9/84—Penicillin amidase (3.5.1.11)
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
  • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
  • C07K14/245—Escherichia (G)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/70—Vectors or expression systems specially adapted for E. coli
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/70—Vectors or expression systems specially adapted for E. coli
  • C12N15/72—Expression systems using regulatory sequences derived from the lac-operon

Definitions

• the present invention concerns high expression vectors for expression of heterologous genes in bacteria such as Escherichia coli.
• Some of the more frequently used strong promoters for the expression of heterologous genes are the promoters from P L , tac, trp, trc and the T7 promoter described by Studier et al.
• the promoters used are generally regulatable. This feature is essential if the target protein to be expressed is toxic to the host. In general, the stronger the promoter, the more RNA will be transcribed from the DNA leading to the accumulation of messenger RNA.
• Other elements are also involved in the expression of heterologous genes.
• the efficiency of the translation is involved in maximizing the expression of heterologous genes. The efficiency of translation can be affected by the mRNA 5'-terminus sequences as well as by the 5'end hairpin structure of the mRNA.
• a functional ribosome binding site containing a Shine- Dalgamo (SD) sequence properly positioned to an AUG initiation codon is essential for efficient translation. Variation in the distance between the SD sequence and the AUG codon are known to affect mRNA translation. Studies have also shown when the SD sequence or the AUG initiation codon is sequestered in a double-stranded region of the mRNA, translation is less efficient due to the blocking of the accessibility of these sequences to the ribosome. Some other factors that have been reported to affect the efficient expression of heterologous genes are the stability of the messenger RNAs, the susceptibilities of the protein products to proteolysis and the effect of the host genetic background. Although there is a wealth of information about the elements that affect the overall efficiency of a plasmid based expression system, there are other elements that have not been studied which may be involved in the expression of heterologous genes.
• SD Shine- Dalgamo
• the expression vector of the invention further comprises: (e) groES DNA.
• the present invention concerns a prokaryotic host cell containing an expression vector comprising:
• the present invention is also directed to a method for producing a heterologous protein comprising culturing a host cell of the invention under conditions suitable for expression of the protein.
• FIG. 1 Construction of pBMS2000.103 and pBMS2000.75.
• Figure 7 Construction of pBMS2000.103GCA, pBMS2000.75GCA, and pBMS2000HGCA.
• FIG. 1 Construction of pBMS1000PGA, pET ⁇ dPGA, and pBMS2000PGA.
• the Escherichia coli GroES and GroEL are chaperone proteins which mediate the correct folding of a wide variety of polypeptides and facilitate oligomeric protein assembly by preventing premature interior intramolecular interactions that can lead to aggregation or misfolding structure.
• the GroES and the GroEL proteins are transcribed from the same mRNA.
• the expression vectors of the invention are based on the GroESL operon.
• Expression vectors of utility in the present invention are often in the form of "plasmids", which refer to circular double stranded DNA loops which, in their vector form, are not bound to the chromosome.
• the invention is intended to include such other forms of expression vectors which serve equivalent functions and which become known in the art subsequently hereto.
• the vectors of the invention are capable of expressing heterologous genes in large quantities in Escherichia coli.
• the vectors of the invention preferably have an origin of replication and a nucleic acid sequence coding for a selectable marker.
• the particular selectable marker used is not critical provided the marker allows for phenotypic selection in transformed host cells.
• Preferred selectable markers are antibiotic resistance. Examples of antibiotic resistance markers include ampicillin, tetracycline, chloramphenicol, kanamycin, gentamycin, nalidixic acid, rifampicin, spectinomycin, streptomycin, neomycin phosphotransferase, and the like.
• the tac promoter is followed by (i.e., upstream of) the complete gene sequence of the groES gene, which is followed by the intergenic region between the termination codon of the groES gene which is followed by the start codon of the groEL gene (termed herein the "groESL intergenic region"), which is followed by a restriction cloning site.
• the restriction cloning site can be introduced immediately at the start codon of the groEL gene or at the Rsal site in the coding region of the the groEL gene.
