EP0837624A1 - Plants de tomates a murissement tardif - Google Patents

Plants de tomates a murissement tardif

Info

Publication number
EP0837624A1
EP0837624A1 EP96923543A EP96923543A EP0837624A1 EP 0837624 A1 EP0837624 A1 EP 0837624A1 EP 96923543 A EP96923543 A EP 96923543A EP 96923543 A EP96923543 A EP 96923543A EP 0837624 A1 EP0837624 A1 EP 0837624A1
Authority
EP
European Patent Office
Prior art keywords
fruit
plant
tomato
sequence
stage
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
EP96923543A
Other languages
German (de)
English (en)
Inventor
John R. Bedbrook
Pamela Dunsmuir
William J. Howie
Lawrence K. Joe
Kathleen Y. Lee
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
DNA Plant Technology Corp
Original Assignee
DNA Plant Technology Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by DNA Plant Technology Corp filed Critical DNA Plant Technology Corp
Publication of EP0837624A1 publication Critical patent/EP0837624A1/fr
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8249—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving ethylene biosynthesis, senescence or fruit development, e.g. modified tomato ripening, cut flower shelf-life
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)

Definitions

  • the present invention relates generally to the breeding of tomato plants. More specifically, the invention relates to the introduction of a transgene that confers a delayed ripening phenotype on tomato plants.
  • the plant hormone ethylene has a profound influence on plant physiology.
  • ethylene induces a number of physiological changes associated with fruit ripening such as accumulation of carotenoid pigments, conversion of cholorplasts to chromoplasts, the increased expression of genes encoding cell wall degradation enzymes, fruit softening and susceptibility to pathogens.
  • Control of the effects of ethylene is a particularly useful approach to controlling fruit ripening in tomato. More than 80% of tomatoes (by volume) currently sold in the United States are picked while green. Growers harvest green tomatoes for several reasons: (1) green tomatoes are firmer, enabling them to withstand shipping and handling with less injury; (2) a green tomato harvest is less labor-intensive and less costly than a vine-ripe harvest and (3) green fruit stays in the field for a shorter period of time reducing the risk of loss from weather or pests.
  • fruit ripening is associated with a burst of respiration and a concomitant increase in ethylene production. Once ripening is initiated, the endogenous ethylene production rises autocatalytically.
  • the present invention provides tomato plants comprising a genetic locus having a sequence substantially identical to SEQ. ID. No. 1.
  • the plants bear fruit that display significant ripening impairment once the breaker stage is reached. In particular, the fruit reach pink stage about 2 to about 3 weeks after breaker stage, when the fruit are picked at breaker stage and stored at 15 °C.
  • Preferred plants are germinated from seed deposited with the American Type Culture Collection under Accession No. .
  • the invention further provides tomato fruit from the plants of the invention.
  • the fruit of the invention have ethylene levels less than about 1.0 nl/g/hr, preferably less than about 0.5 nl/g/hr.
  • the invention also provides methods of tomato plants with decreased ethylene production.
  • the methods comprise crossing a parent tomato plant with a tomato plant comprising a genetic locus of the invention.
  • the tomato plant comprising the genetic locus can be a plant germinated from seed deposited with American Type Culture
  • the method may further comprise the step of selecting progeny bearing fruit that reach pink stage about 2 to about 3 weeks after breaker stage, when the fruit are picked at breaker stage and stored at 15°C.
  • nucleic acid sequence refers to a single or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end. It includes both self-replicating plasmids, infectious polymers of DNA or RNA and non ⁇ functional DNA or RNA.
  • tomato plant includes whole tomato plants, tomato plant organs (e.g. , leaves, stems, roots, etc.), seeds and tomato plant cells and progeny of same.
  • a tomato plant is "derived from” seed or another plant, if it is germinated directly from the seed or is progeny of the plant or seed (e.g. , F, , F 2 etc.) as a result of standard sexual reproduction.
  • a "primary transformant” is a plant regenerated from one or more plant cells transformed in vitro with a recombinant DNA construct.
  • heterologous sequence is one that originates from a foreign species, or, if from the same species, is substantially modified from its original form.
  • a heterologous promoter operably linked to structural gene is from a species different from that from which the structural gene was derived, or, if from the same species, is different from the promoter normally present with the gene, or is substantially modified from its original form.
  • Two nucleic acid sequences or polypeptides are said to be “identical” if the sequence of nucleotides or amino acid residues, respectively, in the two sequences is the same when aligned for maximum correspondence as described below.
  • sequence is complementary to all or a portion of a reference polynucleotide sequence. Sequence comparisons between two (or more) polynucleotides or polypeptides are typically performed by comparing sequences of the two sequences over a “comparison window” to identify and compare local regions of sequence similarity.
