EP0827539A2 - Protease inhibitoren vom kunitz-type - Google Patents

Protease inhibitoren vom kunitz-type

Info

Publication number
EP0827539A2
EP0827539A2 EP96920140A EP96920140A EP0827539A2 EP 0827539 A2 EP0827539 A2 EP 0827539A2 EP 96920140 A EP96920140 A EP 96920140A EP 96920140 A EP96920140 A EP 96920140A EP 0827539 A2 EP0827539 A2 EP 0827539A2
Authority
EP
European Patent Office
Prior art keywords
protease inhibitor
arg
ala
inhibitor according
gly
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP96920140A
Other languages
English (en)
French (fr)
Inventor
Tyler R. White
Deborah Damm
David D. Lesikar
Kethleen Mcfadden
Brett L. Apt. 1 Garrick
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Scios LLC
Original Assignee
Scios LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Scios LLC filed Critical Scios LLC
Publication of EP0827539A2 publication Critical patent/EP0827539A2/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/81—Protease inhibitors
    • C07K14/8107—Endopeptidase (E.C. 3.4.21-99) inhibitors
    • C07K14/811—Serine protease (E.C. 3.4.21) inhibitors
    • C07K14/8114—Kunitz type inhibitors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/55—Protease inhibitors
    • A61K38/57—Protease inhibitors from animals; from humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/81—Protease inhibitors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence

Definitions

  • the plasma, or serine, proteases of the blood contact system are known to be activated by interaction with negatively charged surfaces.
  • tissue injury during surgery exposes the vascular basement membrane, causing interaction of the blood with collagen, which is negatively charged at physiological pH. This induces a cascade of proteolytic events, leading to production of plasmin, a fibrinolytic protease, and consequent blood loss.
  • CPB cardiopulmonary bypass
  • Factor XII is a single-chain 80 kDa protein that circulates in plasma as an inactive zymogen. Contact with negatively charged nonendothelial surfaces, like those of the bypass circuit, causes surface-bound factor XII to be autoactivated to the active serine protease factor Xlla. See Colman, Agents Actions Suppl . 42:125 (1993) . Surface-activated factor Xlla then processes prekallikrein (PK) to active kallikrein, which in turn cleaves more Xlla from XII in a reciprocal activation reaction that results in a rapid amplification of the contact pathway. Factor Xlla can also activate the first component of complement Cl, leading to production of the anaphylatoxin C5a through the classical complement pathway.
  • PK prekallikrein
  • kallikrein kallikrein
  • Factor Xlla can also activate the first component of complement Cl, leading to production of the anaphylatoxin
  • the CPB-induced inflammatory response includes changes in capillary permeability and interstitial fluid accumulation.
  • Cleavage of high molecular weight kininogen (HK) by activated kallikrein generates the potent vasodilator bradykinin, which is thought to be responsible for increasing vascular permeability, resulting in edema, especially in the lung.
  • the lung is particularly susceptible to damage associated with CPB, with some patients exhibiting what has been called "pump lung syndrome" following bypass, a condition indistinguishable from adult respiratory distress. See Johnson et al . , J. Thorac. Cardiovasc. Surg. 107:1193 (1994).
  • Post-CPB pulmonary injury includes tissue damage thought to be mediated by neutrophil sequestration and activation in the microvasculature of the lung.
  • Activated factor XII can itself stimulate neutrophil aggregation.
  • Activated neutrophils may damage tissue through release of oxygen-derived free-radicals, proteolytic enzymes such as elastase, and metabolites of arachidonic acid. Release of neutrophil products in the lung can cause changes in vascular tone, endothelial injury and loss of vascular integrity.
  • Intrinsic inhibition of the contact system occurs through inhibition of activated Xlla by Cl-inhibitor (Cl- INH) . See Colman, supra. During CPB, this natural inhibitory mechanism is overwhelmed by massive activation of plasma proteases and consumption of inhibitors.
  • a potential therapeutic strategy for reducing post-bypass pulmonary injury mediated by neutrophil activation would, therefore, be to block the formation and activity of the neutrophil agonists kallikrein, factor Xlla, and C5a by inhibition of proteolytic activation of the contact system.
  • Protease inhibitor therapy whichpartially attenuates the contact system is currently employed clinically in CPB.
  • Aprotinin also known as basic pancreatic protease inhibitor (BPPI)
  • BPPI basic pancreatic protease inhibitor
  • BPPI basic pancreatic protease inhibitor
  • Aprotinin treatment results in a significant reduction in blood loss following bypass, but does not appear to significantly reduce neutrophil activation.
  • aprotinin is of bovine origin, there is concern that repeated administration to patients could lead to the development of an immune response to aprotinin in the patients, precluding its further use.
  • the proteases inhibited by aprotinin during CPB appear to include plasma kallikrein and plasmin.
  • Aprotinin is an inhibitor of plasmin (K, of 0.23nM), and the observed reduction in blood loss may be due to inhibition of fibrinolysis through the blocking of plasmin action.
  • aprotinin inhibits plasma kallikrein, (K; of 20nM) , it does not inhibit activated factor XII, and consequently only partially blocks the contact system during CPB.
  • factor Xlla By inhibiting the proteolytic activity of factor Xlla, kallikrein production would be prevented, blocking amplification of the contact system, neutrophil activation and bradykinin release. Inhibition of Xlla would also prevent complement activation and production of C5a. More complete inhibition of the contact system during CPB could, therefore, be achieved through the use of a better Xlla inhibitor.
  • Protein inhibitors of factor Xlla are known. For example, active site mutants of ovantitrypsin that inhibit factor Xlla have been shown to inhibit contact activation in human plasma. See Patston et al . , J. Biol . Chem. 265:10786 (1990). The large size and complexity (greater than 400 amino acid residues) of these proteins present a significant challenge for recombinant protein production, since large doses will almost certainly be required during CPB. For example, although it is a potent inhibitor of both kallikrein and plasmin, nearly 1 gram of aprotinin must be infused into a patient to inhibit the massive activation of the kallikrein-kinin and fibrinolytic systems during CPB.
  • the use of smaller, more potent Xlla inhibitors such as the corn and pumpkin trypsin inhibitors (Wen, et al . , Protein Exp. & Purif . 4:215 (1993); Pedersen, e al., J. Mol . Biol . 236:385 (1994)) could be more cost-effective than the large c-,-antitrypsins, but the infusion of high doses of these non-mammalian inhibitors could result in immunologic reactions in patients undergoing repeat bypass operations.
  • the ideal protein Xlla inhibitor is, therefore, preferably, small, potent, and of human sequence origin.
  • KPI Kunitz Protease Inhibitor
  • the isolated KPI domain has been prepared by recombinant expression in a variety of systems, and has been shown to be an active serine protease inhibitor. See, for example, Sinha, et al . , J. Biol . Chem. 265:8983 (1990) .
  • the measured in vi tro K, of KPI against plasma kallikrein is 45nM, compared to 20nM for aprotinin.
  • Phage display methods have been recently used for preparing and screening derivatives of Kunitz-type protease inhibitors. See PCT Application No. 92/15605, which describes specific sequences for 34 derivatives of aprotinin, some of which were reportedly active as elastase and cathepsin inhibitors. The amino acid substitutions in the derivatives were distributed throughout almost all positions of the aprotinin molecule.
  • Phage display methods have also been used to generate
  • protease inhibitors that can bind to and inhibit the activity of serine proteases are greatly to be desired.
  • serine proteases such as kallikrein; chymotrypsins A and B; trypsin; elastase; subtilisin; coagulants and procoagulants, particularly those in active form, including coagulation factors such as factors Vila, IXa, Xa, Xla, and Xlla; plasmin; thrombin; proteinase-3; enterokinase; acrosin; cathepsin; urokinase; and tissue plasminogen activator.
  • novel protease inhibitors that can ameliorate one or more of the undesirable clinical manifestations associated with enhanced serine protease activity, for example by reducing pulmonary damage or blood loss during CPB.
  • the present invention relates to peptides that can bind to and preferably exhibit inhibition of the activity of serine proteases. Those peptides can also provide a means of ameliorating, treating or preventing clinical conditions associated with increased activity of serine proteases. Particularly, the novel peptides of the present invention preferably exhibit a more potent and specific (i.e., greater) inhibitory effect toward serine proteases of interest in comparison to known serine protease inhibitors.
  • proteases include: kallikrein; chymotrypsins A and B; trypsin; elastase; subtilisin; coagulants and procoagulants, particularly those in active form, including coagulation factors such as factors Vila, IXa, Xa, Xla, and Xlla; plasmin; thrombin; proteinase-3; enterokinase; acrosin; cathepsin; urokinase; and tissue plasminogen activator.
  • the invention provides protease inhibitors that can ameliorate one or more of the undesirable clinical manifestations associated with enhanced serine protease activity, for example, by reducing pulmonary damage or blood loss during CPB.
  • the present invention relates to protease inhibitors comprising the following amino acid sequences:
  • the invention relates more specifically to protease inhibitors comprising the following amino acid sequences: X 1 -Val-Cys-Ser-Glu-Gln-Ala-Glu-X-Gly-X 3 -Cys-Arg- Ala-X 4 -X 5 -X 6 -X 7 -Trp-Tyr-Phe-Asp-Val-Thr-Glu-Gly- Lys-Cys-Ala-Pro-Phe-X 8 -Tyr-Gly-Gly-Cys-X 9 -X ,0 -X u - X l2 -Asn-Asn-Phe-Asp-Thr-Glu-Glu-Tyr-Cys-Met-Ala- Val-Cys-Gly-Ser-Ala-He, wherein X 1 is selected from Glu-Val-Val-Arg-Glu- , Asp, or Glu; X 2 is selected from Thr, Val, He and Ser;
  • Another aspect of this invention provides protease inhibitors wherein at least two amino acid residues selected from the group consisting of X 4 , X 5 , X 6 , and X 7 defined above differ from the residues found in the naturally occurring sequence of KPI.
  • Another aspect of this invention provides protease inhibitors wherein X 1 is Asp or Glu, X 2 is Thr, X 3 is Pro, and X 12 is Ser.
  • Yet another aspect of this invention provides protease inhibitors wherein X 1 is Glu, X 2 is Thr, X 3 is Pro, X 4 is Met, X s is He, X 6 is Ser, X 7 is Arg, x 8 is Phe, X 9 is Gly, X 10 is Gly, and X 11 is Asn.