• Heterologous gene cloned into the former expression vectors will be expressed as the native protein whereas heterologous gene cloned into the latter expression vectors will be expressed as a fusion protein to the first 7 amino acids of the groEL gene.
• the cloning restriction sites supply the codon, ATG, the codon needed for the initiation of the translation.
• the vectors of the invention can be categorized into two classes, those containing the groES gene and those without the groES gene.
• the first class of vectors contain the strong regulatable promoter, tac, followed by the codons coding for the gene GroES.
• a cloning site is introduced into the Rsal site of the gene coding for GroEL or a cloning site is introduced immediately before the start codon of the GroEL gene.
• the gene product will be a fusion protein containing approximately 7 amino acids of the GroEL gene at the amino terminus; in the latter case, the gene product will be the native protein containing the amino acid methionine at the amino terminus.
• the vectors In both types of constructs, all the GroEL sequences after the introduced restriction site preferably are removed.
• the vectors contain the tac promoter followed by various length of the intergenic sequences between the groES and groEL gene and a restriction site which supply the initiation codon for the cloning of heterologous genes. The groES gene has been eliminated.
• the deletion of the groES gene sequences can be advantageous in some cases.
• the co-expression of the groES protein in large quantities may interfere with downstream processing, such as the immobilizaton of the enzymes to solid supports.
• an expression vector containing the gene sequences for the groES gene e.g., pBMS2000
• the vectors of the invention also optionally contain sequences coding for the lac repressor to regulate the transcription from the lac promoter; this allows expression of the heterologous gene cloned to be controlled by isopropyl- ⁇ -D-thiogalactopyranoside (IPTG) or lactose.
• IPTG isopropyl- ⁇ -D-thiogalactopyranoside
• vectors contemplated herein optionally express heterologous genes constitutively. This is accomplished by removing the operator sequences from the promoter region.
• An example of such a vector is plasmid pBMS2000H.
• Advantages in using a constitutive expression vector include elimination of the need to add an inducer to induce the system to express the heterologous gene products. This can decrease the cost of goods and simplify fermentation process by eliminating one fermentation parameter needed to be examined such as the optimal IPTG concentration and the optimal time to add the inducer to yield optimal expression of the gene product. It is possible, in some cases, that the cloning of heterologous genes in constitutive expression vectors will yield more heterologous gene products as the gene products are accumulated from the very beginning of the cell growth.
• the regulatory DNA sequences of the vectors of the invention are operatively linked to the DNA sequence coding for all or part of the heterologous gene sequence desired to be expressed.
• operatively linked means that the regulatory DNA sequences are capable of directing the replication and/or the expression of the DNA sequence coding for all or part of the protein desired to be expressed.
• the vectors of the invention can be used to express a wide variety of heterologous genes.
• heterologous genes that can be expressed using the vectors of the invention include D-amino acid oxidase gene from Trignopsis variabilis; genes encoding immunotoxins such as G28.5sFv-PE40 and BR110sFv-PE40; the gene coding for penicillin G amidase, the gene coding for the glutaryl cephalosporin amidase (GCA), and the like.
• the vectors of the invention yield higher titers of expressed enzymes (e.g., GCA), relative to other vectors known in the art, such as T-7 RNA polymerase based pET vectors.
• the expression vectors of the invention may also include other DNA sequences known in the art, for example, stability leader sequences which provide for stability of the expression product, secretory leader sequences which provide for secretion of the expression product, stability elements which provide mitotic stability to the plasmid, and other sequences which provide additional sites for cleavage by restriction endonucleases.
• stability leader sequences which provide for stability of the expression product
• secretory leader sequences which provide for secretion of the expression product
• stability elements which provide mitotic stability to the plasmid
• Other sequences which provide additional sites for cleavage by restriction endonucleases.
• the characteristics of the actual expression vector used must be compatible with the host cell which is to be employed.