  • a “comparison window”, as used herein, refers to a segment of at least about 20 contiguous positions, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
  • Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman Adv. Appl. Math. 2: 482 (1981), by the homology alignment algorithm of Needleman and Wunsch J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson and Lipman Proc. Natl. Acad. Sci. (U.S.A.) 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr. , Madison, WI), or by inspection. These references are incorporated herein by reference.
  • Percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e. , gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.
  • substantially identical of polynucleotide sequences means that a polynucleotide comprises a sequence that has at least 60% sequence identity, preferably at least 80%, more preferably at least 90% and most preferably at least 95% , compared to a reference sequence using the programs described above (preferably BESTFIT) using standard parameters.
  • BESTFIT the programs described above
  • One of skill will recognize that these values can be appropriately adjusted to determine corresponding identity of proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading frame positioning and the like.
  • Substantial identity of amino acid sequences for these purposes normally means sequence identity of at least 40% , preferably at least 60% , more preferably at least 90%, and most preferably at least 95% .
  • stringent conditions are sequence dependent and will be different in different circumstances.
  • stringent conditions are selected to be about 5° C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH.
  • Tm is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe.
  • stringent conditions will be those in which the salt concentration is about 0.02 molar at pH 7 and the temperature is at least about 60°C.
  • Figure 1 is a schematic diagram of the T-DNA region of pWTT2144/AccS.
  • Figure 2 is a restriction map of the T-DNA region of pWTT2144/AccS showing the location of the hybridization probes used in the genomic mapping.
  • Figure 3 is a schematic diagram showing the Acc2 genomic region and Acc2 cDNA and the fragments used as probes to determine transgene structure in the 1345-4 transformant.
  • Figure 4 is schematic diagram showing the structure of the T-DNA insert of the invention.
  • the present invention provides tomato plants (Lycopersicon esculentum) comprising a stably incorporated locus that confers a delayed fruit ripening phenotype on the plant.
  • the tomato plants of the invention contain a T-DNA insert comprising a sequence (the AccS transgene) derived from a tomato fruit-specific aminocyclopropane carboxylate (ACC) synthase gene, but that does not encode a functional ACC synthase enzyme.
  • ACC synthase is the rate limiting enzyme that converts s- adenosylmethionine to 1 -aminocyclopropane- 1 -carboxylic acid, the immediate precursor to ethylene.
  • incorporation of the AccS transgene in a tomato plant genome inhibits expression of the ACC synthase gene. Inhibition of ACC synthase biosynthesis results in reduced levels of ethylene biosynthesis.
  • fruit of tomato plants comprising the transgene exhibit a delayed ripening phenotype, but ripen normally when external ethylene is applied.
  • an "AccS transgene” is a truncated coding region from the tomato Acc2 gene which is fused to a 35S promoter from cauliflower mosaic virus and a nos3 ' termination sequence from Agrobacterium tumefaciens.
  • the sequence from the Acc2 gene is a sequence consisting of nucleotide 149 to nucleotide 1237. Rottman et al. J. Mol. Biol. 222:937-961 (1991).
  • the plants of the invention are derived, directly or indirectly, from transformation of a tomato plant cell with a construct comprising a T-DNA having the following regions: (1) LB, the left border region of Agrobacterium T-DNA; (2) 2 ⁇ pnos, a tandem duplicate untranslated promoter region of the nopaline synthase gene from Agrobacterium; (3) nptll, the neomycin phosphotransferase gene from Tn5; (4) ocs3' , the 3' untranslated genion of the octopine synthase gene from Agrobacterium; (5) LacZ' , an untranslated LacZ polylinker sequence; (6) p35S, the 35S promoter form cauliflower mosaic virus (7) Cab22L, the leader sequence corresponding to the 5' untranslated region of the Cab22R gene from petunia fused to the 35S promoter; (8) AccS, the truncated coding region from base 149 to base 1237 of the tomato Acc2 gene;
  • the "T-DNA insert" of the invention comprises three copies of the T- DNA described above.
  • the three copies are arranged in inverted repeats at the LB and RB.
  • one border is deleted such that there is only one complete border at each junction.
  • the LB and RB at either end of the T-DNA structure are also deleted.
  • TranswitchTM suppression U.S. Patent No. 5,283, 184.
  • TranswitchTM gene suppression is the reduced accumulation of the targeted gene mRNA (reduced steady state RNA). The trait (level of suppression), once selected through the first sexual generation, behaves in a simple Mendelian fashion.
  • the methods of the present invention can be used to delay fruit ripening of any tomato (large fruited or cherry) cultivar for fresh market or processing tomato production.
