Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D213/00—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members
  • C07D213/02—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members
  • C07D213/04—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom
  • C07D213/24—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom with substituted hydrocarbon radicals attached to ring carbon atoms
  • C07D213/36—Radicals substituted by singly-bound nitrogen atoms
  • C07D213/40—Acylated substituent nitrogen atom
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D207/00—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom
  • C07D207/02—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
  • C07D207/04—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
  • C07D207/10—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
  • C07D207/16—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D217/00—Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems
  • C07D217/22—Heterocyclic compounds containing isoquinoline or hydrogenated isoquinoline ring systems with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to carbon atoms of the nitrogen-containing ring
  • C07D217/26—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D277/00—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
  • C07D277/02—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings
  • C07D277/20—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
  • C07D277/22—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to ring carbon atoms
  • C07D277/28—Radicals substituted by nitrogen atoms
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
  • C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
  • C07D401/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a chain containing hetero atoms as chain links
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
  • C07K5/04—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
  • C07K5/06—Dipeptides
  • C07K5/06008—Dipeptides with the first amino acid being neutral
  • C07K5/06017—Dipeptides with the first amino acid being neutral and aliphatic
  • C07K5/06026—Dipeptides with the first amino acid being neutral and aliphatic the side chain containing 0 or 1 carbon atom, i.e. Gly or Ala
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
  • C07K5/04—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
  • C07K5/06—Dipeptides
  • C07K5/06008—Dipeptides with the first amino acid being neutral
  • C07K5/06017—Dipeptides with the first amino acid being neutral and aliphatic
  • C07K5/06034—Dipeptides with the first amino acid being neutral and aliphatic the side chain containing 2 to 4 carbon atoms
  • C07K5/06043—Leu-amino acid
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
  • C07K5/04—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
  • C07K5/06—Dipeptides
  • C07K5/06008—Dipeptides with the first amino acid being neutral
  • C07K5/06017—Dipeptides with the first amino acid being neutral and aliphatic
  • C07K5/06034—Dipeptides with the first amino acid being neutral and aliphatic the side chain containing 2 to 4 carbon atoms
  • C07K5/06052—Val-amino acid
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
  • C07K5/04—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
  • C07K5/06—Dipeptides
  • C07K5/06008—Dipeptides with the first amino acid being neutral
  • C07K5/06017—Dipeptides with the first amino acid being neutral and aliphatic
  • C07K5/0606—Dipeptides with the first amino acid being neutral and aliphatic the side chain containing heteroatoms not provided for by C07K5/06086 - C07K5/06139, e.g. Ser, Met, Cys, Thr
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
  • C07K5/04—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
  • C07K5/06—Dipeptides
  • C07K5/06008—Dipeptides with the first amino acid being neutral
  • C07K5/06017—Dipeptides with the first amino acid being neutral and aliphatic
  • C07K5/0606—Dipeptides with the first amino acid being neutral and aliphatic the side chain containing heteroatoms not provided for by C07K5/06086 - C07K5/06139, e.g. Ser, Met, Cys, Thr
  • C07K5/06069—Ser-amino acid
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
  • C07K5/04—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
  • C07K5/06—Dipeptides
  • C07K5/06008—Dipeptides with the first amino acid being neutral
  • C07K5/06078—Dipeptides with the first amino acid being neutral and aromatic or cycloaliphatic
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides

Definitions

• the invention relates to HIV and FIV protease inhibitors. More particularly, the invention is directed to HIV and FIV protease inhibitors characterized by core structures having a small P3 residue. The invention is also directed to methods for making such compounds with clinically useful activity and which are potentially resistive against loss of inhibitory activity due to development of resistant strains of HIV.
• ggtg grQun The aspartyl protease (PR) of human immunodeficiency virus (HIV) has been the subject of extensive research for the development of therapeutically useful inhibitors to control the progression of human acquired immunodeficiency syndrome (AIDS) .
• PR human immunodeficiency virus
• AIDS human acquired immunodeficiency syndrome
• Four competitive inhibitors of this enzyme have been approved and several others are in clinical trials (Babine et al . Chem. Rev. 1997, 97, 1359-1472; De Lucca et al . Drug Discovery Today 1997, 2, 6-18; Vacca et al . Drug Discovery Today 1997, 2, 261-272; Huff et al . J. Med. Chem. 1991, 34, 2305; lodawer et al. Ann. Rev. Biochem. 1993, 62, 543-585).
• many drug-resistant variants of HIV have been identified, including 45 distinct drug-resistant variants found in the past 3 years .
• the drug-resistant mutants are generated through incomplete suppression of the virus by inhibitors clinically and usually contain multiple substitutions in their proteases. Moreover, these mutant enzymes often exhibit cross-resistance to many structurally distinct protease inhibitors. Therefore, development of new broad-based protease inhibitors efficacious against a wide spectrum of HIV variants may be necessary in order to slow down the development of drug resistance (Schinazi et al . Int. Antiviral News 1997, 5, 129-142; Wilson et al . J. Biochim. Biophy. Acta 1997, 1339, 113-125; Erickson et al . Annu. Rev. Pharmacol. Toxicol. 1996, 36, 545-571; Gulnik et al .
• FIV is a retrovirus which causes an immunodeficiency syndrome in cats comparable to AIDS in humans (Talbott et al . Proc. Natl. Acad. Sci. USA 1989, 86, 5743-5747; Pedersen et al . Science 1987, 235, 790-793).
• Both HIV and FIV PRs are C2-symmetric homodimeric enzymes, and they have almost superimposable active-site structures that facilitate catalysis by an identical mechanism (Slee et al . J. Am. Chem. Soc. 1995, 117, 11867-11878) . Similar to HIV PR, FIV PR also processes both structural proteins of gag and the enzymes encoded by pol during FIV replication (Kramer et al .
• Furhtermore what is needed is a class of HIV and FIV protease inhibitors having enhanced possibilities of variability at the binding region for improving binding between the enzyme and its inhibitor.
• One aspect of the invention is directed to a protease inhibitor represented by the following structure:
• R x may be any of the following radicals: hydrogen, carbobenzyloxy- , carbobenzyloxy-valine- , carbobenzyloxy-glycine-valine- , carbobenzyloxy-alanine-valine- , carbobenzyloxy-leucine-valine- , carbobenzyloxy- phenylalanine-valine- , carbobenzyloxy-serine-valine- , carbobenzyloxy-alanine-asparagine- , carbobenzyloxy- threonine- valine- and carbobenzyloxy-valine-valine- .
• R 2 may be any of the following radicals: -CH 2 -Phenyl, and -CH 2 -CH (CH 3 ) 2 .
• R 3 may be any of the following radicals: hydrogen, oxygen and hydroxyl;
• R 4 is selected from the group consisting of hydrogen, oxygen and hydroxyl, wherein R 3 and R 4 are not both hydroxyl and wherein R 3 and R 4 are either a single combined oxygen forming a carbonyl group.
• R 5 may be any of the following radicals: hydrogen, and oxygen;
• R 6 is selected from the group consisting of hydrogen, and oxygen, wherein R 5 and R 6 are either a single combined oxygen forming a carbonyl group or both seperately hydrogen.
• R 7 is a radical represented by the formula:
• R 8 is a radical selected from the group consisting of - (H) 2 , and -H(t-Butyl) .
• Another aspect of the invention is directed to a protease inhibitor represented by the following structure:
• R-* may be any of the following radicals: hydrogen, carbobenzyloxy-, carbobenzyloxy-valine-, carbobenzyloxy-glycine-valine- , carbobenzyloxy-alanine-valine- , carbobenzyloxy-leucine-valine- , carbobenzyloxy- phenylalanine-valine- , carbobenzyloxy-serine-valine- , carbobenzyloxy-threonine-valine- , carbobenzyloxy- lanine- asparagine- and carbobenzyloxy-valine-valine- .
• R 2 may be any of the following radicals:
• R 3 is either hydrogen or -OH.
• Another aspect of the invention is directed to a protease inhibitor represented by the following structure:
• R ⁇ may be any of the following radicals: hydrogen, carbobenzyloxy-, carbobenzyloxy-valine-, carbobenzyloxy-glycine-valine- , carbobenzyloxy-alanine-valine- , carbobenzyloxy-leucine-valine- , carbobenzyloxy- phenylalanine-valine- , carbobenzyloxy- serine-valine- , carbobenzyloxy-threonine-valine- , carbobenzyloxy-alanine- asparagine- and carbobenzyloxy-valine -valine- .
• R 2 is either - (H) 2 or -H(t-Butyl).
• Another aspect of the invention is directed to a protease inhibitor represented by the following structure:
• R x may be any of the following radicals: hydrogen, carbobenzyloxy-, carbobenzyloxy-valine-, carbobenzyloxy-glycine-valine- , carbobenzyloxy-alanine-valine- , carbobenzyloxy-leucine-valine- , carbobenzyloxy- phenylalanine-valine- , carbobenzyloxy-serine-valine- , carbobenzyloxy-threonine-valine- , carbobenzyloxy-valine- valine- and carbobenzyloxy-alanine-asparagine- .
• protease inhibitor represented by the following structure:
• R x may be any of the following radicals: hydrogen, carbobenzyloxy-, carbobenzyloxy-valine-, carbobenzyloxy-glycine-valine- , carbobenzyloxy-alanine-valine- , carbobenzyloxy-leucine-valine-, carbobenzyloxy- phenylalanine-valine- , carbobenzyloxy-serine-valine- , carbobenzyloxy-threonine-valine- , carbobenzyloxy-valine- valine- and carbobenzyloxy-alanine-asparagine- .