• Suitable expression vectors containing the desired coding and control sequences may be constructed using standard recombinant DNA techniques as taught herein or as known in the art, many of which are described in T. Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982.
• the present invention additionally concerns host cells containing an expression vector of the invention. Suitable host cells are prokaryotic cells which are preferably biologically pure.
• Suitable prokaryotic host cells include, for example, Escherichia coli, Bacillus subtilus and Salmonella typhimurum cells.
• the most preferred host cell of the invention is E. coli DH5 ⁇ mcr which is also designated ATCC 98563.
• E. coli ATCC 98563 was deposited with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland, U.S.A. 20852 on October 28, 1997, under the provisions of the Budapest Treaty.
• E. coli ATCC 98563 contains plasmid pBMS2000.
• Expression vectors may be introduced into host cells by various methods known in the art. For example, transfection of host cells with expression vectors can be carried out by the calcium phosphate precipitation method.
• expression vectors into host cells
• electroporation biolistic fusion, liposomal fusion, nuclear injection, viral or phage infection or protoplast fusion
• the host cell may be cultured under conditions permitting expression of the desired protein or polypeptide.
• Host cells containing an expression vector of the invention may be identified by one or more of the following six general approaches: (a) DNA- DNA hybridization; (b) the presence or absence of marker gene functions; (c) assessing the level of transcription as measured by the production of hTOPI mRNA transcripts in the host cells; (d) detection of the gene product immunologically; (e) complementation analysis; and (f) enzyme assay, enzyme assay being the preferred method of identification.
• the presence of a DNA sequence coding for the desired heterologous protein can be detected by DNA-DNA or RNA-DNA hybridization using probes complementary to the DNA sequence.
• the recombinant expression vector host system can be identified and selected based upon the presence or absence of certain marker gene functions (e.g., thymidine kinase activity, resistance to antibiotics, uracil prototrophy, etc.).
• a marker gene can be placed in the same plasmid as the DNA sequence coding for the heterologous gene under the regulation of the same or a different promoter used to regulate heterologous protein production. Expression of the marker gene in response to induction or selection indicates expression of the DNA sequence coding for the heterologous protein.
• the production of heterologous gene mRNA transcripts can be assessed by hybridization assays.
• RNA can be isolated and analyzed by Northern blotting or nuclease protection assay using a probe complementary to the RNA sequence.
• the total nucleic acids of the host cell may be extracted and assayed or hybridization to such probes.
• the expression of the heterologous gene can be assessed immunologically, for example, by Western blotting.
• the expression of the heterologous gene can be assessed by complementation analysis.
• expression of enzyme activity can be inferred by improved growth of cells under growth-limiting conditions.
• expression of heterologous DNA can be measured by assaying for enzyme activity using known methods. For example, the assay described in Y. Pommier, J. Biol. Chem., 265, pages 9418-9422, 1990 may be employed.
• DNA sequences of expression vectors, plasmids or DNA molecules of the present invention may be determined by various methods known in the art. For example, the dideoxy chain termination method as described in Sanger et al., Proc. Natl. Acad. Sci. USA, 74, pages 5463-5467, 1977, or the Maxam-Gilbert method as described in Proc. Natl. Acad. Sci. USA, 74, pages 560-564, 1977 may be employed.
• the present invention is also directed to a method for producing a heterologous protein comprising culturing a host cell of the invention under conditions suitable for expression of the protein.
• Growth of the host cells may be achieved by one of ordinary skill in the art by the use of an appropriate medium.
• Appropriate media for growing host cells include those which provide nutrients necessary for the growth of the cells.
• a typical medium for growth includes necessary carbon sources, nitrogen sources, and trace elements. Inducers may also be added.
• the term "inducer”, as used herein, includes any compound enhancing formation of the desired protein or peptide.
• Carbon sources may include sugars such as glucose, sucrose, lactose, galactose, raffinose, and the like; nitrogen sources include yeast extract, casamino acids, N-Z amine, bacto-tiyptone, and the like.
• a preferred medium comprises 2.4% yeast extract, 1.2% Bacto- tryptone, 0.4% glycerol, 0.72M dipotassium hydrogen phosphate and 0.17M potassium dihydrogen phosphate.
• the pH of the medium is preferably adjusted to about 6.8 to 7.5, more preferably about 7.0.