  • Another aspect of this invention provides protease inhibitors wherein X 1 is Asp, X 2 is Thr, X 3 is Pro, X 4 is Arg, X 5 is He, X 6 is He, X 7 is Arg, x 8 is Val, X 9 is Arg, X 10 is Ala, and X" is Lys.
  • Another aspect of this invention provides protease inhibitors wherein X 1 is Glu-Val-Val-Arg-Glu- , X 2 is Thr, X 3 is Pro, X 4 is Met, X 5 is He, X 6 is Ser, X 7 is Arg, x 8 is Phe, X 9 is Gly, X 10 is Gly, X 11 is Asn, and X 12 is Ala.
  • Another aspect of this invention provides protease inhibitors wherein X 1 is Glu-Val-Val-Arg-Glu-, X 2 is Thr, X 3 is Pro, X 4 is Met, X 5 is He, X 6 is Ser, X 7 is Arg, x 8 is Phe, X 9 is Gly, X 10 is Gly, X 11 is Ala, and X 12 is Arg.
  • Another aspect of this invention provides protease inhibitors wherein X 1 is Glu, X 2 is Thr, X 3 is Pro, X 4 is Met, X 5 is He, X 6 is Ser, X 7 is Arg, x 8 is Phe, X 9 is Gly, X 10 is Ala, X 11 is Asn, and X 12 is Arg.
  • Another aspect of this invention provides protease inhibitors wherein X 1 is Glu-Val-Val-Arg-Glu-, X 2 is Thr, X 3 is Pro, X 4 is Met, X 5 is He, X 6 is Ser, X 7 is Arg, x 8 is Phe, X 9 is Gly, X 10 is Arg, X 11 is Asn, and X 12 is Arg.
  • Another aspect of this invention provides protease inhibitors wherein X 1 is Glu- Val-Val-Arg-Glu- , X 2 is Thr, X 3 is Pro, X 4 is Met, X 5 is He, X 6 is Ser, X 7 is Arg, x 8 is Val, Leu, or Gly, X 9 is Gly, X 10 is Gly, X 11 is Asn, and X 12 is Arg.
  • Another aspect of this invention provides protease inhibitors wherein X 1 is Glu-Val-Val-Arg-Glu- , X 2 is Thr, X 3 is Pro, X 4 is Met, X s is He, X 6 is Ser, X 7 is Ala, x 8 is Phe, X 9 is Gly, X 10 is Gly, X 11 is Asn, and X 12 is Arg.
  • Another aspect of this invention provides protease inhibitors wherein X 1 is Glu- Val-Val-Arg-Glu-, X 2 is Thr, Val, or Ser, X 3 is Pro, X 4 is Ala or Leu, X 5 is He, X 6 is Tyr, X 7 His, X 8 is Phe, X 9 is Gly, X 10 is Gly, X 11 is Ala, and X 12 is Arg.
  • protease inhibitors wherein X 2 is Thr, and X 4 is Ala. Another aspect of this invention provides protease inhibitors wherein X 2 is Thr, and X 4 is Leu. Another aspect of this invention provides protease inhibitors wherein X 2 is Val, and X 4 is Ala. Another aspect of this invention provides protease inhibitors wherein X 2 is Ser, and X 4 is Ala. Another aspect of this invention provides protease inhibitors wherein X 2 is Val, and X 4 is Leu. Another aspect of this invention provides protease inhibitors wherein X 2 is Ser, and X 4 is Leu.
  • Yet another aspect of this invention provides protease inhibitors wherein X 1 is Glu-Val-Val-Arg-Glu-, X 2 is Thr, X 3 is Pro, X 4 is Leu, X s is Phe, X 6 is Lys, X 7 is Arg, X 8 is Phe, X 9 is Gly, X 10 is Gly, X 11 is Ala, and X 12 is Arg.
  • Another aspect of this invention provides protease inhibitors wherein X 1 is Glu-Val-Val-Arg-Glu-, X 2 is Thr, X 3 is Pro, X 4 is Leu, X 5 is Phe, X 6 is Lys, X 7 is Arg, X* is Phe, X 9 is Tyr, X 10 is Gly, X" is Ala, and X 12 is Arg.
  • protease inhibitors wherein X 1 is Glu-Val-Val-Arg-Glu-, X 2 is Thr, X 3 is Pro, X 4 is Leu, X s is Phe, X 6 is Lys, X 7 is Arg, X 8 is Phe, X 9 is Leu, X 10 is Gly, X n is Ala, and X 12 is Arg.
  • the present invention also relates to protease inhibitors comprising the following amino acid sequences:
  • X 1 is selected from Glu-Val-Val-Arg-Glu- and Asp-Val-Val-Arg-Glu- ;
  • X 2 is selected from Arg and Lys;
  • X 3 is selected from Met, Arg, Ala, Leu, Ser, Val;
  • X 4 is selected from He and Ala;
  • X 5 is selected from Ser, He, Ala, Pro, Phe, Tyr, and Trp; and
  • X 6 is selected from Arg, Ala, His, Gin, and Thr; provided that: when X 2 is Arg, X 3 is Leu, and X 4 is He, X 5 cannot be Ser; and also provided that either X 3 is not Met; or X 4 is not He; or X 5 is not
  • protease inhibitors wherein X 3 is Arg or Met, and X 5 is Ser or He. Yet another aspect of this invention provides protease inhibitors wherein X 5 is selected from Phe, Tyr and Trp. Another aspect of this invention provides protease inhibitors wherein X 3 is Ala or Leu.
  • That secretory signal peptide may preferably comprise the signal sequence of yeast alpha-mating factor.
  • Another aspect of this invention provides a host cell transformed with any of the DNA molecules defined above.
  • Such a host cell may preferably comprise E. coli or a yeast cell.
  • the yeast cell may be selected from Saccharomyces cerevisiae and Pichia pastoris .
  • Another aspect of this invention provides a method for producing a protease inhibitor of the present invention, comprising the steps of culturing a host cell as defined above and isolating and purifying said protease inhibitor.
  • a further aspect of this invention provides a pharmaceutical composition, comprising a protease inhibitor of the present invention together with a pharmaceutically acceptable sterile vehicle.
  • An additional aspect of this invention provides a method of treatment of a clinical condition associated with increased activity of one or more serine proteases, comprising administering to a patient suffering from said clinical condition an effective amount of a pharmaceuti ⁇ cal composition comprising a protease inhibitor of the present invention together with a pharmaceutically acceptable sterile vehicle. That method of treatment may preferably be used to treat the clinical condition of blood loss during surgery.
  • Yet another aspect of this invention provides a method for inhibiting the activity of serine proteases of interest in a mammal comprising administering a therapeutically effective dose of a pharmaceutical composition comprising a protease inhibitor of the present invention together with a pharmaceutically acceptable sterile vehicle.
  • Another aspect of this invention provides a method for inhibiting the activity of serine proteases of interest in a mammal comprising administering a therapeutically effective dose of a pharmaceutical composition comprising a protease inhibitor of the present invention together with a pharmaceutically acceptable sterile vehicle, wherein said serine proteases are selected from the group consisting of: kallikrein; chymotrypsins A and B; trypsin; elastase; subtilisin; coagulants and procoagulants, particularly those in active form, including coagulation factors such as factors Vila, IXa, Xa, Xla, and Xlla; plasmin; thrombin; proteinase-3; enterokinase; acrosin; cathepsin; urokinase; and tissue plasminogen activator.
  • kallikrein chymotrypsins A and B
  • trypsin elastase
  • subtilisin subtilisin
  • a further aspect of this invention relates to protease inhibitors comprising the following amino acid sequences:
  • the invention also relates more specifically to protease inhibitors comprising the following amino acid sequences: Glu-Val-Val-Arg-Glu-Val-Cys-Ser-Glu-Gln-Ala-Glu- Thr-Gly-Pro-Cys-Arg-Ala-X 1 -X 2 -X 3 -Arg-Trp-Tyr-Phe- Asp-Val-Thr-Glu-Gly-Lys-Cys-Ala-Pro-Phe-Phe-Tyr- Gly-Gly-Cys-X 4 -Gly-Asn-Arg-Asn-Asn-Phe-Asp-Thr- Glu-Glu-Tyr-Cys-Met-Ala-Val-Cys-Gly-Ser-Ala-Ile, wherein X 1 is selected from Ala, Leu, Gly, or Met; X 2 is selected from He, His, Leu, Lys, Ala, or Phe; X 3 is
  • a further aspect of this invention provides a protease inhibitor as defined above wherein X 1 is Met, X 3 is Ser, and X 4 is Gly.
  • Another aspect of this invention provides a protease inhibitor wherein X 2 is selected from His, Ala, Phe, Lys, and Leu.
  • Another aspect of this invention provides a protease inhibitor wherein X 2 is His.
  • Another aspect of this invention provides a protease inhibitor wherein X 2 is Ala.
  • Another aspect of this invention provides a protease inhibitor wherein X 2 is Phe.
  • Another aspect of this invention provides a protease inhibitor wherein X 2 is Lys.
  • Another aspect of this invention provides a protease inhibitor wherein X 2 is Leu.
  • Another aspect of this invention provides a protease inhibitor wherein X 1 is Met, X 2 is He, and X 4 is Gly.
  • Yet another aspect of this invention provides a protease inhibitor wherein X 3 is He. Another aspect of this invention provides a protease inhibitor wherein X 3 is Pro. Another aspect of this invention provides a protease inhibitor wherein X 3 is Phe. Another aspect of this invention provides a protease inhibitor wherein X 3 is Tyr. Another aspect of this invention provides a protease inhibitor wherei'n X 3 is Trp. Another aspect of this invention provides a protease inhibitor wherein X 3 is Asn. Another aspect of this invention provides a protease inhibitor wherein X 3 is Leu.
  • An additional aspect of this invention provides a protease inhibitor wherein X 3 is Lys. Another aspect of this invention provides a protease inhibitor wherein X 3 is His. Another aspect of this invention provides a protease inhibitor wherein X 3 is Glu. Another aspect of this invention provides a protease inhibitor wherein X 1 is Ala. Another aspect of this invention provides a protease inhibitor wherein X 2 is He. Another aspect of this invention provides a protease inhibitor wherein X 3 is Phe, and X 4 is Gly. Another aspect of this invention provides a protease inhibitor wherein X 3 is Tyr, and X 4 is Gly. Another aspect of this invention provides a protease inhibitor wherein X 3 is Trp, and X 4 is Gly.