• FIG 1 illustrates models of HIV protease (top) and FIV protease (middle) complexed with lb.
• the models show the small S3 site in FIV protease and the close proximity of the P3 (CH3) and PI (PhCH2) residues, a structural feature found in many drug-resistant HIV proteases.
• Figure 2 shows the amino acid side chains in the S subsites interacting with the inhibitors are indicated.
• Figure 3 illustrates the dissymmetric inhibitors with small P3 residues.
• Compounds 2b-6b and 7 contain a methyl group as P3 residue .
• Figure 4 shows the proposed mechanism of inhibition by 5b .
• a water molecule is added, with assistance of the enzyme, to the ⁇ -keto group to form a g-em-diol.
• Figure 5 illustrates models of HIV protease (top) and FIV protease (middle) complexed with R031-8959, and FIV PR complexed with the modified inhibitor 7a (bottom) .
• the P3 group of R031-8959 is too big to fit the S3 subsite of FIV PR, whereas 7a with methyl group as P3 residue shows a good fit.
• Figure 6 shows the synthesis of intermediate compound 13 with the following conditions: (a) 2 , 2-dimethoxypropane, p-TsOH (80%); (b) Pd/C, H2, MeOH (99%); (c) HBTU, Cbz-Val, Et3N, CH3CN (89%) ; (d) HBTU, Cbz-amino acids, Et3N, CH3CN; (e) p-TsOH, MeOH.
• Figure 7 shows the synthesis of compound 2b with the following conditions: (a) NMM, THF, i-BuOCOCl. (b) CH2N2, Et 2 0. (c) HCl (85%, 3 steps) (d) NaBH 4 , EtOH, ( 90% d.e, 81%) (e) NaOMe , MeOH (96%) . (f) MeOH, Et 3 N (90%) (g) Pd/C, H 2 , EtOAc . (h) Cbz-Ala-Val-OH, HBTU, Et 3 N, CH 3 CN.(49%, 2 steps).
• Figure 8 shows the synthesis of the ⁇ -Ketoamides 5a and 5b with the following conditions: (a) BH 3/ THF. (b) Swern Oxidation (90%) . (c) NaHS0 3 , H 2 0. (d) KCN. (e) HCl ( 6N in dioxane) , (f ) Cbz-Cl, NaOH, H 2 0 (52%, 4 steps), (g) HBTU, Et 3 N, CH 3 CN (73%). (h) Pd/C, H 2 , EtOAc. (i) Cbz-Ala-Val-OH, HBTU, Et 3 N, CH 3 CN (65%, 2 steps), (j) Dess-Martin (63%).
• Figure 9 illustrates the synthesis of the modified existing drug 6b with the following conditions: (a) PhB(OH) 2 , PhMe, reflux (b) THF, rt, (78%, 2 steps); (c) Cbz-Ala-Val-OH, HBTU, Et 3 N, CH 3 CN (73%) ; and drugs 7a, b with the following onditions: (a) MeOH, Et 3 N, (80%) . (b) TFA, CH 2 C1 2 . (c) HBTU, Et 3 N, CH 3 CN, Cbz-Ala-Val-OH (76%) or Cbz-Ala-Asn-OH (78%) .
• Figure 10 tabulates the inhibition of FIV and HIV PRs by small P3 residue containing inhibitors and their parent compounds wherein the superscript are each described as follows: Ki and IC50 values were determined in duplicate using fluorescent substrate (For procedures see Lee et al . Proc. Natl. Acad. Sci. USA 1998, 95, 939-944; for HIV PR substrate, see Toth, M. V. ; Marshall, G. R. Int . J. Peptide Res . 1990, 36, 544); b) Data obtained at pH 5.25 at 370 C in 0.
• Ki values were determined in duplicate, b) Data obtained at pH 5.25 at 370C in 0. IM NaH 2 P0 4 , 0.1 M sodium citrate, 0.2 M NaCl , 0.1 mM DTT, 5% glycerol, and 5% DMSO in volume; c) data obtained at pH 5.25 at 370C in 0. IM MES, 5% glycerol, and 5% DMSO in volume; d) From Slee et al . J. Am. Chem. Soc. 1995, 117, 11867-11878 ;nd, not determined.
• Figure 12 illustrates the synthsis of C symmetric inhibitors 1000-1400.
• Figure 13 illustrates examples of HIV PR inhibitors testes as inhibitors of FIV PR.
• Figure 14 illustrates TL-3-139 Timecourse PPR-FIV Acute Infection.
• Figure 15 illustrates SIV p27 ELISA.
• Figure 16 shows Days post WEAU-1.6 Infection (25 TCID 50).
• HIV PR human immunodeficiency virus protease
• FIV PR feline immunodeficiency virus protease
• Candidate drugs which are successfully screened in vi tro may then be tested in cats as model systems on which to test HIV PR inhibitors in vivo .
• the invention is directed to a new type of inhibitor with a small P3 residue.
• These inhibitors are effective against HIV and its drug-resistant mutants, as well as FIV. Modification of existing HIV protease inhibitors by reducing the size of the P3 residue has the same effect.
• This finding provides a new strategy for the development of HIV protease inhibitors effective against the wild type and drug-resistant mutants and further supports that FIV protease is a useful model for drug-resistant HIV proteases, which often are developed through reduction in size of the binding region for P3 group or the combined P3 and Pi groups .
• FIV PR exhibited a strong preference for small hydrophobic groups at the S3 and S3 ' subsites in contrast to the high flexibility for the P3 and P3 ' residues binding to HIV PR (ibid, 939-944) .
• Kinetic studies have also indicated that the binding preference observed in drug-resistant mutant HIV PRs is very similar to that found in FIV PR (ibid, 939-944)
• the most potent FIV PR inhibitor lb ( Figure 3) strongly inhibits FIV, HIV, and SIV infections in tissue culture with virtually the same degree of effectiveness.
• the x-ray structure of FIV PR complexed with inhibitor lb has been determined and shown that the PI and P3 side chains are positioned very closely, consistent with previous structural studies for HIV and FIV PRs that SI and S3 subsites are neighboring hydrophobic pockets to accommodate the corresponding PI and P3 side chains (The x-ray structure of lb complexed with HIV, FIV (3X), FIV (V59I), and FIV (Q99V) PRs have been determined and will be published separately: Li et al . Biochemistry, unpublished as of filing) .
• Models of lb bound to HIV and FIV PR (Figure 1) indicate that the SI and S3 subsites in HIV PR constitute a much larger hydrophobic pocket than the corresponding subsites found in FIV PR. Because of this smaller hydrophobic size, FIV PR can only accommodate inhibitors with a smaller size for PI and P3 residues together, and several drug-resistant HIV PRs are indeed found to have a smaller domain composed of S3 and SI subsites.