  • Exemplary cultivars that can be used include essentially all commercial cultivars. For listings of suitable tomatoes see, Rick, in Evolution of Crop Plants N.W. Simmonds, ed. pp268-273 (Longman, London, 1976) and Taylor in The Tomato Crop ppl-35 (Chapman and Hall, London, 1986).
  • a tomato plant of the present invention can be obtained by crossing a plant comprising the T-DNA insert of the invention with any tomato cultivar lacking the insert.
  • Any standard method used for crossing tomato plants can be used to introduce the transgene into the genome of the desired plant.
  • the methods involve emasculation of one parent, followed by application of pollen from the other parent to the stigma of the first parent.
  • the crosses can be performed using either parent as the pollen parent. Embryo rescue can also be performed if the flowers abort after pollination.
  • the plant containing the T-DNA insert can be a plant derived from primary transformants or can be a plant in which the factor was introduced through a sexual cross.
  • Preferred plants of the invention are those derived from seed deposited with the American Type Culture Collection (ATCC) Accession No.
  • a number of methods can be used to determine if a tomato plant exhibiting a delayed ripening phenotype comprises the T-DNA insert of the invention in its genome.
  • the terms used herein to describe ripeness of tomato fruit are according to standard ripeness classes as described, for instance, in The Tomato Crop Atherton and Rudich eds. (Chapman Hall, 1986).
  • the ripeness classes for a given given fruit are set forth in Table 1.
  • Fruit of the plants of the invention reach breaker stage between about 40 and about 70 days after anthesis, usually between about 45 and about 60 days after anthesis.
  • the fruit differ significantly from wild type fruit in terms of ripening inhibition.
  • the fruit of plants of the invention typically remain at the breaker stage 5 to 7 days longer than wild type.
  • the transition from breaker stage to light red stage in the ripening impaired fruit is further delayed with respect to the transition for wild type fruit.
  • the fruit of the invention typically require approximately 21 days to proceed from the breaker stage to light red stage, whereas wild type fruit typically require 4 to 5 days to turn from the breaker stage to the red stage.
  • the ripening impaired fruit under field conditions can remain indefinitely at the light red stage without ever reaching the red stage.
  • Ripening impaired fruit of the invention typically require at least about 2 weeks (typically about 3 weeks) to reach the pink stage, and while some may reach the light red stage, the fruit can remain indefinitely without reaching the red stage. Fruit will, however, reach the red stage upon the application of ethylene. This is to be contrasted with wild type fruit which typically require 5 to 7 days to reach red ripe stage from the breaker stage under comparable conditions.
  • Fruit color development as measured by the a/b ratio measures about 5 to about 10 fold less in the fruit of the invention as compared to control fruit at the breaker or equivalent stage. Standard methods for determining tomato fruit color are described, for instance, in Gull et al. J. Amer. Soc. Hon. Sci. 1 14:950-954 (1989) and Kader et al. Hort. Sci. 13:577-578 (1978).
  • the levels of color in the fruit of the invention are 4 to 5 times lower.
  • the fruit do not synthesize normal levels of ethylene during ripening.
  • the level which is detected at the breaker or equivalent stage is less than about 0.5 nl/g/hr, usually about 0J nl/g/hr as measured using a standard assay as described in Grierson and Tucker, Planta 157: 174-179 (1983) and Sawamura et al. Plant Cell Physiol. 19: 1061-1069 (1978).
  • the fruit At the pink stage which follows the breaker stage the fruit continue to have ethylene levels which are reduced by about 50 to about 100 fold compared to control fruit.
  • kanamycin resistance can be determined using selective media or by spraying 10- 14 day old tomato seedlings with a solution of kanamycin (Ig/L) on three consecutive days.
  • the levels of Acc2 mRNA can be measured using standard techniques such as Northern blots, RNAse protection assays and the like.
  • nucleic hybridization techniques can be used to determine structure of the T-DNA insert in the plant. The example section, below, provides a detailed description of the molecular characterization of the T- DNA insert of the invention.
  • the precise locus in which the T-DNA insert of the invention is integrated can be determined using standard genetic and molecular mapping techniques well known to those of skill in the art.
  • the locus will be the same as the parent plant.
  • the following example is provided to illustrate, but not limit the claimed invention.
  • Example 1 Agrobacterinm-inediated transformation system Introduction of DNA into plant tissue by Agrobacterium-mediat d transformation as described in U.S. Patent No. 5,283, 184.
  • the vector system used to transfer the AccS transgene into tomato is based on the Ti plasmid from Agrobacterium tumefaciens.
  • the T-DNA plasmid, pWTT2144/ AccS, used in these transformations is composed of: (1) the replication of origin from pACYC184 that ensures replication in Escherichia coli; (2) the pVSl replicon (derived from Pseudomonas aeruginosa DNA) that ensures replication in A.