• the process of the present invention is performed under conditions suitable for expression of the desired peptide.
• the pH of the medium is preferably maintained between about 7.0and 7.5, most preferably between about 7.0 and 7.2, during the growth of host cells.
• a suitable temperature range for the process of the invention is from about 25°C to about 37°C. Pressure is not known to be critical to practice of the invention and for convenience about atmospheric pressure is typically employed.
• the process of the invention is preferably carried out under aerobic conditions.
• Lauria agar Lauria broth supplemented with 1.5% Difco Bacto agar
• T broth 1.2% Difco Bacto tryptone, 2.4% Difco Bacto yeast extract, 0.72M dipotassium hydrogen phosphate, 0.17M potassium dihydrogen phosphate, 0.4% glycerol
• the forward and the reverse PCR primers were synthesized with ABI 391 DNA Synthesizer.
• the forward primer (5OTCAAAGGAGAGTTATCCATGGATATTCGTCC3') (SEQ.ID.NO.:1 ) was designed to introduce a Ncol restriction site at the start codon of the groES gene.
• the reverse primer 5OTCAAAGGAGAGTTATCCATGGATATTCGTCC3'
• the penicillin G amidase gene was amplified from E. coli XG44 genomic DNA by PCR using specific forward primer (CAGAGGATATCATGAAAAAT) (SEQ.ID.NO.:3)which introduces an BspHI restriction site and reverse primer (ACCAGGATCCAACATCACAATACCTG) (SEQ.ID.NO.:4) which introduces a BamH I restriction site.
• the PCR condition consisted of the initial denaturing step at 95°C for 2 minutes followed by 33 cycles of denaturation at 94°C for 1 minute, primer annealing at 55°C for 1 minute, and primer extension at 72°C for 2 minutes. Upon final extension of the cycling steps, a final extension at 72°C for 5 minutes was performed before the reaction was stored at 4°C.
• the cells harboring the recombinant genes were grown overnight in T-broth in the presence of 30 ⁇ g/ml of neomycin sulfate. The next day, the cultures were diluted 1 :10 with T-broth supplemented with appropriate antibiotic. The cells were grown at 30°C in a gyratory incubator for 4hours and/or to the optical density of 2.0 at 600nm at which time appropriate concentration of isopropyl- ⁇ -D-thiogalactopyranoside (IPTG) was added to the culture. The cultures were continued incubated in the presence of IPTG at 30°C for an additional four hours.
• IPTG isopropyl- ⁇ -D-thiogalactopyranoside
• GCA glutaryl cephalosporin amidase
• the clarified supernatant diluted to the appropriate concentration at a volume of 250 ⁇ l was added to an equal volume of prewarmed 20 mg/ml glutaryl-7-ADCA in 0.3M Tris buffer, pH ⁇ .O.
• the reaction mixtures were incubated in a gyratory incubator at 37°C at 330rpm for 30 minutes. The reaction was stopped by the addition of 4 ml of 25mM H 2 SO 4 .
• the reaction mixtures were clarified by centrifugation and the 5 ⁇ l of the sample was injected onto a 5 micron Phenosphere C18 column and the products eluted with 95% 60mM ammonium acetate and 5% acetonitrile.
• the cells expressing the penicillin G amidase were harvested by centrifugation and the cell pellets were resuspended in water. The cells were disrupted by sonication and the cell lysates assayed for penicillin G amidase activity. One ml of the appropriately dilute supernatant was added to one ml of prewarmed 4.5% potassium penicillin G prepared in 200 mM potassium phosphate buffer, pH7.5. The reaction mixtures were incubated in a gyratory incubator at 37°C for 15 minutes. The reactions were stopped by the addition of one ml of 99.0% CH 3 CN and 1.0% HOAC, mixed, and clarified by centrifugation.
• Plasmid pBM11 M5 was digested with Pvu I and Cla I. The 3'- overhang and 5' overhang bases were removed by treatment with T4 polymerase and Klenow fragment, respectively. The 4.4Kb fragment was electroeluted and ligated. The resultant plasmid, named pBM11M5(Cla/Pvu), was subjected to partial Hind III digestion. The linearized fragment was electroeluted, the ⁇ '-overhang filled in with Klenow fragment, and ligated. Restriction analyses were performed to select for the plasmid with the Hindi 11 site eliminated at the correct position.
• the resultant plasmid named pBM11 M5(Cla/Pvu/H3) was digested with Hind III and BamH I.
• the 3.35 Kb fragment was eluted and ligated to the 90 bp tac promoter obtained by the digestion of plasmid pDR540 with Hind III and BamH I.
• the resultant plasmid, named pBM11tac was digested with EcoR I and Hind III, yielding a 2.9 Kb fragment which was ligated to the 1.3 Kb lad Q fragment obtained by the digestion of pUC19lac' Q with EcoRI and Hindlll.
• an Nco I cloning site was introduced immediately after the BamH I of the tac promoter by inserting the adapter 5'-GATCTCCATGGG-3' (SEQ.ID.NO.:5)
• Plasmid pBMS1000 was digested with restriction enzymes, Ncol and Smal.
• the resultant 4.2 Kb fragment was ligated to the groELS gene obtained via PCR amplifications and digested with Ncol and Smal as described above.