• the S3 and S3' subsites of FIV PR are sterically more congested than those in HIV PR, and these three different residues may define the S3 and S3 ' subsite specificities of the enzymes.
• the results of these studies point to a new direction for development of inhibitors effective against both HIV PR and its drug-resistant variants as shown in Figures 1 and 2.
• Example 2 Dissymmetric Inhibitors with Small P3 Groups The S3 and S3 ' subsite specificities of FIV PR and drug-resistant HIV PRs with mutations affecting the S3 subsite were investigated further to determine if there is a correlation between them.
• the new inhibitors of HIV PR were synthesized with Ala at P3 , Val or Asn at P2 , and various Phe-Pro isosteric cores for the Pl-Pl ' residues ( Figure 3) .
• the inhibitory activities of each compound against FIV, HIV, and drug-resistant mutant HIV PRs were determined as described previously (Lee et al . Proc. Natl. Acad. Sci. USA 1998, 95, 939-944) and the results are summarized in Figure 10.
• the modified inhibitors 2b-5b which contain a methyl group as P3 residue, displayed 120- to 1000- fold improved inhibitory activities against HIV PR and at least three orders of magnitude higher potency for FIV PR compared to their parent compounds.
• 5b was found to be a slow binding inhibitor with Ki of 2.5 and 46 nM against HIV and FIV PR, respectively.
• Ki 2.5 and 46 nM against HIV and FIV PR, respectively.
• This level of potency against FIV PR by the inhibitor with a molecular weight of only 649 was truly remarkable, considering the smallest efficient substrate for the enzyme is an eight-residue peptide,
• the increased inhibitory activity of 5b may occur via enzyme-assisted hydration of the ketone moiety within the active site to form a gem-diol as transition-state mimic, similar to the case of a related ⁇ -keto amide inhibitor observed previously by x-ray structure and 13 C NMR analyses ( Figure 4; Slee et al . , ibid) .
• the relative inhibitory activities of inhibitors 2b-5b against FIV PR are similar to the relative activities against HIV PR.
• 5b is a superior inhibitor of both enzymes
• the hydroxyketone 4b is 57- and 44- fold more effective than its diastereomer 3b against HIV and FIV PR, respectively.
• the relative effectiveness of the Pl-Pl' core structures in 2b-5b against HIV PR is also consistent with the binding pattern of their parent compounds 2a-5a.
• extension of the backbone of an inhibitor to contain an appropriate P3 moiety is essential to exhibit high potency against FIV PR, which is also consistent with our previous results with C2-symmetric inhibitor lb (Lee et al . , ibid) .
• compound 7b showed 7.5- and 51 -fold less potent than 7a against HIV and FIV PR, respectively. Changing the P2 Val residue of 7a to Asn increased hydrophilicity of the inhibitor, which could be a major cause of lower activity found in 7b for both enzymes. In fact, compound 7b was more soluble in water than 7a and thus would require higher desolvation energy to bind the hydrophobic active sites of enzymes.
• modified inhibitors with dual efficacy against FIV and HIV PR were also tested against drug-resistant mutant HIV PRs G48V and V82F. These mutant enzymes were selected since Gly 48 and Val 82 are within the S3 and S3 ' subsites and have been identified as some of the most frequently mutated residues associated with development of drug resistance. Against these mutant enzymes, all modified inhibitors retained most of their original potency, and their relative inhibitory activity was also directly proportional to the efficacy against wild-type HIV PR.
• modification of the FDA approved drugs ABT-538 and R031-8959 containing a bulky P3 group to the ones with methyl group at P3 i.e.
• V82F and G48V mutants were known to be less efficient enzymes compared to the wild-type HIV PR. Therefore, inhibitory activities of compounds tested against these mutant enzymes are expected to be lower compared to wild-type HIV PR.
• Compound lb was also active in cell culture (Bacheler et al . J. Antiviral Chem. Chemother . 1994, 5, 111) .
• HIV PR exhibits a high degree of flexibility in binding at the S3 and S3 ' subsites (Lee et al . , ibid) .
• the results from the inhibition studies of the diols 8-10 against HIV PR showed very different patterns compared to their analogs lb, 9b-10b.
• the Ki values of compounds 8 and 10 were 4.3- and 2.0-fold higher than lb and 10b, respectively. This indicates that Phe at PI and PI' is better than Leu for binding to HIV PR.
• compound 9 is a more effective inhibitor than 9b and also showed 7.5- and 6.3- fold higher potency against HIV PR compared to 8 and 10,, respectively. This significant improvement was not observed from lb, 9b-10b.
• compounds containing a hydroxy group at P3 and P3 ' side chains (12 and 13) were also effective inhibitors of both HIV and FIV PR.
• compound 12 displayed the highest potency with K. values of 0.58 nM and 32 nM against HIV and FIV PRs, respectively. It is noteworthy that compound 12 is more hydrophilic than lb by two additional hydroxy groups and would require more desolvation energy in order to bind to the hydrophobic active sites of enzymes. However, compound 12 exhibited a 3 -fold higher potency against HIV PR and similar inhibition against FIV PR, compared to lb.
• the hydroxyethyla ine inhibitor 2b was prepared by coupling the proline derivative 24 to the epoxide 25 (Slee et al. J. Am. Chem. Soc. 1995, 117, 11867-11878; Hung et al . J. Org. Chem. 1991, 56, 3849-3855) via reflux in methanol, using triethylamine as shown in Figure 7.
• the synthesis of the core isostere 5a has been modified from the method previously employed by our group.
• the ⁇ -hydroxy acid 26, prepared from known procedures (Munoz et al . Bioorg. Med. Chem. 1994, 2, 1085-1090) was coupled to the proline derivative 24 to give the ⁇ -hydroxy amides 3a and 3b.