  • tumefaciens (3) the tetracycline resistance marker from plasmid RP1 that allows for selection of the binary plasmid in A. tumefaciens and E. coli, and (4) the left and right border regions of T-DNA from an octopine strain of A. tumefaciens which surround the DNA insertion in the plant genome.
  • the nptll gene from transposon Tn5 that encodes enzyme neomycin phosphotransferase II and serves as a selectable marker for transformed plant cells, fused to a nopaline synthase (nos) promoter sequence and octopine synthase (ocs3 ') termination sequence from A. tumefaciens, and the LacZ' polylinker region with multiple restriction sites for cloning of genes to be transferred.
  • the T-DNA has an insertion of a truncated Acc2 gene coding region fused to the 35S promoter from cauliflower mosaic virus and the nos3 ' termination sequence in the LacZ' polylinker region of pWTT2144. Plasmid pWTT2144 was transferred from E. coli to A. tumefaciens
  • LBA4404 which carries the pAL4404 vir plasmid, by a triparental mating procedure as described by Figurski et al. , Proc. Natl. Acad. Sci. USA 76: 1648-1652 (1979).
  • the plasmid pWTT2144/ AccS was used to transform the parental line 91 103-1 14 to generate line 1345-4, described in detail below.
  • the T-DNA region of this plasmid consists of the following sequences (see, Figure 1):
  • CaMV35S The 35S promoter region is derived from cauliflower mosaic virus and controls expression of the AccS gene.
  • the 35S promoter directs high level constitutive expression and is widely used as a promoter for high expression of transgenes.
  • Cab22L leader The Cab22L leader sequence (Cab22L) is a 69 bp fragment of Petunia hybrida genomic DNA which was derived from the Cab22L gene and corresponds to the 5' untranslated region for that gene.
  • the AccS gene is a truncated coding region derived from an ACC synthase gene (Acc2) isolated from tomato (L. esculentum).
  • Acc2 ACC synthase gene isolated from tomato (L. esculentum).
  • the AccS gene corresponds to a 1088 bp region of the Acc2 gene from base 149 to base 1237.
  • the AccS gene does not encode a functional ACC synthase enzyme.
  • Termination sequences The nopaline synthase (nos3 ') and octopine synthase (ocs3 ') gene termination sequences from A. tumefaciens function in the expression of the AccS and nptll genes, respectively.
  • the nos promoter is present in line 1345-4 as a duplicate tandem repeat of the untranslated 5' region of the nopaline synthase gene from A. tumefaciens. It functions in line 1345-4 in the expression of the nptll selectable marker gene. This sequence, as used in line 1345-4, no longer functions as a regulated article since it is not associated with the nopaline synthase coding region which functions in A. tumefaciens.
  • nptll The nptll gene is a coding region originally isolated from transposon Tn5. It encodes a protein, neomycin phosphotransferase II, which catalyzes the phosphorylation of certain aminoglycoside antibiotics, rendering transformed cells resistant to kanamycin. It functions in line 1345-4 as a selectable marker.
  • LacZ' polylinker sequence The untranslated LacZ' polylinker sequence functions in line 1345-4 as a site for cloning the AccS transgene into the binary vector pWTT2144. Borders. The left and right border regions of T-DNA from A. tumefaciens function in the transfer of gene sequences into the tomato genome. The border regions are the only necessary m-acting elements in T-DNA for T-DNA insertion. The use of a binary vector system allows for other necessary transfer elements to act in trans so that only the border regions are required to be integrated into the plant host genome.
  • T-DNA borders are only partially transferred to the tomato genome; during the transformation process, the left border is cut between nucleotides 293 and 294 (left border nick) while the right border is cut between nucleotides 7603 and 7604 (right border nick).
  • This cleavage reduces the length of the right border fragment of pWTT2144/ AccS from 1900 bp to 303 bp in the T-DNA and the left border fragment of pWTT2144/AccS from 880 bp to 589 bp in the T-DNA ( Figure 1).
  • DN ⁇ P tomato line 91103-114 is a somaclone derived from the breeding line FL7181 developed by Dr. Jay Scott at the University of Florida.
  • Line FL7181 is characterized as a determinate large-fruited variety with an average fruit weight of 8 oz.
  • Fruit are globate to slightly elliptical in shape and are substantially firmer than fruit of comparable varieties (i.e. , Floradade).
  • Fruit shoulders are smooth and exhibit a darker green shade than the rest of the fruit surface before ripening.
  • the fruit stem (pedicel) lacks a joint. This line is known to be resistant to Verticillium wilt race 1 and Fusarium wilt races 1 and 2.
  • the DNAP line 91103-1 14 exhibits all of the traits described above, but differs from FL7181 principally by reduced blossom end scar size, strong main stem and increased foliage cover for fruit. Line 91103-1 14 also differs from FL7181 in its adaptation to diverse growth environments; while FL7181 is specifically adapted to Florida growing regions, 91 103-114 has proven to grow well in other regions (e.g. , California).
  • the line 1345-4 is a homozygous T 2 selection from an original T 0 transformant 1345, obtained after Agrobacterium tumefaciens transformation of the DNAP line 91 103-1 14 with binary vector pWTT2144/ AccS.