• the resultant 6.2Kb plasmid was named pBMS1000GroESL.
• Plasmid pBM11taclac ⁇ N203GCA is a fusion expression plasmid derived from pBMSI 000 containing DNA coding for the first 33 amino acids of the phage ⁇ N protein fused to the amino terminus of the 203 glutaryl ceph amidase gene (203GCA).
• the ⁇ N protein fusion portion may be removed by digestion with Ncol (5' end) and BspH1 (3' end).
• Plasmid pBM11taclac ⁇ N203GCA was digested with BspHI and the 5' overhang filled with Klenow fragment followed by digestion with Ncol.
• the 6.1 kb fragment was electroeluted and ligated to the 403 base pair fragment containing the complete gene sequence for the groES gene and the first 7 amino acids of the groEL gene.
• the GCA protein is a fusion product of the groEL gene. This fragment was generated by the digestion of plasmid pBM1 ItaclacGroESL with restriction enzymes, Nco I and Rsa I followed by electroelution.
• the resultant 6.5 Kb plasmid was named pBMS1999GCA.
• Plasmid pBMS1999 was digested with Mfe I and BspH I.
• the 6.43 kb fragment was purified from the gel by electroelution and ligated to the following synthetic adapter: groES Mfe I stop
• TTTCTA GTAC-5' (seq.lD.NO.:10)
• the resultant plasmid was named pBMS2000GCA. This plasmid has the intact groES gene, the intergene region between groES and groEL gene followed by the sequence coding for the 203 glutaryl ceph amidase gene. Plasmid pET9d (purchased from Novogen) was digested with restriction enzyme, Ncol and BamHI.
• the linearized 4.3 Kb plasmid DNA was purified from the agarose gel by electroelution and ligated to the 2 Kb glutaryl cephalosporin amidase gene obtained by digestion of a plasmid containing the GCA203 gene with BspH I and BamH I.
• the resultant plasmid was named pET9dGCA.
• Plasmid pBMS2000 was dervived from plasmid pBMS2000GCA. Plasmid pBMS2000GCA was digested with restriction enzymes, Mfel and
• CTAGTGGGCTAG SEQ.ID.NO.:12
• the resultant plasmid was named pBMS2000.
• This plasmid contains the intact groES gene, the intergene region between groES and groEL, and BspHI and BamHI restriction sites for gene cloning.
• Plasmid pBMS2001 was derived from plasmid pBMS2000. Plasmid pBMS2000 was digested with restriction enzymes, Mfel and BamHI. The resultant 4.53 Kb fragment was ligated to the following oligomer
• the resultant plasmid was named pBMS2001. This plasmid contains the intact groES gene, the intergene region between groES and GroEL followed by restriction sites Ncol and BamHI for gene cloning.
• Plasmid pBMS2002 was derived from plasmid pBMS2000. Plasmid pBMS2000 was digested with restriction enzymes, Mfel and BamHI. The resultant 4.53 Kb fragment was ligated to the following oligomer 5 Mfel
• AAACATATGCCCG SEQ.ID.NO.:1 ⁇
• the resultant 4.6 Kb plasmid was named pBMS2002.
• This plasmid contains the intact groES gene, the intergene region between groES and ⁇ groEL followed by restriction sites Ndel and BamHI for gene cloning.
• Plasmid pBMS2000.103 is derived from plasmid pBMS2000. It lacks the sequence coding for the groES gene but retains the intergenic 0 sequences between the groES/groEL genes. Plasmid pBMS2000 was digested with restriction enzymes, Hindlll and BspHI. This process removes the tac promoter, the lac operator, the groES gene and the groES/groEL intergenic region. The resultant 4.12 Kb fragment was ligated to a chemically synthesized oligomer which contains the sequences of the tac ⁇ promoter, the lac operator, and the groES/groEL intergenic region. Hindlll AGCTTGTTGACAATTAATCAACGGCTCGTATAATGTGTGGAATTGTGAGC GGATAACAATTTCCGCGCAC (SEQ.ID.NO.:17)
• the resultant 4.2 Kb plasmid is named pBMS2000.103. 0
• TTCTAGTAC (SEQ.ID.NO.:22)
• the resultant 4.2 Kb plasmid is named pBMS2000.7 ⁇ . 0
• Plasmid pBMS1000 was digested with restriction enzymes, Hindlll and Ncol. The 4.1 Kb fragment was isolated, electroeluted and ligated to the following oligomer ⁇
• the resultant 4.2Kb plasmid named pBMS2000H contains the tac 0 promoter followed by intergenic space sequences between the groES and groEL gene. It does not contain the operator sequences thus rendering any heterologous gene cloned in this vector to be expressed constitutively.
• Plasmid pBMS2000H was digested with restriction enzymes, Ncol and BamHI.
• the 4.2Kb was isolated by electroelution and ligated to the 2Kb ⁇ glutaryl cephalosporin amidase gene obtained by digestion of a plasmid containing the GCA203 gene with BspHI and BamHI.
• the resultant 6.2 Kb plasmid was named pBMS2000GCA.
• Plasmids pBMS2000.103GCA and pBMS2000.75GCA were digested with restriction enzymes, BspHI and BamHI.
• the 4.2 Kb fragment was electroeluted and ligated to the 2Kb glutaryl cephalosporin amidase gene obtained by digestion of a plasmid containing the GCA203 gene with BspHI and BamHI.
• the resultant 6.2 Kb plasmid was named pBMS2000.103GCA ⁇ and pBMS2000.7 ⁇ GCA.
• pBMS1000GCA 54 20 pET ⁇ GCAGCA 120 60 pBMS2000GCA 280 150