• Example 6 Analysis of the S3 and S3' Subsite Specificities of FIV Protease : Development of a Broad-based Protease Inhibitor Efficacious A ⁇ ainst FIV, SIV, and HIV in vi tro and ex vivo The S3 and S3 ' subsite binding specificities of HIV and
• FIV PRs have been explored using C2-symmetric competitive inhibitors.
• the inhibitors evaluated contained ⁇ IS, 2R, 3R, 4S) -1,4-diamino-l, 4-dibenzyl-2 , 3-diol as PI and Pi' units, Val as P2 and P2 ' residues, and a variety of amino acids at the P3 and P3 ' positions. All inhibitors showed very high potency against HIV PR in vi tro, and their Ji ' s ranged between 1.1 and 2.6 nM. In contrast to the low restriction of P3 and P3 ' residues observed in HIV PR, FIV PR exhibited strong preference for small hydrophobic groups at the S3 and S3' subsites. Within this series, the most effective inhibitor against FIV PR contained Ala at P3 and P3 ' . Its Ki of 41 nM was 415- and
• At least six mutated residues in HIV PR which cause drug resistance are also found in the structurally aligned native residues of FIV PR.
• Kinetic studies also showed that various potent HIV PR inhibitors containing the P3 to P3 ' residues Slee et all, JACS 117, 11867-11878, including the FDA approved drug Ro 31-8959 (ibid) , are less efficient inhibitors of FIV PR by a factor of 100 or more.
• FIV PR may serve as a model for drug resistant mutant HIV PRs and may contribute to the understanding of HIV resistance to protease inhibitors.
• the inhibitory activity of the reference compound 1000 was decreased by almost 1.7xl0 fold compared to its Ki for HIV PR.
• This striking activity loss observed for 1000 was recovered by extending the backbone of the inhibitor using Gly as P3 and P3 ' residues, with the Ki of 1100 being 110-fold lower than 1000.
• This preference of the extended inhibitor backbone found in FIV PR is also supported by the observation that HIV PR will cleave a six residue peptide substrate, Ac-Gln-Ala-Tyr ⁇ Pro-Ile-Gln, whereas the smallest FIV PR substrate is an eight residue peptide, Ac-Pro- Gln-Ala-Tyr ⁇ Pro-Ile-Gln-Thr* The best residue for S3 and S3 ⁇ binding was Ala.
• inhibitor 1200 ⁇ Ki 41 nM
• the inhibitory activity of 1200 against FIV PR was reduced by increasing the size of the side chain of the P3 and P3 ' residues, with the Ki of 1300 4-fold higher than 1200.
• the diol 1400 showed 45- and 170-fold lower potency compared to 1100 and 1200, respectively, and this result suggests that the benzyl side chain of P3 and P3 ' residues may cause unfavorable interaction with FIV PR or the neighboring Pi and PI' side chains.
• the S3 and S3 ' subsites of FIV PR is sterically more congested than those in HIV PR, and these three different residues may define the S3 and S3' subsite specificities of the enzymes.
• the Gly 48 and Val 82 of HIV PR have been identified as frequently mutated residues to develop drug resistance*
• the potency of the FDA approved drugs containing bulky P3 moieties, Ro 31-8959 and ABT-538, against G48V mutant was decreased by 27 and 17 fold, respectively.
• the V82F mutant becomes 15, 7, and 90 fold less sensitive toward the licensed drugs AG-1343, MK-639, and ABT-538, respectively.
• the assays were performed in FIV-infected feline T-cells which were cultured in the presence of compound 1200 at different concentrations over the course of 1 month.
• Each data in Figure 14 represents the amount of pelletable FIV reverse transcriptase in the culture supernatant.
• Compound 1200 was able to markedly inhibit FIV replication at 0.5 ⁇ g/ml (0.55 mM) and found to be most effective at 1.0 ⁇ g/ml (1.1 ⁇ M) . Furthermore, this inhibitor was not toxic to feline T-cells.
• the drug-treated cultures were split and replated with and without compound 1200. No virus was detected in the absence or presence of drug after two weeks in culture (Not shown) . No sign of resistance development against the drug has been observed after eight weeks of continuous culture.
• the cells cultured with 1 ⁇ g/ml (1.1 ⁇ M) or 5 ⁇ g/ml (5.5 ⁇ M) of inhibitor 1200 remained 100% viable after 1 month, identical to results obtained in the absence of virus infection.
• supernatants were removed and added to 1x105 uninfected MT-2 cells after a 1:5 dilution with fresh CM. After 3 weeks the MT-2 cells remained uninfected, demonstrating the absence of free virus in cultures of infected MT-2 cells treated with compound 1200.
• FIV PR exhibits a specific preference for amino acids containing small side chains at the P3 and P3 ' positions, especially for Ala.
• extension of inhibitor backbone can increase the potency of inhibitors in FIV PR.
• Our in vi tro inhibition studies of mutant FIV PR also showed a direct relationship between the inhibition of FIV PR and HIV PR. This observation suggests that potent inhibitors of FIV PR, containing P3 to P3 ' residues, become even more efficient against HIV PR.
• the most potent inhibitor 1200 has also shown strong ability to control lentiviral infections in tissue culture. In fact, this is the first compound which inhibits replication of FIV, HIV and SIV with virtually the same degree of effectiveness. This remarkable versatility of compound 1200 also suggests the strong possibility of sustaining its potency against mutant HIV PRs. Experiments are underway to test this hypothesis. Finally, while the current results represent only an initial step toward developing potential therapeutic agents against HIV PR which will be effective against native protease as well as mutant enzymes, using the FIV system for advancing HIV therapies is clearly an effective and relevant strategy where target drugs have dual efficacy against FIV and HIV. As a natural animal system, FIV offers the ability to perform in vivo tests of efficacy and assessment of drug resistance that is not readily feasible in primate systems. In addition, it is hoped that the broad-based nature of inhibitors arising from these studies will afford a reduced level of resistance development .