  • the primary transformant 1345 was selected in a greenhouse screen of several hundred primary transformants to have fruit which did not ripen when left on the vine. Subsequently, 10 of the 1345 T, seed (derived from self fertilization) which were prescreened for kanamycin resistance were sceened in the greenhouse and observations on the plant and fruit phenotype were made. Plant 1345-4 was selected as having fruit which did not ripen on the vine. The 1345-4 plant was shown to be homozygous for the T-DNA locus. Seed from the self-fertilization of 1345-4 have been subsequently analyzed in multiple field trials over multiple growing seasons.
  • the second approach to evaluating the stability of line 1345-4 is through observation of the delayed-ripening phenotype in the field.
  • a number of separate field trials for the evaluation of the homozygous 1345-4 line and progeny derived from it have been carried out. These trials have involved the evaluation of fruit on at least 2000 separate plants of 1345-4. During these evaluations, which involved observations of the individual plants at multiple times during the ripening process and the harvest of fruit from all of the plants, no exceptional plants in which all the fruit ripen at the normal rate have been observed.
  • T-DNA is defined as the region between the left and right borders of the binary vector pWTT2144/ AccS that is transferred into the plant (see Figure 1). This region includes the nptll selectable marker and the truncated ACC synthase gene (AccS), together with the left and right border sequences.
  • Figure 2 shows the restriction enzymes used to cleave the DNA and the location of the four probes used to determine the structure of T-DNA insert, the left border (LB), nptll, Acc2, and right border (RB) probes. 1. Copy number
  • AccS The number of additional AccS genes in 1345 was determined by digesting genomic DNA from transgenic plants with Hindlll and EcoRI. then after electrophoresis and transfer to nylon membranes, hybridizing to a 3 P-labeled Acc2 probe. This probe hybridizes to a 0.9 kb EcoRI-Hindlll fragment from the transgene (AccS) and a 1.2 kb Hindlll fragment from the endogenous Acc2 gene which includes an additional 300 bp of intron sequence. By comparing the intensity of the transgene and endogenous bands, a determination of the number of copies of the transgene can be made in either the hemizygous primary transformant or homozygous S I progeny.
  • T-DNA Structure It is known that a single intact copy or multiple T-DNA copies can be inserted at a single locus as direct or inverted repeats around either the left or right border, and it is known that deletions of the T-DNA or insertions of genomic DNA may be present between the T-DNA copies (Jorgenson et al , Mol. Gen. Genet. 207:471-477 (1987)).
  • To determine the organization of the T-DNAs in the 1345 genome we hybridized several different probes to the 1345-4 genome digested with several restriction enzymes.
  • Figure 2 shows the relative map position of the probes in the T-DNA.
  • nptll If the T-DNA is intact, the nptll probe will hybridize to a single 2.4 kb EcoRI fragment containing the entire 2Xpnos-/7/?t//-ocs3' fusion (see Figure 2). In 1345-4 genomic DNA cut with EcoRI.
  • the expected 2.4 kb fragment is present in addition to two other hybridizing fragments of 5.2 kb and 2.9 kb.
  • the 2.9 kb fragment also hybridizes to the left border probe which indicates that there is probably one complete internal copy and 2 incomplete copies of T-DNA with deletions occurring at the LB. Since the 2.9 kb EcoRI fragment hybridizes to both nptll and LB probes, this junction is likely an inverted repeat with a deletion of one of the borders that includes the EcoRI site. Hybridization of an EcoRI fragment to both the LB probe and the nptll probe can only occur if a deletion eliminates one of the EcoRI sites.
  • Ncol cleaves within the nptll coding sequence digestion of the T-DNA with this enzyme will give two nptll fragments, one of 2J kb which spans the nptll 3' coding region up to the Ncol site located at the ATG of the AccS transgene, and one of 1.2 kb in length which includes the 5' nptll coding region and LB to the next Ncol site in either genomic DNA or adjacent T-DNA insertion. If there is a perfect inverted repeat at the LB, we expect a 3.3 kb Ncol fragment that hybridizes to both the nptll and LB probes.
  • Linkage of AccS and nptll Xbal and Hindlll cleave the T-DNA once approximately 1 kb in from the right border. Digestion with either of these enzymes will generate fragments containing both the nptll and AccS genes. After Xbal digestion, a 9.2 kb and a 6.2 kb fragment hybridized with both probes. After Hindlll digestion, a 9.2 kb and 6.4 kb fragment hybridized to both probes confirming that each copy of AccS is linked to a copy of nptll. The 9.2 kb fragment also hybridizes to the LB. The size of the fragments are consistent with the presence of inverted T-DNA repeats at the LB and RB.
  • T-DNA insertion The structure for 1345-4 T-DNA insertion is shown in Figure 4. It consists of three T-DNAs assembled in inverted repeats at the LB and RB. At the LB-LB and
  • LacZ ⁇ - I ->ocs3 • GTATTGGGCAGCGGCCGCTGTTACCCGGCCGCCGTGCTGGACCGGGTTGA
  • GQTTCTGTCA GTTCCAAACG TAAAACGGCT TGTCCCGCGT CATCQGCGGG GGTCATAACG TGACTCC AATTCTCCGC TCA GATCCA GATTATTTGG ATTGAGAGTG AATATGAGAC
  • ATCGTAGGTGAAGGTGGAAATTAATGATCCATCTTGAGACCACAGGCCCA CAACAGCTACCAGTTTCCTCAAGGGTCCACCAAAAACGTAAGCGCTTACG TACATGGTCGATAAGAAAAGGCAATTTGTAGATGTTAACATCCAACGTCG