  • Yet another other aspect of this invention provides a protease inhibitor wherein X 3 is Ser or Phe, and X 4 is
  • Another aspect of this invention provides a protease inhibitor wherein X 2 is His or Leu, X 3 is Phe, and X 4 is Gly. Another aspect of this invention provides a protease inhibitor wherein X 1 is Leu. Another aspect of this invention provides a protease inhibitor wherein
  • X 2 is His, X 3 is Asn or Phe, and X 4 is Gly.
  • Another aspect of this invention provides a protease inhibitor wherein X 2 is He, X 3 is Pro, and X 4 is Gly.
  • Another aspect of this invention provides a protease inhibitor wherein X 1 is Gly, X 2 is He, X 3 is Tyr, and X 4 is Gly.
  • Another aspect of this invention provides a protease inhibitor wherein X 1 is Met, X 2 is His, X 3 is Ser, and X 4 is Tyr.
  • protease inhibitors comprising the following amino acid sequences: X l -Val-Cys-Ser-Glu-Gln-Ala-Glu-X 2 -Gly-Pro-Cys-
  • X 1 is selected from Glu-Val-Val-Arg-Glu-, Asp, or Glu
  • X 2 is selected from Thr, Val, He and Ser
  • X 3 is selected from Arg, Ala, Leu, Gly, or Met
  • X 4 is selected from He, His, Leu, Lys, Ala, or Phe
  • X 5 is selected from Ser, He, Pro, Phe, Tyr, Trp, Asn, Leu, His, Lys, or Glu
  • X 6 is selected from Arg, His, or Ala
  • X 7 is selected from Gly, Ala, Lys, Pro, Arg, Leu, Met, or Tyr.
  • Another aspect of this invention provides a protease inhibitor as defined above wherein at least two amino acid residues selected from the group consisting of X 3 , X 4 , X 5 , and X 6 differ from the residues found in the naturally occurring sequence of KPI.
  • Another aspect of this invention provides a protease inhibitor wherein X 1 is Glu-Val-Val-Arg-Glu-, X 2 is Thr, Val, or Ser, X 3 is Ala or Leu, X 4 is He, X s is Tyr, X 6 is His and X 7 is Gly.
  • Another aspect of this invention provides a protease inhibitor wherein X 2 is Thr, and X 3 is Ala.
  • Another aspect of this invention provides a protease inhibitor wherein X 2 is Thr, and X 3 is Leu. Another aspect of this invention provides a protease inhibitor wherein X 2 is Val, and X 3 is Ala. Another aspect of this invention provides a protease inhibitor wherein X 2 is Ser, and X 3 is Ala. Another aspect of this invention provides a protease inhibitor wherein X 2 is Val, and X 3 is Leu. Another aspect of this invention provides a protease inhibitor wherein X 2 is Ser, and X 3 is Leu.
  • Another aspect of this invention provides a protease inhibitor wherein X 1 is Glu-Val-Val-Arg-Glu-, X 2 is Thr, X 3 is Leu, X 4 is Phe, X s is Lys, X 6 is Arg and X 7 is Gly.
  • Another aspect of this invention provides a protease inhibitor wherein X 1 is Glu-Val-Val-Arg-Glu-, X 2 is Thr, X 3 is Leu, X 4 is Phe, X 5 is Lys, X 6 is Arg and X 7 is Tyr.
  • Another aspect of this invention provides a protease inhibitor wherein X 1 is Glu-Val-Val-Arg-Glu-, X 2 is Thr, X 3 is Leu, X 4 is Phe, X 5 is Lys, X 6 is Arg and X 7 is Leu.
  • Figure 1 shows the strategy for the construction of plasmid pTW10:KPI.
  • Figure 2 shows the sequence of the synthetic gene for KPI (1 ⁇ 57) fused to the bacterial phoA secretory signal sequence.
  • Figure 3 shows the strategy for construction of plasmid pKPI-61.
  • Figure 4 shows the 192 bp -Xbal-Hindlll synthetic gene fragment encoding KPI (l-»57) and four amino acids from yeast alpha-mating factor.
  • Figure 5 shows the synthetic 201 bp - ⁇ bal-Hindlll fragment encoding KPI(-4 ⁇ 57) in PKPI-61.
  • Figure 6 shows the strategy for the construction of plasmid pTW113.
  • Figure 7 shows plasmid PTW113, encoding the 445 bp synthetic gene for yeast alpha-factor-KPI(-4-*57) fusion.
  • Figure 8 shows the amino acid sequence for KPI (-4 ⁇ 57) .
  • Figure 9 shows the strategy for constructing plasmid pTW6165.
  • Figure 10 shows plasmid, PTW6165, encoding the 445 bp synthetic gene for alpha-factor-KPI(-4 ⁇ 57; M15A, S17W) fusion.
  • Figure 11 shows the sequences of the annealed oligonucleotide pairs used to construct plasmids PTW6165, pTW6166, pTW6175, pBG028, pTW6183, pTW6184, pTW6185, pTW6173, and pTW6174.
  • Figure 12 shows the sequence of plasmid PTW6166 encoding the fusion of yeast alpha-factor and KPI(-4 ⁇ 57; M15A, S17Y) .
  • Figure 13 shows the sequence of plasmid PTW6175 encoding the fusion of yeast alpha-factor and KPI(-4 ⁇ 57; M15L, S17F) .
  • Figure 14 shows the sequence of plasmid PBG028 encoding the fusion of yeast alpha-factor and KPI(-4-»57; M15L, S17Y) .
  • Figure 15 shows the sequence of plasmid PTW6183 encoding the fusion of yeast alpha-factor and KPI(-4 ⁇ 57; I16H, S17F) .
  • Figure 16 shows the sequence of plasmid PTW6184 encoding the fusion of yeast alpha-factor and KPI(-4 ⁇ 57; I16H, S17Y) .
  • Figure 17 shows the sequence of plasmid PTW6185 encoding the fusion of yeast alpha-factor and KPI(-4-»57; I16H, S17W) .
  • Figure 18 shows the sequence of plasmid PTW6173 encoding the fusion of yeast alpha-factor and KPI(-4 ⁇ 57; M15A, I16H) .
  • Figure 19 shows the sequence of plasmid PTW6174 encoding the fusion of yeast alpha-factor and KPI(-4-*57; M15L, I16H) .
  • Figure 20 shows the amino acid sequence of KPI 4-57; M15A, S17W) .
  • Figure 21 shows the amino acid sequence of KPI -4 ⁇ 57; M15A, S17Y) .
  • Figure 22 shows the amino acid sequence of KPI -4 ⁇ 57; M15L, S17F) .
  • Figure 23 shows the amino acid sequence of KPI (-4-*57; M15L, S17Y) .
  • Figure 24 shows the amino acid sequence of KPI -4 ⁇ 57; I16H, S17F) .
  • Figure 25 shows the amino acid sequence of KPI -4 ⁇ 57; I16H, S17Y) .
  • Figure 26 shows the amino acid sequence of KPI -4 ⁇ 57; I16H, S17W) .
  • Figure 27 shows the amino acid sequence of KPI -4 ⁇ 57; M15A, S17F) .
  • Figure 28 shows the amino acid sequence of KPI (-4 ⁇ 57; M15A, I16H) .
  • Figure 29 shows the amino acid sequence of KPI 4 ⁇ 57; M15L, I16H) .
  • Figure 30 shows the construction of plasmid pSP26:A ⁇ p:Fl.
  • Figure 31 shows the construction of plasmid pglll.
  • Figure 32 shows the construction of plasmid pP oA:KPI:gIII.
  • Figure 33 shows the construction of plasmid pLGl.
  • Figure 34 shows the construction of plasmid pAL51.
  • Figure 35 shows the construction of plasmid pAL53.
  • Figure 36 shows the construction of plasmid PSP26:Amp:FI:PhoA:KPI:gill.
  • Figure 37 shows the construction of plasmid pDWl #14.
  • Figure 38 shows the coding region for the fusion of phoA-KPI (1 ⁇ 55) -genelll.
  • Figure 39 shows the construction of plasmid PDWl 14- 2.
  • Figure 40 shows the construction of KPI Library 16- 19.
  • Figure 41 shows the expression unit encoded by the members of KPI Library 16-19.
  • Figure 42 shows the phoA-KPI (1 ⁇ 55) -genelll region encoded by the most frequently occurring randomized KPI region.
  • Figure 43 shows the construction of pDD185 KPI (-4 ⁇ 57; M15A, S17F) .
  • Figure 44 shows the sequence of alpha-factor fused to KPI (-4 ⁇ 57; M15A, S17F) .
  • Figure 45 shows the inhibition constants (KjS) determined for purified KPI variants against the selected serine proteases kallikrein, factor Xa, and factor Xlla.
  • Figure 46 shows the inhibition constants (KjS) determined for KPI variants against kallikrein, plasmin, and factors Xa, Xla, and Xlla.
  • Figure 47 shows the post-surgical blood loss in pigs in the presence (KPI) and absence (NS) of KPI 185-1 (M15A, S17F) .
  • Figure 48 shows the post-surgical hemoglobin loss in pigs in the presence (KPI) and absence (NS) of KPI 185-1 (M15A, S17F) .
  • Figure 49 shows the oxygen tension in the presence and absence of KPI, before CPB, immediately after CPB, and at 60 and 180 minutes after the end of CPB.
  • Figure 50 summarizes the results shown in Figures 47- 49.
  • Figure 51 shows the sequence of plasmid PTW6166 encoding the fusion of yeast alpha-factor and KPI(-4 ⁇ 57; M15A, S17Y) .
  • Figure 52 shows the sequence of plasmid PTW6175 encoding the fusion of yeast alpha-factor and KPI(-4 ⁇ 57; M15L, S17F) .
  • Figure 53 shows the sequence of plasmid PBG028 encoding the fusion of yeast alpha-factor and KPI(-4-»57; M15L, S17Y) .