• x as shown in the figure 3 is selected from the group consisting of hydrogen, carbobenzyloxy-, carbobenzyloxy-valine-, carbobenzyloxy-glycine-valine- , carbobenzyloxy-alanine-valine- , carbobenzyloxy-leucine-valine- , carbobenzyloxy-phenylalanine- valine-, carbobenzyloxy-serine-valine-, carbobenzyloxy-alanine- asparagine-, carbobenzyloxy-threonine-valine- and carbobenzyloxy-valine-valine- all linked to the inhibitors using the procedures as described below and wherein all groups obtained from sources disclosed above or synthesized using procedures well known in the art or stated herein.
• Models of the protease inhibitor, lb, complexed with HIV-1 protease and FIV protease were built using the Brookhaven Protein Data Bank entries IHVIll and 1FIV6 as starting points.
• the structure of A77003 is quite similar to that of lb.
• the stereochemistry of one of the ecorei hydroxyls had to be inverted, and the pyrimidine groups were replaced by the Cbz groups.
• the model of lb bound to HIV-1 protease was built first, using Insightll 97.0is Biopolymerl ⁇ and Discover modules, and the AMBER force field. Molecular mechanics minimization was performed using the conjugate gradients minimizer until the minimization converged, i.e. the derivative of the energy was less than 0.001. Distance constraints were used in the early stages of the modeling to ensure that the hydrogen bonds were preserved between the inhibitor, water and protease. Initially, only the inhibitor model, five active-site water molecules, and the residues of the active site that were in contact with the inhibitor were allowed to move.
• IC 50 values for HIV protease a backbone engineered HIV-1 protease, prepared by total chemical synthesis (Kent et . al . Science 1992, 256, 221) 450 nM final concentration was added to a solution (152 ⁇ L final volume) containing inhibitor, 28 ⁇ M fluorogenic peptide substrate (sequence Abz-Thr-Ile-Nle-Phe- (p-N0 2 ) -Gln-Arg-NH 2 (Toth et. al . ,
• dimethylsuIfoxide in assay buffer lOOmM MES buffer containing 0.5 mg/mL BSA (Bovine Serum Album, fatty acid, nuclease and protease free - to stabilize enzyme) at pH 5.5.
• BSA Bovine Serum Album, fatty acid, nuclease and protease free - to stabilize enzyme
• the solution was mixed and incubated over 5 minutes during which time the rate of substrate cleavage was monitored by continuously recording the change in fluorescence of the assay solution. An excitation filter of 325 nm, and an emission filter of 420 nm were used. This data was converted into ⁇ M substrate cleaved per minute, using a predetermined standard calibration curve of change in fluorescence against concentration of substrate cleaved.
• Ki for HIV protease was performed similarly with the following modifications.
• the substrate concentrations used were 57, 43, 28 and 14 ⁇ M. All other concentrations were as above.
• the curve fit for the data was determined and the subsequent _?•£ ⁇ _ derived using a computer program based on the equation of Morrison et . al . BioChim. Biophys. ACTA 1969,185, 269, for tight binding inhibitors.
• i- and IC 50 for FIV protease 0.125 ⁇ g of the enzyme was added to a solution (100 ⁇ L final volume) containing inhibitor, 560 ⁇ M peptide substrate (sequence Gly- Lys-Glu-Glu-Gly-Pro-Pro-Gln-Ala-Tyr ⁇ Pro-Ile-Gln-Thr-Val-Asn- Gly) and 2% dimethyl sulfoxide in a 1:3 mixture of assay buffer (as above) and 4M NaCl aq. solution.
• the data used was generated similarly to that for K with the following modifications .
• the substrate concentrations used were 560, 448, 336, 224, 111 and 56 ⁇ M, in the absence of inhibitor.
• FIV protease A 503 base pair Eco Rl-Bam HI fragment containing the coding sequence of FIV protease was cloned from FIV-34TF10 (Talbott et . al . Proc. Natl. Acad. Sci. USA 86 1989, 5743) into the pT7-7 vector (Tabor et . al . Proc. Natl. Acad. Sci USA 82 1985, 1074). The 5' end of the insert was modified by the addition of an Ndel adaptor, which provided the proper reading frame with initiation of translation from the methionine encoded in the latter site.
• the cells were allowed to reach mid-log phase, then the temperature was reduced to 24 'C and IPTG (isopropyl ⁇ -thiogalactopyranoside) was added to a final concentration of 1 mM. The fermentation was allowed to proceed for 16 hours, at which time the cells were harvested by centrifugation and frozen at -70 °C in 100 g aliquots for future use .
• IPTG isopropyl ⁇ -thiogalactopyranoside
• Cells (100 g) were lysed by addition of 600 mL, 50 mM Tris-HCl, pH 8, 5 mM EDTA and 2 mM 2-mercaptoethanol to the frozen pellet.
• the cells lysed upon thawing and the viscous mixture was homogenized at 4 'C for 2 min in a Waring blender.
• the sample was centrifuged at 8,000 x g for 20 min and the pellet discarded.
• the sample was diluted to 1 liter, then subjected to tangential flow against a 300 K cut-off membrane (Filtron) and the PR was washed through the membrane using five liters of the same buffer.
• Fintron 300 K cut-off membrane
• the retentate was discarded and the flow-through supernatant concentrated by tangential flow against a 10 K cut-off membrane.
• the retentate was passed over a DE52 anion exchange column (5 x 20 cm) equilibrated in the same buffer.
• the flow-through from this column was passed over an S-Sepharose Fast Flow matrix ( 2.5 x 20 cm column, Pharmacia) , again equilibrated at pH 8 in the same buffer.
• the flow-through from S-Sepharose was made IM with respect to ammonium sulfate and applied to a phenyl sepharose column (Pharmacia, 1.5 x 10 cm), washed with lysis buffer containing IM ammonium sulfate, then eluted with a 100-0% linear ammonium sulfate gradient. Peak fractions containing PR were pooled, concentrated using Centripreps (Amicon) , and dialyzed against 10 mM Tris-HCl, pH 8 , 5 mM EDTA, 2 mM 2-mercaptoethanol .