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Nutrition Science (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)

Abstract

L'invention porte sur des plants de tomates présentant un phénotype de retard de mûrissement et dans lesquels a été introduit un segment d'insertion d'ADN-T comportant un gène Acc2 tronqué. L'introduction du segment d'insertion d'ADN-T dans le génome du plant inhibe la biosynthèse de l'éthylène dans le fruit.
EP96923543A 1995-06-30 1996-06-28 Plants de tomates a murissement tardif Ceased EP0837624A1 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US72195P 1995-06-30 1995-06-30
US72195P 1995-06-30
PCT/US1996/011096 WO1997001952A1 (fr) 1995-06-30 1996-06-28 Plants de tomates a murissement tardif

Publications (1)

Publication Number Publication Date
EP0837624A1 true EP0837624A1 (fr) 1998-04-29

Family

ID=21692734

Family Applications (1)

Application Number Title Priority Date Filing Date
EP96923543A Ceased EP0837624A1 (fr) 1995-06-30 1996-06-28 Plants de tomates a murissement tardif

Country Status (6)

Country Link
EP (1) EP0837624A1 (fr)
JP (1) JPH11510376A (fr)
AU (1) AU710874B2 (fr)
CA (1) CA2226088A1 (fr)
MX (1) MX9800118A (fr)
WO (1) WO1997001952A1 (fr)