  • Figure 54 shows the inhibition constants (KjS) determined for KPI variants against kallikrein, plasmin, and factor Xlla.
  • the present invention provides peptides that can bind to and preferably inhibit the activity of serine proteases. These inhibitory peptides can also provide a means of ameliorating, treating or preventing clinical conditions associated with increased activity of serine proteases.
  • the novel peptides of the present invention preferably exhibit a more potent and specific (i.e., greater) inhibitory effect toward serine proteases of interest than known serine protease inhibitors.
  • proteases include: kallikrein; chymotrypsins A and B; trypsin; elastase; subtilisin; coagulants and procoagulants, particularly those in active form, including coagulation factors such as factors Vila, IXa, Xa, Xla, and Xlla; plasmin; thrombin; proteinase-3; enterokinase; acrosin; cathepsin; urokinase; and tissue plasminogen activator.
  • Peptides of the present invention may be used to reduce the tissue damage caused by activation of the proteases of the contact pathway of the blood during surgical procedures such as cardiopulmonary bypass (CPB) . Inhibition of contact pathway proteases reduces the "whole body inflammatory response" that can accompany contact pathway activation, and that can lead to tissue damage, and possibly death.
  • the peptides of the present invention may also be used in conjunction with surgical procedures to reduce activated serine protease-associated perioperative and postoperative blood loss. For instance, perioperative blood loss of this type may be particularly severe during CPB surgery.
  • Pharmaceutical compositions comprising the peptides of the present invention may be used in conjunction with surgery such as CPB; administration of such compositions may occur preoperatively, perioperatively or postoperatively.
  • Examples of other clinical conditions associated with increased serine protease activity for which the peptides of the present invention may be used include: CPB- induced inflammatory response; post-CPB pulmonary injury; pancreatitis; allergy-induced protease release; deep vein thrombosis; thrombocytopenia; rheumatoidarthritis; adult respiratory distress syndrome; chronic inflammatory bowel disease; psoriasis; hyperfibrinolytic hemorrhage; organ preservation; wound healing; and myocardial infarction.
  • Other examples of preferable uses of the peptides of the present invention are described in U.S. Patent No. 5,187,153.
  • the invention is based upon the novel substitution of amino acid residues in the peptide corresponding to the naturally occurring KPI protease inhibitor domain of human amyloid ⁇ -amyloid precursor protein (APPI) . These substitutions produce peptides that can bind to serine proteases and preferably exhibit an inhibition of the activity of serine proteases. The peptides also preferably exhibit a more potent and specific serine protease inhibition than known serine protease inhibitors. In accordance with the invention, peptides are provided that may exhibit a more potent and specific inhibition of one or more serine proteases of interest, e.g., kallikrein, plasmin and factors Xa, Xla, Xlla, and Xlla.
  • serine proteases of interest e.g., kallikrein, plasmin and factors Xa, Xla, Xlla, and Xlla.
  • the present invention also includes pharmaceutical compositions comprising an effective amount of at least one of the peptides of the invention, in combination with a pharmaceutically acceptable sterile vehicle, as described in REMINGTON'S PHARMACEUTICAL SCIENCES: DRUG RECEPTORS AND RECEPTOR THEORY, (18th ed.), Mack Publishing Co., Easton, PA (1990).
  • REMINGTON'S PHARMACEUTICAL SCIENCES: DRUG RECEPTORS AND RECEPTOR THEORY (18th ed.
  • Mack Publishing Co. Easton, PA (1990).
  • the sequence of KPI is shown in Table l.
  • Table 2 shows a comparison of this sequence with that of aprotinin, with which it shares about 45% sequence identity.
  • the numbering convention for KPI shown in Table l and used hereinafter designates the first glutamic acid residue of KPI as residue 1. This corresponds to residue number 3 using the standard numbering convention for aprotinin.
  • the crystal structure for KPI complexed with trypsin has been determined. See Perona et al., J. Mol . Biol . 230:919 (1993) . The three-dimensional structure reveals two binding loops within KPI that contact the protease.
  • the first loop extends from residue Thr 9 to He 16
  • the second loop extends from residue Phe 32 to Gly 37 .
  • the two protease binding loops are joined through the disulfide bridge extending from Cys 12 to Cys 36 .
  • KPI contains two other disulfide bridges, between Cys 3 and Cys 53 , and between Cys 28 to Cys 49 .
  • This structure was used as a guide to inform our strategy for making the amino acid residue substitutions that will be most likely to affect the protease inhibitory properties of KPI.
  • Our examination of the structure indicated that certain amino acid residues, including residues 9, 11, 13-18, 32, and 37-40, appear to be of particular significance in determining the protease binding properties of the KPI peptide.
  • substituted peptides may exhibit more potent and specific serine protease inhibition toward selected serine proteases of interest than exhibited by the natural KPI peptide domain.
  • substituted peptides may further comprise one or more additional substitutions at residues 9, 11, 13, 14, 32 and 37-40; in particular, such peptides may further comprise a substitution at positions 9 or 37, or an additional substitution at residue 13.
  • the peptides of the present invention preferably exhibit a greater potency and specificity for inhibiting one or more serine proteases of interest (e.g., kallikrein, plasmin and factors Vila, IXa, Xa, Xla, and Xlla) than the potency and specificity exhibited by native KPI or other known serine protease inhibitors. That greater potency and specificity may be manifested by the peptides of the present invention by exhibiting binding constants for serine proteases of interest that are less than the binding constants exhibited by native KPI, or other known serine protease inhibitors, for such proteases.
  • serine proteases of interest e.g., kallikrein, plasmin and factors Vila, IXa, Xa, Xla, and Xlla
  • That greater potency and specificity may be manifested by the peptides of the present invention by exhibiting binding constants for serine proteases of interest that are less than the
  • aprotinin is twice as potent as wild-type KPI with respect to inhibition of human plasma kallikrein, and is 100-fold more potent as an inhibitor of human plasmin.
  • a series of KPI variants may then be created, using the methods detailed below, where the residues present in aprotinin at positions 13, 15 and 17 are substituted with the residues found in KPI. The effect of such substitutions upon KPI inhibition of plasma kallikrein and plasmin is then determined.
  • single-amino acid substitutions in the first protease binding loop are generally additive, that is, combinations of single amino-acid substitutions, each of which individually enhance the potency toward plasmin, result in variants with even higher potency.
  • the substitution R13K results in a plasmin K j of 12.3, and the further exchange of M15R results in a K ; that is reduced to 1.45.
  • Yeast are transformed with these two sets of plasmids, and 100 individual colonies are picked at random from each transformation. Small cultures are grown from each of these colonies, and their conditioned broth is harvested and tested for kallikrein inhibiting activity.
  • the plasmids from colonies yielding cultures expressing KPI variants more potent than wild-type KPI are isolated, and the KPI domain are sequenced. It is found that only four 4 substitutions at position 15: M15A,M15L,M15S,M15V; and 4 substitutions at position 17: S17P,S17F,S17Y and S17W, result in KPI variants with improved potency toward kallikrein.
  • [M15L,S17F]) are substantially more potent toward kallikrein and factor Xlla than the single amino acid substitutions on which they are based.
  • the results of changing arginine at positions 18 for alanine also suggest that substitutions at position 18 could affect inhibition of kallikrein and factor Xlla.
  • the KPI double variant M13A,S17W (named TW6165 below) is used to construct a series of variants where all possible amino acid substitutions other than Cys and Arg are placed at position 18. Of these variants, three
  • the results described above relate to proteins having the N-terminal sequence EWREVCS- et seg. , as found in KPI (-4-»57) .
  • the present invention also relates, however to proteins wherein the N-terminal sequence may be varied, preferably by substituting aspartic acid at the N-terminus in place of the glutamic acid (i.e. the N- ter inal sequence is DWREVCS-).
  • Other N-terminal sequences that may be used will be apparent to the skilled artisan, including a sequence lacking the first four amino acids of KPI(-4-»57), i.e. having the sequence EVCS-.
  • the serine protease inhibitory properties of peptides of the present invention were measured for the serine proteases of interest — kallikrein, plasmin and factors Xa, Xla, and Xlla.
  • Methodologies for measuring the inhibitory properties of the KPI variants of the present invention are known to those skilled in the art, e.g., by determining the inhibition constants of the variants toward serine proteases of interest, as described in Example 4, infra.
  • Such studies measure the ability of the novel peptides of the present invention to bind to one or more serine proteases of interest and to preferably exhibit a greater potency and specificity for inhibiting one or more serine protease of interest than known serine protease inhibitors such as native KPI.
  • the clinical and therapeutic efficacy of the peptides of the present invention can be assayed by in vitro and in vivo methodologies known to those skilled in the art, e.g., as described in Example 5, infra.
  • BPTI RPDFCLEPPYTGPCKJUtllRYFYNAKAGLCOTFVYGGCRAKRNNFKSAEDCMRTCGGA 1 10 20 30 40 50
  • the peptides of the present invention can be created by synthetic techniques or recombinant techniques which employ genomic or cDNA cloning methods.
  • KPI variants of the present invention can be routinely synthesized using solid phase or solution phase peptide synthesis.
  • Methods of preparing relatively short peptides such as KPI by chemical synthesis are well known in the art.
  • KPI variants could, for example be produced by solid-phase peptide synthesis techniques using commercially available equipment and reagents such as those available from Milligen (Bedford, MA) or Applied Biosystems-Perkin Elmer (Foster City, CA) .
  • segments of KPI variants could be prepared by solid-phase synthesis and linked together using segment condensation methods such as those described by Dawson et al., Science 266:776 (1994).
  • substitution of any amino acid is achieved simply by replacement of the residue that is to be substituted with a different amino acid monomer.
  • KPI variants are produced by recombinant DNA technology. This requires the preparation of genes encoding each KPI variant that is to be made. Suitable genes can be constructed by oligonucleotide synthesis using commercially available equipment, such as that provided by Milligen and Applied Biosystems, supra . The genes can be prepared by synthesizing the entire coding and non- coding strands, followed by annealing the two strands. Alternatively, the genes can be prepared by ligation of smaller synthetic oligonucleotides by methods well known in the art. Genes encoding KPI variants are produced by varying the nucleotides introduced at any step of the synthesis to change the amino acid sequence encoded by the gene.
  • KPI variants are made by site- directed mutagenesis of a gene encoding KPI.