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Genetics & Genomics (AREA)
• Chemical & Material Sciences (AREA)
• Engineering & Computer Science (AREA)
• Organic Chemistry (AREA)
• Wood Science & Technology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Zoology (AREA)
• General Engineering & Computer Science (AREA)
• Biomedical Technology (AREA)
• Biotechnology (AREA)
• Molecular Biology (AREA)
• General Health & Medical Sciences (AREA)
• Biochemistry (AREA)
• Microbiology (AREA)
• Biophysics (AREA)
• Medicinal Chemistry (AREA)
• Physics & Mathematics (AREA)
• Plant Pathology (AREA)
• Mycology (AREA)
• Gastroenterology & Hepatology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)
• Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Applications Claiming Priority (3)

Publications (3)

Family

ID=22090991

Family Applications (1)

Country Status (9)

Families Citing this family (14)

Citations (1)

Family Cites Families (11)

• 1998
  • 1998-12-04 US US09/205,428 patent/US6068991A/en not_active Expired - Lifetime
  • 1998-12-11 AU AU17233/99A patent/AU743599B2/en not_active Expired
  • 1998-12-11 JP JP2000539121A patent/JP4446600B2/ja not_active Expired - Lifetime
  • 1998-12-11 DE DE69838681T patent/DE69838681T2/de not_active Expired - Lifetime
  • 1998-12-11 AT AT98962067T patent/ATE377648T1/de active
  • 1998-12-11 EP EP98962067A patent/EP1040184B1/fr not_active Expired - Lifetime
  • 1998-12-11 ES ES98962067T patent/ES2296350T3/es not_active Expired - Lifetime
  • 1998-12-11 CA CA2314396A patent/CA2314396C/fr not_active Expired - Lifetime
  • 1998-12-11 WO PCT/US1998/026343 patent/WO1999031220A1/fr active IP Right Grant

Patent Citations (1)

Non-Patent Citations (3)

Also Published As

Similar Documents

Legal Events