Families Citing this family (41)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9710475D0 (en) * 1997-05-21 1997-07-16 Zeneca Ltd Gene silencing
AUPP249298A0 (en) 1998-03-20 1998-04-23 Ag-Gene Australia Limited Synthetic genes and genetic constructs comprising same I
KR20010042069A (ko) 1998-03-20 2001-05-25 베니텍 오스트레일리아 리미티드 유전자 발현 조절방법
US20040214330A1 (en) 1999-04-07 2004-10-28 Waterhouse Peter Michael Methods and means for obtaining modified phenotypes
US8598332B1 (en) 1998-04-08 2013-12-03 Bayer Cropscience N.V. Methods and means for obtaining modified phenotypes
WO1999053050A1 (fr) † 1998-04-08 1999-10-21 Commonwealth Scientific And Industrial Research Organisation Procedes et moyens d'obtention de phenotypes modifies
AU776150B2 (en) 1999-01-28 2004-08-26 Medical College Of Georgia Research Institute, Inc. Composition and method for (in vivo) and (in vitro) attenuation of gene expression using double stranded RNA
US7485715B2 (en) 1999-06-18 2009-02-03 Ceres, Inc. Sequence-determined DNA encoding AP2 domain polypeptides
US7479555B2 (en) 1999-07-21 2009-01-20 Ceres, Inc. Polynucleotides having a nucleotide sequence that encodes a polypeptide having MOV34 family activity
US6423885B1 (en) 1999-08-13 2002-07-23 Commonwealth Scientific And Industrial Research Organization (Csiro) Methods for obtaining modified phenotypes in plant cells
EP1229134A3 (fr) 2001-01-31 2004-01-28 Nucleonics, Inc Utilisation de l'inhibition post-transcriptionnelle pour l'identification des séquences d'acides nucléiques qui modifient la fonction d'une cellule
WO2008069878A2 (fr) 2006-10-27 2008-06-12 Ceres, Inc. Modulation de lignine dans les plantes
WO2007089610A1 (fr) 2006-01-26 2007-08-09 Ceres, Inc. Modulation des taux d'huile dans des plantes
US9758790B2 (en) 2004-12-08 2017-09-12 Ceres, Inc. Modulating the level of components within plants
MX2008009220A (es) 2006-01-17 2008-10-10 Biolex Therapeutics Inc Composiciones y metodos para la humanizacion y optimizacion de n-glicanos en plantas.
WO2007120989A2 (fr) 2006-02-24 2007-10-25 Ceres, Inc. Régions de régulation d'ombre
US20130191941A1 (en) 2006-07-05 2013-07-25 Shing Kwok Modulating light response pathways in plants, increasing light-related tolerances in plants, and increasing biomass in plants
US8222388B2 (en) 2006-11-22 2012-07-17 Ceres, Inc. Broadly expressing regulatory regions
US8298794B2 (en) 2008-10-09 2012-10-30 Ceres, Inc. Cinnamyl-alcohol dehydrogenases
WO2010046423A2 (fr) 2008-10-22 2010-04-29 Basf Se Utilisation d'herbicides sulfonylurées sur des plantes cultivées
WO2010046422A2 (fr) 2008-10-22 2010-04-29 Basf Se Utilisation d'herbicides de type auxine sur des plantes cultivées
CN102573451A (zh) 2009-07-20 2012-07-11 希尔雷斯股份有限公司 具有增加的生物质的转基因植物
WO2011140329A1 (fr) 2010-05-06 2011-11-10 Ceres, Inc. Plantes transgéniques à biomasse augmentée
BR112013010278B1 (pt) 2010-10-27 2020-12-29 Ceres, Inc método para produzir uma planta, método para modular a composição de biomassa em uma planta, ácido nucleico isolado e método para alterar a composição de biomassa em uma planta
SG195304A1 (en) 2011-06-10 2013-12-30 Temasek Life Sciences Lab Ltd Genetic manipulation and expression systems for pucciniomycotina and ustilaginomycotina subphyla
BR122020026837B1 (pt) 2011-11-02 2021-04-13 Ceres, Inc Método de aumento do rendimento de planta em solo contendo níveis elevados de al3+, método de aumento da tolerância de uma planta
WO2013086499A2 (fr) 2011-12-09 2013-06-13 Ceres, Inc. Plantes transgéniques ayant une composition de biomasse altérée
EP2839007B1 (fr) 2012-04-19 2017-12-27 Temasek Life Sciences Laboratory Limited Procédés d'augmentation de la longueur des fibres de coton
EP2900817B1 (fr) * 2012-09-28 2021-11-10 Nunhems B.V. Plants de solanum lycopersicum présentant des modifications non transgéniques dans le gène acs4
US20150250174A1 (en) 2012-10-01 2015-09-10 Basf Se Use of n-thio-anthranilamide compounds on cultivated plants
WO2014079820A1 (fr) 2012-11-22 2014-05-30 Basf Se Utilisation de composés d'anthranilamides pour réduire les infections virales véhiculées par les insectes
US9101100B1 (en) 2014-04-30 2015-08-11 Ceres, Inc. Methods and materials for high throughput testing of transgene combinations
CA3226788A1 (fr) 2014-07-15 2016-01-21 Ceres, Inc. Procedes pour augmenter le rendement de cultures sous stress abiotique
US10266837B2 (en) 2014-10-22 2019-04-23 Temasek Life Sciences Laboratory Limited Terpene synthases from ylang ylang (Cananga odorata var. fruticosa)
EP3028573A1 (fr) 2014-12-05 2016-06-08 Basf Se Utilisation d'un triazole fongicide sur des plantes transgéniques
WO2016091674A1 (fr) 2014-12-12 2016-06-16 Basf Se Utilisation de cyclaniliprole sur des plantes cultivées
US11064696B2 (en) 2015-04-07 2021-07-20 Basf Agrochemical Products B.V. Use of an insecticidal carboxamide compound against pests on cultivated plants
CN109196105B (zh) 2016-03-24 2022-08-05 莱顿大学 转染植物和减少随机整合事件的方法
EP3338552A1 (fr) 2016-12-21 2018-06-27 Basf Se Utilisation d'un fongicide tetrazolinone sur des plantes transgéniques
EP3502259A1 (fr) 2017-12-19 2019-06-26 Universiteit Leiden Stratégie combinatoire permettant de réduire des événements d'intégration aléatoire lors de la transfection de plantes
US11473086B2 (en) 2019-06-19 2022-10-18 Ut-Battelle, Llc Loss of function alleles of PtEPSP-TF and its regulatory targets in rice