  • Methods of site-directed mutagenesis are well known in the art. See, for example, Ausubel et al., (eds.) CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Wiley Interscience, 1987); PROTEIN ENGINEERING (Oxender & Fox eds., A. Liss, Inc. 1987) .
  • These methods require the availability of a gene encoding KPI or a variant thereof, which can then be mutagenized by known methods to produce the desired KPI variants.
  • PCR linker-scanning and polymerase chain reaction
  • a gene encoding KPI can be obtained by cloning the naturally occurring gene, as described for example in U.S. Patents Nos. 5,223,482 and 5,187,153, which are hereby incorporated by reference in their entireties. In particular, see columns 6-9 of U.S. Patent No. 5,187,153. See also PCT Application No. 93/09233.
  • a synthetic gene encoding KPI is produced by chemical synthesis, as described above.
  • the gene may encode the 57-amino acid KPI domain shown in Table 1, or it may also encode additional N-terminal amino acids from the APPI protein sequence, such as the four amino acid sequence (Glu-Val-Val-Arg, designated residues -4 to -1) immediately preceding the KPI domain in APPI.
  • the synthetic KPI gene contains restriction endonuclease recognition sites that facilitate excision of DNA cassettes from the KPI gene. These cassettes can be replaced with small synthetic oligonucleotides encoding the desired changes in the KPI peptide sequence. See Ausubel, supra .
  • This method also allows the production of genes encoding KPI as a fusion peptide with one or more additional peptide or protein sequences.
  • the DNA encoding these additional sequences is arranged in-frame with the sequence encoding KPI such that, upon translation of the gene, a fusion protein of KPI and the additional peptide or protein sequence is produced.
  • Methods of making such fusion proteins are well known in the art.
  • additional peptide sequences that can be encoded in the genes are secretory signal peptide sequences, such as bacterial leader sequences, for example ompA and phoA, that direct secretion of proteins to the bacterial periplasmic space.
  • the additional peptide sequence is a yeast secretory signal sequence, such as c-- mating factor, that directs secretion of the peptide when produced in yeast.
  • Additional genetic regulatory sequences can also be introduced into the synthetic gene that are operably linked to the coding sequence of the gene, thereby allowing synthesis of the protein encoded by the gene when the gene is introduced into a host cell. Examples of regulatory genetic sequences that dan be introduced are: promoter and enhancer sequences and transcriptional and translational control sequences. Other regulatory sequences are well known in the art. See Ausubel et al., supra, and Sambrook et al., supra. Sequences encoding other fusion proteins and genetic elements are well known to those of skill in the art.
  • the KPI sequence is prepared by ligating together synthetic oligonucleotides to produce a gene encoding an in-frame fusion protein of yeast ⁇ -mating factor with either KPI (1 ⁇ 57) or KPI (-4 ⁇ 57) .
  • the gene constructs prepared as described above are conveniently manipulated in host cells using methods of manipulating recombinant DNA techniques that are well known in the art. See, for example Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, Second Edition, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 1989) , and Ausubel, supra.
  • the host cell used for manipulating the KPI constructs is E. coli .
  • the construct can be ligated into a cloning vector and propagated in E. coli by methods that are well known in the art. Suitable cloning vectors are described in Sambrook, supra, or are commercially available from suppliers such as Promega (Madison, WI) , Stratagene (San Diego, CA) and Life Technologies (Gaithersburg, MD) .
  • genes encoding KPI variants are obtained by manipulating the coding sequence of the construct by standard methods of site-directed mutagenesis, such as excision and replacement of small DNA cassettes, as described supra. See Ausubel, supra, and Sinha et al., supra. See also U.S. Patent 5,373,090, which is herein incorporated by reference in its entirety. See particularly, columns
  • KPI variants can be produced using phage display methods. See, for example, Dennis et al. supra, which is hereby incorporated by reference in its entirety. See also U.S. Patent Nos. 5,223,409 and 5,403,484, which are hereby also incorporated by reference in their entireties. In these methods, libraries of genes encoding variants of KPI are fused in- frame to genes encoding surface proteins of filamentous phage, and the resulting peptides are expressed
  • the phage are then screened for the ability to bind, under appropriate conditions, to serine proteases of interest immobilized on a solid support.
  • Large libraries of phage can be used, allowing simultaneous screening of the binding properties of a large number of KPI variants. Phage that have desirable binding properties are isolated and the sequences of the genes encoding the corresponding KPI variants is determined. These genes are then used to produce the KPI variant peptides as described below.
  • KPI variants are expressed in Pichia pastoris.
  • the KPI variants are cloned into expression vectors to produce a chimeric gene encoding a fusion protein of the KPI variant with yeast Qf-mating factor.
  • the mating factor acts as a signal sequence to direct secretion of the fusion protein from the yeast cell, and is then cleaved from the fusion protein by a membrane-bound protease during the secretion process.
  • the expression vector is transformed into S. cerevisiae, the transformed yeast cells are cultured by standard methods, and the KPI variant is purified from the yeast growth medium.
  • Recombinant bacterial cells expressing the peptides of the present invention are grown in any of a number of suitable media, for example LB, and the expression of the recombinant antigen induced by adding IPTG to the media or switching incubation to a higher temperature. After culturing the bacteria for a further period of between 2 and 24 hours, the cells are collected by centrifugation and washed to remove residual media. The bacterial cells are then lysed, for example, by disruption in a cell homogenizer and centrifuged to separate dense inclusion bodies and cell membranes from the soluble cell components.
  • This centrifugation can be performed under conditions whereby dense inclusion bodies are selectively enriched by incorporation of sugars such as sucrose into the buffer and centrifugation at a selective speed. If the recombinant peptide is expressed in inclusion bodies, as is the case in many instances, these can be washed in any of several solutions to assist in the removal of any contaminating host proteins, then solubilized in solutions containing high concentrations of urea (e.g., 8M) or chaotropic agents such as guanidine hydrochloride in the presence of reducing agents such as S-mercaptoethanol or DTT (dithiothreitol) .
  • urea e.g. 8M
  • chaotropic agents such as guanidine hydrochloride in the presence of reducing agents such as S-mercaptoethanol or DTT (dithiothreitol) .
  • telomeres of the present invention may be advantageous to incubate the peptides of the present invention for several hours under conditions suitable for the peptides to undergo a refolding process into a conformation which more closely resembles that of native KPI.
  • conditions generally include low protein concentrations less than 500 ⁇ g/ml, low levels of reducing agent, concentrations of urea less than 2M and often the presence of reagents such as a mixture of reduced and oxidized glutathione which facilitate the interchange of disulphide bonds within the protein molecule.
  • the refolding process can be monitored, for example, by SDS-PAGE or with antibodies which are specific for the native molecule (which can be obtained from animals vaccinated with the native molecule isolated from parasites) .
  • the peptide can then be purified further and separated from the refolding mixture by chromatography on any of several supports including ion exchange resins, gel permeation resins or on a variety of affinity columns.
  • Purification of KPI variants can be achieved by standard methods of protein purification, e.g., using various chromatographic methods including high performance liquid chromatography and adsorption chromatography. The purity and the quality of the peptides can be confirmed by amino acid analyses, molecular weight determination, sequence determination and mass spectrometry. See, for example, PROTEIN PURIFICATION METHODS — A PRACTICAL APPROACH, Harris et al., eds. (IRL Press, Oxford, 1989).
  • the yeast cells are removed from the growth medium by filtration or centrifugation, and the KPI variant is purified by affinity chromatography on a column of trypsin-agarose, followed by reversed-phase HPLC.
  • KPI variants Once KPI variants have been purified, they are tested for their ability to bind to and inhibit serine proteases of interest in vitro .
  • the peptides of the present invention preferably exhibit a more potent and specific inhibition of serine proteases of interest than known serine protease inhibitors, such as the natural KPI peptide domain.
  • binding and inhibition can be assayed for by determining the inhibition constants for the peptides of the present invention toward serine proteases of interest and comparing those constants with constants determined for known serine protease inhibitors, e.g., the native KPI domain, toward those proteases.
  • Methods for determining inhibition constants of protease inhibitors are well known in the art. See Fersht, ENZYME STRUCTURE AND MECHANISM, 2nd ed. , W.H. Freeman and Co., New York, (1985).
  • the inhibition experiments are carried out using a chromogenic synthetic protease substrate, as described, for example, in Bender et al., J. Amer. Chem. Soc. 88:5890 (1966). Measurements taken by this method can be used to calculate inhibition O 96/35788 PC ⁇ 7US96/06384
  • K K, values
  • KPI variants that exhibit potent and specific inhibition of one or more serine proteases of interest may subsequently be tested in vivo. In vitro testing, however, is not a prerequisite for in vivo studies of the peptides of the present invention.
  • the peptides of the present invention may be tested, alone or in combination, for their therapeutic efficacy by various in vivo methodologies known to those skilled in the art, e.g., the ability of KPI variants to reduce postoperative bleeding can be tested in standard animal models.
  • cardiopulmonary bypass surgery can be carried out on animals such as pigs in the presence of KPI variants, or in control animals where the KPI variant is not used.
  • the use of pigs as a model for studying the clinical effects associated with CPB has previously been described. See Redmond et al., Ann. Thorac. Surg. 56:474 (1993) .
  • the KPI variant is supplied to the animals in a pharmaceutical sterile vehicle by methods known in the art, for example by continuous intravenous infusion.
  • Chest tubes can be used to collect shed blood for a defined period of time.
  • the shed blood, together with the residual intrathoracic blood found after sacrifice of the animal can be used to calculate hemoglobin (Hgb) loss.
  • Hgb hemoglobin
  • the postoperative blood and Hgb loss is then compared between the test and control animals to determine the effect of the KPI variants.
  • KPI variants of the present invention found to exhibit therapeutic efficacy may preferably be used and administered, alone or in combination or as a fusion protein, in a manner analogous to that currently used for aprotinin or other known serine protease inhibitors. See Butler et al., supra .
  • Peptides of the present invention generally may be administered in the manner that natural peptides are administered.
  • a therapeutically effective dose of the peptides of the present invention preferably affects the activity of the serine proteases of interest such that the clinical condition may be treated, ameliorated or prevented.
  • Therapeutically effective dosages of the peptides of the present invention can be determined by those skilled in the art, e.g., through in vivo or in vitro models.