• the sample was made 10 mM with respect to MOPS, adjusted to pH 5.5 with HCl, then applied to a Resource S column (Pharmacia) equilibrated in 10 mM Tris-MOPS, pH 5.5 , 5 mM EDTA and 2 mM 2- mercaptoethanol .
• PR was eluted using a linear 0-300 mM NaCl gradient in the same buffer. Peak fractions were pooled, concentrated, and stored as aliquots at -20 'C for further studies . The integrity of the isolated FIV PR was confirmed by ion spray mass spectrometry.
• Coupling constants are reported in hertz and chemical shifts are reported in parts per million (d) relative to tetramethylsilane (TMS, 0 ppm), MeOH (3.30 ppm for ⁇ and 49.0 ppm for 13 C) or CHC1 3 (7.24 ppm for 1 H and 77.0 ppm for 13 C) as internal reference.
• Infrared spectra were recorded on a Perkin-Elmer 1600 series FT-IR spectrophotometer. Absorptions are reported in wavenumbers (cm "1 ) .
• Peptide fragments described herein were synthesized using traditional peptide coupling methodologies [EDC (l-(3- dimethylaminopropyl ) - 3 -ethylcarbodiimide HCl), HOBt (1-hydroxybenzotriazole) and DIEA (diisopropylethylamine) ] .
• Esters were hydrolyzed either by base (LiOH for methyl esters) or acid (TFA for t -butyl esters) .
• step j the substrate 3a, 3b, 4a, or 4b (21 mg, 0.044 mmol) was dissolved in dry CH 2 C1 2 (2 mL) , and Dess -Martin periodinane (26 mg, 0.088 mmol) added.
• the reaction mixture was stirred at ambient temperature for 24 hours, then diluted with ethyl acetate (10 mL) and quenched by addition of saturated sodium bicarbonate (aq , (5 mL) and sodium thiosulfate.
• the aqueous phase was extracted with ethyl acetate (3 x 20 mL) .
• reaction mixture was stirred for 15 min at 20 °C under Ar then quenched by addition of brine (20 ml) and extracted with EtOAc (4 x 20 ml) .
• the organic layer was washed sequentially with IM HCl (5 ml), sat. aq. NaHC03 (5 ml), and sat. aq. NaCl (5 ml), dried over MgS04 , filtered and concentrated in vacuo.
• Compound 25 was formed from the multi step process as shown in Figure 7 (with all intermediates purified by silica gel chromatography).
• Step (a) Free acid 1.0 equiv. (Aldrich), NMM 1.1 equiv. (Aldrich), .10 M THF, 1.1 equiv. i-BuOCOCl were mixed together for 1 hour at 0 0C until complete by TLC monitoring, the reaction was next quenched via standard workup as described above and carried on to the next step after column chromatography.
• Step (b) 1.0 equiv. of intermediate compound from step a was suspended in solution with 1.1 equiv.
• Step (d) 1.0 equiv. of intermediate compound from step c was suspended in solution with 1.1 equiv.
• Step (e) 1.0 equiv. of intermediate compound from step d was suspended in solution with 10 equiv. NaOMe, 1.0 M MeOH, 25 0C for 1 hour until complete by TLC monitoring, the reaction was next quenched via standard workup as described above and carried on to the next step after column chromatography (96%) to form compound 25.
• step b Intermediate from step a is exposed to standard Swern Oxidation conditions well known in the art using standard amounts of oxalyl chloride/ triethyl amine in methylene chloride and mixed together for 1 hour at 0 °C until complete by TLC monitoring, the reaction was next quenched via standard workup as described above and carried on to the next step after column chromatography. (90%).
• the reaction mixture was heated at 60 ⁇ C for 5 hr and cooled to
• the Ku and Vmax values for the fluorogenic peptide substrate 2-aminobenzoyl (Abz) -Thr-Ile-Nle ⁇ Phe- (p- N02 ) -Gln-Arg-NH2 Toth et al Int. J. Peptide Res. 36, 544-550 were determined by measuring the initial rate of hydrolysis at different substrate concentrations (5.0, 7.5, 10, 20, 35, 50, 100, and 200 ⁇ M) by monitoring the change in fluorescence at an excitation wavelength of 325 nm and an emission wavelength of 420 nm, and fitting the obtained data to the Mic aelis-Menten equation using the Grafit program (version 3.0, Erithacus Software Ltd., UK). Assays were run in 0.1 M MES buffer, containing 5% ( v/v) glycerol, and 5% ⁇ v/v) DMSO (200 ⁇ l final volume) .
• the enzyme concentration 5.0, 7.5, 10, 20, 35, 50, 100, and
• the Ki for each inhibitor of HIV PR was determined by obtaining the progress curve with the inhibitor (2.0 - 9.0 nM) at different substrate concentrations (7.5, 10, 20, 35, and 50 mM) , under the same reaction conditions as above. The curve fit the data was determined, and the subsequent Ki was derived using the Grafit program. For FIV PRs, the kinetic data were determined under the similar reaction conditions as for HIV PR. The KM and Vmax for the fluorogenic substrate Arg-Ala-Leu-Thr-Lys (Abz) -Val-
• Gln ⁇ nPhe-Val-Gln-Ser-Lys-Gly-Arg were determined by monitoring the change in fluorescence at an excitation filter of 325 nm and an emission filter of 410 nm with the Grafit program under the following reaction conditions : substrate concentration (6.0, 10, 20, 35, 50, 100, and 200 ⁇ M) , 0.1 M NaH 2 P ⁇ 4 buffer containing 0.1 M Na citrate, 0.2 M NaCl, 1.0 mM DTT, 5% ⁇ v/v) glycerol, 5% ⁇ v/v) DMSO and 7.5 ⁇ g/ml (FIV(3X) and FIV(V59I)) or 2.5 ⁇ g/ml (FIV(Q99V)) of the enzyme.
• the Ki for each inhibitor of FIV PRs was also determined by obtaining the progress curve with the inhibitor (50 nM - 20 ⁇ M) at different substrate concentrations (10, 20, 35, and 50 ⁇ M) .
• FIV(3X) was constructed as described Laco et al, J. Virol. 71, 5505-5511 and contains the G5I, N55T, and C84K codon mutations which block three primary autoproteolysis sites in the FIV PR. All clones were sequenced to confirm the modifications made to the FIV PR ORF . Kinetic analyses revealed no significant change in KM or kcat values between the autoproteolysis-resistant 3X PR and wild type FIV PR.
• Mutant FIV PRs were prepared that contained substitutions of HIV residues noted to be associated with drug resistance in HIV (16) at equivalent sites in the three dimensional structure.