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4843186B1 (en) * 1986-07-28 1997-02-25 Lsl Inc Long shelf life heterozygous tomato plant
US5231020A (en) 1989-03-30 1993-07-27 Dna Plant Technology Corporation Genetic engineering of novel plant phenotypes

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9701952A1 *

Also Published As

Publication number Publication date
JPH11510376A (ja) 1999-09-14
AU710874B2 (en) 1999-09-30
MX9800118A (es) 1998-11-29
WO1997001952A1 (fr) 1997-01-23
AU6402996A (en) 1997-02-05
CA2226088A1 (fr) 1997-01-23

Similar Documents

Publication Publication Date Title
AU710874B2 (en) Delayed ripening tomato plants
US6670526B1 (en) Arabidopsis ESD4 gene and method to control flowering time
AU718262B2 (en) Methods and constructs for producing male sterile plants
CA2281487A1 (fr) Genes de type "cotyledon1 feuillu" et leurs utilisations
US6162964A (en) Molecular methods of hybrid seed production
WO1990008828A2 (fr) Procedes moleculaires de production de semences hybrides
CN109134632B (zh) 调控植物根发育的蛋白及其编码基因和应用
US5952546A (en) Delayed ripening tomato plants with T-DNA bearing a truncated ACC2 synthase gene
EP2604694A1 (fr) Procédé d'amélioration de plantes
WO1999014348A1 (fr) TRANSFORMATION DE VEGETAUX $i(IN PLANTA)
JPH08508412A (ja) エチレンに対する修正された応答をもつ植物
AU2006314535A1 (en) EMP4 gene
EP3689895B1 (fr) Modulation de la vigueur de semences
EP2402446A1 (fr) Gène impliqué dans le développement d'une graine
CA2258571A1 (fr) Reductases de sterol de plantes et leurs utilisations
WO1997048793A9 (fr) Reductases de sterol de plantes et leurs utilisations
US5569831A (en) Transgenic tomato plants with altered polygalacturonase isoforms
US20060123514A1 (en) Self-fertile apple resulting from S-RNAase gene silencing
HUT71783A (en) Crucifer acc-synthase, gene coding it, the promoter of the gene, and recombinant methods for production of acc-synthase and transgenic plants expressing acc-synthase
CA2226945A1 (fr) Procede pour l'expression de genes etrangers et vecteurs correspondants
EP0814161A1 (fr) ContrÔle génétique du transport polaire de l'auxin dans des plantes et manipulation de croissance végétale, architecture et morphogénèse
JP2001037358A (ja) ワタ繊維特性が改良されたワタ植物、その作出方法および該ワタ植物体からのワタ繊維の製造方法
AU655574C (en) Molecular methods of hybrid seed production
KR20160039370A (ko) Ore7 유전자를 이용한 식물 생산성 증대 방법, 식물 스트레스 내성 강화 방법 및 식물 노화 지연 방법
WO2001020006A1 (fr) Promoteur inductible

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19980130

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN REFUSED

18R Application refused

Effective date: 20020729