  • the peptides of the present invention may be administered in total amounts of approximately 0.01 to approximately 500, specifically 0.1 to 100 mg/kg body weight, if desired in the form of one or more administrations, to achieve therapeutic effect. It may, however, be necessary to deviate from such administration amounts, in particular depending on the nature and body weight of the individual to be treated, the nature of the medical condition to be treated, the type of preparation and the administration of the peptide, and the time interval over which such administration occurs.
  • compositions comprising peptides of the present invention are advantageously administered in the form of injectable compositions.
  • Such peptides may be preferably administered to patients via continuous intravenous infusion, but can also be administered by single or multiple injections.
  • a typical composition for such purpose comprises a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers include aqueous solutions, non-toxic excipients, including salts, preservatives, buffers and the like, as described in REMINGTON'S PHARMACEUTICAL SCIENCES, pp. 1405-12 and 1461-87 (1975) and THE NATIONAL FORMULARY XIV., 14th Ed. Washington: American Pharmaceutical Association (1975) .
  • Aqueous carriers include water, alcoholic/aqueous solutions, saline solutions, parenteral vehicles such as sodium chloride, Ringer's dextrose, etc.
  • Intravenous vehicles include fluid and nutrient replenishers.
  • Preservatives include antimicrobials, anti-oxidants, chelating agents and inert gases.
  • the pH and exact concentration of the various components of the composition are adjusted according to routine skills in the art. See GOODMAN AND GILMAN'S THE PHARMACOLOGICAL BASIS FOR THERAPEUTICS (7th ed.).
  • the peptides of the present invention may be present in such pharmaceutical preparations in a concentration of approximately 0.1 to 99.5% by weight, specifically 0.5 to 95% by weight, relative to the total mixture.
  • Such pharmaceutical preparations may also comprise other pharmaceutically active substances in addition to the peptides of the present invention.
  • Other methods of delivering the peptides to patients will be readily apparent to the skilled artisan.
  • mammalian serine proteases that may exhibit inhibition by the peptides of the present invention include: kallikrein; chymotrypsins A and B; trypsin; elastase; subtilisin; coagulants and procoagulants, particularly those in active form, including coagulation factors such as thrombin and factors Vila, IXa, Xa, Xla, and Xlla; plasmin; proteinase-3; enterokinase; acrosin; cathepsin; urokinase; and tissue plasminogen activator.
  • kallikrein kallikrein
  • chymotrypsins A and B trypsin
  • elastase subtilisin
  • coagulants and procoagulants particularly those in active form, including coagulation factors such as thrombin and factors Vila, IXa, Xa, Xla, and Xlla
  • plasmin proteinase-3
  • Examples of conditions associated with increased serine protease activity include: CPB-induced inflammatory response; post-CPB pulmonary injury; pancreatitis; allergy-induced protease release; deep vein thrombosis; thrombocytopenia; rheumatoid arthritis; adult respiratory distress syndrome; chronic inflammatory bowel disease; psoriasis; hyperfibrinolytic hemorrhage; organ preservation; wound healing; and myocardial infarction.
  • Other examples of the use of the peptides of the present invention are described in U.S. Patent No. 5,187,153.
  • the inhibitors of the present invention may also be used for inhibition of serine protease activity in vi tro, for example during the preparation of cellular extracts to prevent degradation of cellular proteins.
  • the inhibitors of the present invention may preferably be used in a manner analogous to the way that aprotinin, or other known serine protease inhibitors, are used.
  • aprotinin as a protease inhibitor for preparation of cellular extracts is well known in the art, and aprotinin is sold commercially for this purpose.
  • Plasmid PTW10:KPI is a bacterial expression vector encoding the 57 amino acid form of KPI fused to the bacterial phoA signal sequence. The strategy for the construction of PTW10:KPI is shown in Figure 1.
  • Plasmid pcDNAII (Invitrogen, San Diego, CA) was digested with PvuII and the larger of the two resulting PvuII fragments (3013 bp) was isolated.
  • Bacterial expression plasmid pSP26 was digested with AEluI and RsrII , and the 409 bp Mlul-Rsrll fragment containing the pTrp promoter element and transcription termination signals was isolated by electrophoresis in a 3% NuSieve Agarose gel (FMC Corp., Rockland, ME).
  • Plasmid pSP26 containing a heparin-binding EGF-like growth factor (HB- EGF) insert between the Ndel and Hindlll sites, is described as pNA28 in Thompson et al . , J. Biol . Chem. 269:2541 (1994) . Plasmid pSP26 was deposited in host E. coli W3110, pSP26 with the American Type Culture Collection (ATCC) , 12301 Parklawn Drive, Rockville, Maryland, 20852, USA under the conditions specified by the Budapest Treaty on the International Recognition of the Deposit of Microorganisms (Budapest Treaty) . Host E.
  • ATCC American Type Culture Collection
  • coli W3110, pSP26 was deposited on 3 May 1995 and given Accession No. 69800. Availability of the deposited plasmid is not to be construed as a license to practice the invention in contravention of the rights granted under the authority of any government in accordance with its patent laws.
  • the ends of the Mlul-Rsrll fragment were blunted using DNA polymerase Klenow fragment by standard techniques.
  • the blunted fragment of pSP26 was then ligated into the large PvuII fragment of plasmid pCDNAII, and the ligation mixture was used to transform E. coli strain MC1061. Ampicillin-resistant colonies were selected and used to isolate plasmid pTWIO by standard techniques.
  • a synthetic gene was constructed encoding the bacterial phoA secretory signal sequence fused to the amino terminus of KPI(l-*57) .
  • the synthetic gene contains cohesive ends for Ndel and Hindlll, and also incorporates restriction endonuclease recognition sites for Agrel, RsrII, Aatll and BamHI, as shown in Figure 2.
  • the synthetic phoA-KPI gene was constructed from 6 oligonucleotides of the following sequences (shown 5' ⁇ 3'):
  • the oligonucleotides were phosphorylated and annealed in pairs: 6167 + 6169, 6165 + 6166, 6168 + 6164.
  • 20 ⁇ l T4 DNA Ligase Buffer New England Biolabs, Beverley, MA
  • 1 ⁇ g of each oligonucleotide pair was incubated with 10 U T4 Polynucleotide Kinase (New England Biolabs) for 1 h at 37°C, then heated to 95°C for l minute, and slow-cooled to room temperature to allow annealing.
  • All three annealed oligo pairs were then mixed for ligation to one another in a total volume of 100 ⁇ l T4 DNA Ligase Buffer, and incubated with 400 U T4 DNA Ligase (New England Biolabs) overnight at 15°C.
  • the ligation mixture was extracted with an equal volume of phenol:CHC1 3 (1:1), ethanol-precipitated, resuspended in 50 ⁇ l Restriction Endonuclease Buffer #4 (New England Biolabs) and digested with Ndel and Hindlll.
  • annealed, ligated and digested oligos were then subjected to electrophoresis in a 3% ⁇ uSieve Agarose gel, and the 240 bp Ndel-Hindlll fragment was excised.
  • This gel- purified synthetic gene was ligated into plasmid pTWIO which had previously been digested with Ndel and Hindlll, and the ligation mixture was used to transform E. coli strain MC1061. Ampicillin-resistant colonies were selected and used to prepare plasmid pTW10:KPI.
  • This plasmid contains the phoA-KPI(l-»57) fusion protein inserted between the pTrp promoter element and the transcription termination signals.
  • Plasmid pTW10:KPI was digested with Agel and Hindlll; the resulting 152 bp Ag-el-Hindlll fragment containing a portion of the KPI synthetic gene was isolated by preparative gel electrophoresis.
  • the annealed oligonucleotides were then ligated to the Agrel-Hindlll fragment of the KPI (1 ⁇ 57) synthetic gene.
  • the resulting 192 bp -Xbal-Hindlll synthetic gene (shown in Figure 4) was purified by preparative gel electrophoresis, and ligated into plasmid pUC19 which had previously been digested with -Xbal and Hindlll.
  • the ligation products were used to transform E. coli strain MC1061. Ampicillin-resistant colonies were picked and used to prepare plasmid PKPI-57 by standard methods.
  • PKPI-57 was digested with .Xbal and Agel and the smaller fragment replaced with annealed oligos 234 + 235, which encode 4 amino acid residues of yeast o.-mating factor fused a 4 amino acid residue amino-terminal extension of KPI(1 ⁇ 57) .
  • the 4 extra amino acids are encoded in the amyloid
  • Hindlll fragment encoding KPI(-4-»57) in pKPI-61 is shown in Figure 5.
  • Plasmid pSP35 was constructed from yeast expression plasmid pYES2 (Invitrogen, San Diego, CA) as follows. A 267 bp PvuII -Xbal fragment was generated by PCR from yeast ⁇ f-mating factor DNA using oligos 6274 and 6273:
  • 6274 GGGGGCAGCTGTATAAACGATTAAAA 6273: GGGGGTCTAGAGATACCCCTTCTTCTTTAG
  • This PCR fragment encoding an 82 amino acid portion of yeast ⁇ -mating factor, including the secretory signal peptide and pro-region, was inserted into pYES2 that had been previously digested with PvuII and .Xbal.
  • the resulting plasmid is denoted pSP34.
  • the resulting synthetic fragment was ligated into the Xbal site of pSP34, resulting in plasmid pSP35.
  • pSP35 was digested with .Xbal and Hindlll to remove the insert, and ligated with the 201 bp .Xbal-Hindlll fragment of pKPI-61, encoding KPI(-4 ⁇ 57).
  • the resulting plasmid pTWH3, encodes the 445 bp synthetic gene for the cv- factor-KPI(-4-»57) fusion. See Figure 7.
  • the cell pellet was resuspended in 200 ml ice-cold water, respun, resuspended in 100 ml ice-cold water, then pelleted again.
  • the washed cell pellet was resuspended in 10 ml ice-cold IM sorbitol, recentrifuged, then resuspended in a final volume of 0.2 ml ice-cold IM sorbitol.
  • a 40 ⁇ l aliquot of cells was placed into the chamber of a cold 0.2 cm electroporation cuvette (Invitrogen) , along with 100 ng plasmid DNA for pTW113.