• FIV(Q99V) The feline immunodeficiency virus 34TF10 infectious molecular clone (FIV-34TF10) was used as the template in a polymerase chain reaction (PCR) using a negative strand primer
• the -300 bp PCR product was purified and used in a second PCR with the same template and with a negative strand primer ( 5 ' ATCAGAAAGCTTTTACATTACTAACCTGATATTAAATTT3 ' ; complementary to nt ' s 2306-2345) which added a stop codon after the determined C-terminal Met codon of the PR ORF in addition to a 3' Hind III restriction site, to facilitate cloning.
• the resulting PCR product was digested with Nde I and Hind III and ligated into pT7-7 (35 ), which had been digested with Nde I and Hind III, to give FIV(Q99V) .
• FIV(V59I) FIV-34TF10 was the template in a PCR reaction with the positive strand primer ( 5 ' GGAAGGCAAAATATGATTGGAATTGGAGGAGGAAAGAGAGGAACA3 ' ; nt ' ⁇ 2135-2178) which mutates the FIV PR Val codon 59 to lie, and the second negative strand primer used for FIV(Q99V) .
• the -200 bp PCR product was purified and used in a second PCR with the same template and the positive strand primer used for FIV(Q99V) .
• a recombinant plasmid bearing a portion of the Pol gene of the BH10 clone of HIV was used for amplification of sequence encoding PR.
• the 5 ' primer was constructed so as to insert an initiator methionine as part of the coding sequence for an Ndel site, eight amino acids prior to the beginning of PR.
• This primer also encoded a nucleotide change to mutate Gin 7 to Lys , in order to block a major site of autoproteolysi ⁇ Rose et al . J. Biol Chem 268, 11939-11945 and thus increase stability of the enzyme.
• the 3' primer was designed to insert a stop codon immediately following residue 99 of PR, with a Hind III site engineered 30 of the stop codon, to facilitate directional cloning.
• the PCR product was then cut with Ndel and Hind III and inserted into the pET 21+ vector (Novagen) for protein expression.
• the recombinant plasmid was transformed into the BL21.DE3, p lys S strain of E. coli .
• Inclusion bodies were prepared and solubilized essentially as described for preparation of FIV PR (24) .
• the washed inclusion body pellet was then solubilized in 200 ml 20 mM Tris-HCl, pH 8 , 1 mM DTT, 5 mM EDTA, 8 M urea with stirring at 4°C for 1 hr .
• Insoluble material was removed by centrifugation at 8,000 x g for 30 min.
• the supernatant from this centrifugation was treated batch-wise by the addition of 20 gm DE 52 anion exchange resin and the mixture was stirred at 4°C for 1 hr . After centrifugation, PR was found in the supernatant.
• the resin was washed once with 50 ml resuspension buffer (above) and the wash and supernatant fractions were combined.
• the supernatant/wash fraction was then passed over Resource Q anion exchange resin equilibrated in resuspension buffer, using a Pharmacia FPLC apparatus.
• the fraction which failed to bind to the column was concentrated using 5K cutoff UltraFree centrifugal concentrators (Millipore) .
• the retentate was then dialyzed overnight against deionized water, which caused precipitation of PR.
• the pellet was recovered by centrifugation at 3,000 x g for 20 min, then resuspended in 20 mM sodium acetate, pH 5.3 , 1 mM DTT, 5 M GuHCl, to a concentration of 1 mg/ml (determined by Lowry assay of the pellet suspended in a known volume of water prior to final pelleting and solubilization in sodium acetate, DTT, GuHCl buffer) .
• MALDI analysis indicated a mass of 10,792, which is within 1 mass unit of the predicted mass for the properly processed PR. Activity was monitored using a flourogenic substrate, as detailed above. Aliquots were stored at -70 °C for subsequent use.
• the lymphocytic cell line 104-C1 (provided by C. Grant) was used as the target for infection.
• Cells were cultured in RPMI- 1640 media supplemented with 10% FBS, 200 ⁇ M L-Glutamine, IX MEM-Vitamins, 100 ⁇ M Sodium Pyruvate, IX Non-Essential Amino Acids, 5.5X10-5M b-ME, 50 ⁇ g/ml Gentamicin, 50 U/ml human recombinant Interleukin-2 (provided by Hoffmann-LaRoche) and 7.5 ⁇ g/ml Concanavalin-A.
• SIVmac251 (provided by R. Desrosiers) were prepared in 174xCEM cells (provided by the NIH AIDS Research and Reference Program) grown in 88% RPMI medium containing 20 mM HEPES ⁇ 12% heat-inactivated fetal calf serum. A 24 hr supernatant was collected at day 14 post infection and aliquoted and stored at -80 'C for subsequent experiments.
• Cells were acutely infected with approximately 400 TCIDso units of SIVmac251 for 90 min at 37'C. The cells were collected by centrifugation, washed twice with medium to remove free virus, then plated in 0.45 ml medium in 48-well tissue culture plates, at 10s cells per well. Compound 1200, prepared as a 10 mg/ml stock in DMSO, was then added to final concentrations of 10, 1.0, 0.1, and 0.001 ⁇ g/ml final concentrations, in triplicate cultures. Triplicate control cultures received medium only. Uninfected cells were also cultured with the above concentrations of Compound 1200, with no effects noted.

Landscapes

• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Genetics & Genomics (AREA)
• Biochemistry (AREA)
• Biophysics (AREA)
• General Health & Medical Sciences (AREA)
• Health & Medical Sciences (AREA)
• Medicinal Chemistry (AREA)
• Molecular Biology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Life Sciences & Earth Sciences (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Peptides Or Proteins (AREA)

Applications Claiming Priority (3)

Publications (2)

Family

ID=22079543

Family Applications (1)

Country Status (3)

Families Citing this family (6)

Citations (3)

Family Cites Families (9)

• 1998
  • 1998-12-08 AU AU19045/99A patent/AU1904599A/en not_active Abandoned
  • 1998-12-08 EP EP98963800A patent/EP1039886A4/de not_active Withdrawn
  • 1998-12-08 WO PCT/US1998/025964 patent/WO1999029311A1/en active Application Filing

Patent Citations (3)

Non-Patent Citations (4)

Also Published As

Similar Documents

Legal Events