  • the cuvette was placed into an Invitrogen Electroporator II and pulsed at 1500 V, 25 ⁇ F, 100 ⁇ . Electroporated cells were diluted with 0.5 ml IM sorbitol, and 0.25 ml was spread on an SD agar plate containing IM sorbitol. After 3 days' growth at 30°C, individual colonies were streaked on SD + CAA agar plates.
  • Yeast cultures were grown in a rich broth and the galactose promoter of the KPI expression vector induced with the addition of galactose as described by Sherman, Methods Ehzymol . 194:3 (1991).
  • a single well-isolated colony of pTW113/ABL115 was used to inoculate a 10 ml overnight culture in Yeast Batch Medium.
  • IL Yeast Batch Medium which had been made 0.2% glucose was inoculated to an OD ⁇ of 0.1 with the overnight culture.
  • the IL culture was induced by the addition of 20 ml Yeast Galactose Feed Medium.
  • Expression vectors for the production of specific variants of KPI(-4-*57) were all constructed using the pTWH3 backbone as a starting point.
  • an expression construct was created by replacing the 40 bp RsrII-Aatll fragment of the synthetic KPI gene contained in pTW113 with a pair of annealed oligonucleotides which encode specific codons mutated from the wild-type KPI(-4 ⁇ 57) sequence.
  • the convention used for designating the amino substituents in the KPI variants indicates first the single letter code for the amino acid found in wild-type KPI, followed by the position of the residue using the numbering convention described supra, followed by the code for the replacement amino acid.
  • M15R indicates that the methionine residue at position 15 is replaced by an arginine.
  • Plasmid pTW113 was digested with RsrII and Aatll, and the larger of the two resulting fragments was isolated.
  • An oligonucleotide pair (812 + 813) was phosphorylated, annealed and gel-purified as described above.
  • the annealed oligonucleotides were ligated into the RsrII and Aatll-digested pTWH3, and the ligation product was used to transform E. coli strain MC1061. Transformed colonies were selected by ampicillin resistance.
  • the resulting plasmid, pTW6165 encodes the 445 bp synthetic gene for the cv-factor-KPI(-4-»57; M15A, S17W) fusion. See Figure 10.
  • pTW6166 KPI(-4 ⁇ 57; M15A, S17Y) — See Figure 12 814: GTCCGTGCCGTGCAGCTATCTACCGCTGGTACTTTGACGT 815: CAAAGTACCAGCGGTAGATAGCTGCACGGCACG
  • pBG028 KPI(-4-»57; M15L, S17Y) —See Figure 14 1493: GTCCGTGCCGTGCTTTGATCTACCGCTGGTACTTTGACGT
  • Transformation of yeast with expression vectors Yeast strain ABL115 was transformed by electroporation exactly according to the protocol described for transformation by pTW113.
  • KPI(-4-*57) variants were purified according to the procedure described for KPI(-4-»57) .
  • the amino acid sequences of KPI(-4 ⁇ 57) variants are shown in
  • Vector pSP26:Amp:Fl contributes the basic plasmid backbone for the construction of the phage display vector for the phoA:KPI fusion, PDWl #14.
  • pSP26:Amp:Fl contains a low-copy number origin of replication, the ampicillin-resistance gene (Amp) and the Fl origin for production of single-stranded phagemid DNA.
  • the ampicillin-resistance gene (Amp) was generated through polymerase chain reaction (PCR) amplification from the plasmid genome of PUC19 using oligonucleotides 176 and 177.
  • PCR amplification of Amp was done according to standard techniques, using Taq polymerase (Perkin-Elmer Cetus, Norwalk, CT) . Amplification from plasmid pUC19 with these oligonucleotides yielded a fragment of 1159 bp, containing PflMI and Clal restriction sites. The PCR product was digested with PflMI and Clal and purified by agarose gel electrophoresis in 3% NuSieve
  • Bacterial expression vector pSP26 Bacterial expression vector pSP26
  • the Fl origin of replication from the mammalian expression vector pcDNAII (Invitrogen) was isolated in a 692 bp Earl fragment. Plasmid pcDNAII was digested with Earl and the resulting 692 bp fragment purified by agarose gel electrophoresis. Earl-Notl adapters were added to the 692 bp Earl fragment by ligation of two annealed oligonucleotide pairs, 179 + 180 and 181 + 182. The oligo pairs were annealed as described above.
  • oligonucleotide-ligated fragment was then ligated into the single Notl site of PSP26 :Amp to yield the vector pSP26: Amp:F1.
  • the PCR oligos contain BamHI and Hindlll restriction recognition sites such that PCR from ml3mp8 plasmid D ⁇ A with the oligo pair yielded a 490 bp BamHI-Hindlll fragment encoding the appropriate portion of genelll.
  • the PCR product was ligated between the BamHI and Hindlll sites within the polylinker of PUC19 to yield plasmid pglll.
  • FIG. 32 A portion of the phoA signal sequence and KPI fusion encoded by the phage display vector PDWl #14 originates with pPhoA:KPI:gIII.
  • the 237 bp Ndel-Hindlll fragment of pTW10:KPI encoding the entire phoA:KPI (l-*57) fusion was isolated by preparative agarose gel electrophoresis, and inserted between the Ndel and Hindlll sites of pUC19 to yield plasmid pPhoA:KPI.
  • FIG. 33 Construction of pLGl is illustrated in Figure 33.
  • the exact genelll sequences contained in vector PDWl #14 originate with phage display vector pLGl.-
  • a modified genelll segment was generated by PCR amplification of the genelll region from pglll using PCR oligonucleotides 6308 and 6305.
  • PCR amplification from pglll with these oligonucleotides yielded a 481 bp BamHI-Hindlll fragment encoding a genelll product shortened by 3 amino acid residues at the amino-terminal portion of the segment of the genelll fragment encoded by pglll.
  • a 161 bp Ndel- BamHI fragment was generated by PCR amplification from bacterial expression plasmid pTHW05 using oligonucleotides 6306 and 6307.
  • Vector pAL51 contains the genelll sequences of pLGl which are to be incorporated in vector pDWl #14.
  • a 1693 bp fragment of plasmid pBR322 was isolated, extending from the BamHI site at nucleotide 375 to the PvuII site at position 2064.
  • Plasmid pLGl was digested with Asp718I and BamHI, removing an 87 bp fragment.
  • the overhanging Asp718I end was blunted by treatment with Klenow fragment, and the PvuII-BamHI fragment isolated from pBR322 was ligated into this vector, resulting in the insertion of a 1693 bp "stuffer" region between the Asp718I and BamHI sites.
  • the 78 bp NdeI -Asp718I region of the resulting plasmid was removed and replaced with the annealed oligo pair 6512 + 6513.
  • the newly created 74 bp NdeI -Asp718I fragment encodes the phoA signal peptide, and contains a BstEII cloning site.
  • the resulting plasmid is denoted pAL51.
  • Plasmid pAL53 contributes most of the vector sequence of pDWl #14, including the basic vector backbone with Amp gene, Fl origin, low copy number origin of replication, genelll segment, phoA promotor and phoA signal sequence.
  • Plasmid pAL51 was digested with Ndel and Hindlll and the resulting 2248 bp Ndel-Hindlll fragment encoding the phoA signal peptide, stuffer region and genelll region was isolated by preparative agarose gel electrophoresis.
  • the Ndel-Hindlll fragment was ligated into plasmid pSP26: Amp:Fl between the Ndel and Hindlll sites, resulting in plasmid pAL52.
  • the phoA promoter region and signal peptide was generated by amplification of a portion of the E. coli genome by PCR, using oligonucleotide primers 405 and 406.
  • the resulting PCR product is a 332 bp ⁇ TluI -Bs EII fragment which contains the phoA promoter region and signal peptide sequence. This fragment was used to replace the 148 bp MluI-BstEII segment of PAL52, resulting in vector pAL53.
  • FIG. 36 Construction of pSP26:Amp:Fl :PhoA:KPI:gIII Construction of pSP26: Amp:F1: hoA:KPI:gIII is illustrated in Figure 36. This particular vector is the source of the KPI coding sequence found in vector pDWl #14. Plasmid pPhoa:KPI:gIII was digested with Ndel and Hindlll, and the resulting 714 bp Ndel-Hindlll fragment was purified, and then inserted into vector pSP26: Amp:Fl between the Ndel and Hindlll sites. The resulting plasmid is denoted pSP26:Amp:Fl:PhoA:KPI:gIII.
  • pDWl #14 Construction of pDWl #14 is illustrated in Figure 37.
  • the sequences encoding KPI were amplified from plasmid pSP26:Amp:Fl: hoA:KPI:gIII by PCR, using oligonucleotide primers 424 and 425.
  • the resulting 172 bp BstEII-BamHI fragment encodes most of KPI ( ⁇ -»55) . This fragment was used to replace the stuffer region in pAL53 between the BstEII and BamHI sites.
  • the resulting plasmid, PDWl #14 is the parent KPI phage display vector for preparation of randomized KPI phage libraries.
  • the coding region for the phoA-KPI (l-*55) -genelll fusion is shown in Figure 38.
  • Plasmid pDWl #14 was digested with Agrel and BamHI, and the 135 bp Agrel-BamHI fragment encoding KPI was discarded.
  • a stuffer fragment was created by PCR amplification of a portion of the PBR322 Tet gene, extending from the BamHI site at nucleotide 375 to nucleotide 1284, using oligo primers 266 and 252.
  • the resulting 894 bp Agrel-BamHI stuffer fragment was then inserted into the Agel/BamEI-digested pDWl #14 to yield the phagemid vector pDWl 14-2.
  • This vector was the starting point for construction of the randomized KPI libraries.
  • KPI Library 16-19 Construction of KPI Library 16-19 is outlined in Figure 40.
  • Library 16-19 was constructed to display KPI-genelll fusions in which amino acid positions Ala 14 , Met", He 16 and Ser 17 are randomized.
  • plasmid pDWl 14-2 was digested with Ag-el and BamHI to remove the stuffer region, and the resulting vector was purified by preparative agarose gel electrophoresis.
  • Plasmid pDWl #14 was used as template in a PCR amplification of the KPI region extending from the Agrel site to the BamHI site.
  • the oligonucleotide primers used were 544 and 551.
  • Oligonucleotide primer 544 contains four randomized codons of the sequence NNS, where N represents equal mixtures of A/G/C/T and S an equal mixture of G or C. Each NNS codon thus encodes all 20 amino acids plus a single possible stop codon, in 32 different DNA sequences.
  • PCR amplification from the wild-type KPI gene resulted in the production of a mixture of 135 bp Agrel- BamHI fragments all containing different sequences in the randomized region.
  • the PCR product was purified by preparative agarose gel electrophoresis and ligated into the Agel/BamHI digested PDWl 14-2 vector. The ligation mixture was used to transform E. coli ToplOF 1 cells
  • the resulting Library 16-19 contained approximately 400,000 independent clones.
  • the expression unit encoded by the members of Library 16-19 is shown in Figure 41.
  • KPI phage were prepared and amplified by infecting transformed cells with M13K07 helper phage as described by Matthews et al . , Science 260:1113 (1993).
  • Bound phage were eluted sequentially by successive 5 minute washes: 0.5 ml 50mM sodium citrate, pH 6.0, 150mM NaCl; 0.5 ml 50mM sodium citrate, pH 4.0, 150mM NaCl; and 0.5 ml 50mM glycine, pH 2.0, 150mM NaCl. Eluted phage were neutralized immediately and phagemids from the pH 2.0 elution were titered and amplified for reselection. After three rounds of selection on kallikrein-Sepharose, phagemid DNA was isolated from 22 individual colonies and subjected to DNA sequence analysis.
  • KPI 1 ⁇ 55; M15A, S17F
  • M15A, S17F were moved from one phagemid vector, pDWl (16-19) 185, to the yeast expression vector so that the
  • KPI variant could be purified and tested.
  • Plasmid pTW113 encoding wild-type KPI (-4-*57) was digested with Agrel and BamHI and the 135 bp Agrel-BamHI fragment was discarded.
  • the 135 bp Agrel-BamHI fragment of pDWl (16-19) 185 was isolated and ligated into the yeast vector to yield plasmid pDD185, encoding ⁇ -factor fused to KPI (-4 ⁇ 57; M15A, S17F) . See Figure 44.
  • Library 6 was constructed to display KPI-genelll fusions in which amino acid positions Ala 14 , He 16 , Ser 17 and Arg 18 are randomized, but position 15 was held constant as Ala.
  • plasmid pDWl #14 was used as template in a PCR amplification of the KPI region extending from the Agrel site to the BamHI site.
  • the oligonucleotide primers used were 551 and 1003.
  • Oligonucleotide primer 1003 contained four randomized codons of the sequence NNS, where N represents equal mixtures of A/G/C/T and S an equal mixture of G or C. Each NNS codon thus encodes all 20 amino acids plus a single possible stop, in 32 different DNA sequences.
  • PCR amplification from the wild-type KPI gene resulted in the production of a mixture of 135 bp Agrel-BamHI fragments all containing different sequences in the randomized region.
  • the PCR product was phenol extracted, ethanol precipitated, digested with BamHI and purified by preparative agarose gel electrophoresis. Plasmid pDWl 14-2 was digested with BamHI, phenol extracted and ethanol precipitated.
  • the insert was ligated at high molar ratio to the vector which was then digested with Agrel to remove the stuffer region.
  • the vector containing the insert was purified by agarose gel electrophoresis and recircularized.
  • the resulting library contains approximately 5xl0 6 independent clones.
  • Library 7 was constructed to display KPI-genelll fusions in which amino acid positions Ala 14 , Met 15 , He 16 , Ser 17 and Arg 18 are randomized.
  • plasmid pDWl #14 was used as template in a PCR amplification of the KPI region extending from the Agrel site to the BamHI site.
  • the oligonucleotide primers used were 551 and 1179. 1179: GCTGAGACCGGTCCGTGCCGT(NNS)jTGGTACTTTGACGTC
  • Oligonucleotide primer 1179 contains five randomized codons of the sequence NNS, where N represents equal mixtures of A/G/C/T and S an equal mixture of G or C. Each NNS codon thus encoded all 20 amino acids plus a single possible stop, in 32 different DNA sequences.
  • PCR amplification from the wild-type KPI gene resulted in the production of a mixture of 135 bp Agrel-BamHI fragments all containing different sequences in the randomized region.
  • the PCR product was phenol extracted, ethanol precipitated, digested with BamHI and purified by preparative agarose gel electrophoresis. Plasmid pDWl 14-2 was digested with BamHI, phenol extracted and ethanol precipitated.
  • the insert was ligated at high molar ratio to the vector which was then digested with Agrel to remove the stuffer region.
  • the vector containing the insert was purified by agarose gel electrophoresis and recircularized.
  • the resulting library contains approximately lxlO 7 independent clones.
  • KPI phage were prepared and amplified by infecting transformed cells with M13K07 helper phage (Matthews and Wells, 1993) .
  • Human factor Xlla (Enzyme Research Laboratories, South Bend, IN), was biotinylated as follows. Factor Xlla (0.5 mg) in 5mM sodium acetate pH 8.3 was incubated with Biotin Ester (Zymed) at room temperature for 1.5 h, then buffer-exchanged into assay buffer (AB) .
  • Unbound phage were removed by washing the magnetically bound biotinylated XHa-phage complexes three times with 0.5 ml AB. Bound phage were eluted sequentially by successive 5 minute washes: 0.5 ml 50mM sodium citrate, pH 6.0, 150mM NaCl; 0.5 ml 50mM sodium citrate, pH 4.0, 150mM NaCl; and 0.5 ml 50mM glycine, pH 2.0, 150mM NaCl. Eluted phage were neutralized immediately and phagemids from the pH 2.0 elution were titered and amplified for reselection. After 3 or 4 rounds of selection with factor Xlla, phagemid DNA was isolated from individual colonies and subjected to DNA sequence analysis.
  • Sequences in the randomized regions were compared with one another to identify consensus sequences appearing more than once. From Library 6 a phagemid was identified which encoded M15L, S17Y, R18H. From Library 7 a phagemid was identified which encoded M15A, S17Y, R18H.
  • Plasmid pTW113 encoding wild-type KPI (-4- * 57) was digested with Agel and BamHI and the 135 bp Ag l-BamHI fragment was discarded.
  • the 135 bp Agel-BamHI fragment of the phagemid vectors were isolated and ligated into the yeast vector to yield plasmids pBG015 and pBG022, encoding alpha-factor fused to KPI (-4 ⁇ 57; M15L, S17Y, R18H) , and KPI (-4 ⁇ 57; M15A, S17Y, R18H) , respectively.
  • Plasmid pBG015 was digested with .Xbal and RsrII, and the larger of the two resulting fragments was isolated.
  • An oligonucleotide pair (1593 + 1642) was phosphorylated, annealed and gel-purified as described previously.
  • the annealed oligonucleotides were ligated into the Xbal and RsrII-digested pBG015, and the ligation product was used to transform E. coli strain MC1061 to ampicillin resistance.
  • the resulting plasmid pBG029 encodes the 445 bp synthetic gene for the alpha-factor-KPI (-4-*57; T9V, M15L, S17F, R18H) fusion.
  • Plasmid pBG022 was digested with Xbal and RsrII, and the larger of the two resulting fragments was isolated.
  • An oligonucleotide pair (1593 + 1642) was phosphorylated, annealed and gel-purified as described previously. The annealed oligonucleotides were ligated into the Xbal and RsrII-digested pBG022, and the ligation product was used to transform E. coli strain MC1061 to ampicillin resistance.
  • the resulting plasmid pBG033, encodes the 445 bp synthetic gene for the alpha-factor-KPI (-4 ⁇ 57; T9V, M15A, S17F, R18H) fusion.
  • KPI phage were prepared and amplified by infecting transformed cells with M13K07 helper phage (Matthews and Wells, 1993) .
  • Bound phage were eluted sequentially by successive 5 minute washes: 0.5 ml 50mM sodium citrate, pH 6.0, 150mM NaCl; 0.5 ml 50mM sodium citrate, pH 4.0 150mM NaCl; and 0.5 ml 50mM glycine, pH 2.0, 150mM NaCl. Eluted phage were neutralized immediately and phagemids from the pH 2.0 elution were titered and amplified for reselection. After three rounds of selection on Xa- Sepharose, phagemid DNA was isolated and subjected to DNA sequence analysis.
  • Plasmid pTW113 encoding wild-type KPI (-4 ⁇ 57) was digested with Agrel and BamHI and the 135 bp Agrel-BamHI fragment was discarded.
  • the 135 bp Agel-Ba HI fragment of the phagemid vector was isolated and ligated into the yeast vector to yield plasmid pDD131, encoding alpha- factor fused to KPI (-4 ⁇ 57; M15L, I16F, S17K) .
  • Plasmid pDD131 was digested with Aatl and BamHI, and the larger of the two resulting fragments was isolated.
  • An oligonucleotide pair (738 + 739) was phosphorylated, annealed and gel-purified as described previously.
  • the annealed oligonucleotides were ligated into the Aatl and BamHI-digested pDD131, and the ligation product was used to transform E. coli strain MC1061 to ampicillin resistance.
  • the resulting plasmid pDD134 encodes the 445 bp synthetic gene for the alpha-factor-KPI (-4 ⁇ 57; M15L, I16F, S17K, G37Y) fusion.
  • Plasmid pDD131 was digested with Aatll and BamHI, and the larger of the two resulting fragments was isolated.
  • An oligonucleotide pair (724 + 725) was phosphorylated, annealed and gel-purified as described previously.
  • the annealed oligonucleotides were ligated into the
  • Aatll and BamHI-digested pDD131 and the ligation product was used to transform E. coli strain MC1061 to ampicillin resistance.
  • the resulting plasmid pDD135, encodes the 445 bp synthetic gene for the alpha-factor-KPI (-4-»57; M15L, I16F, S17K, G37L) fusion.
  • concentrations of active human plasma kallikrein, factor Xlla, and trypsin were determined by titration with p-nitrophenyl p' -guanidinobenzoate as described by Bender et al., supra, and Chase et al., Biochem. Biophys . Res. Commun. 29:508 (1967).
  • Accurate concentrations of active KPI(-4 ⁇ 57) inhibitors were determined by titration of the activity of a known amount of active-site-titrated trypsin.
  • each KPI(-4- * 57) variant (0.5 to lOOnM) was incubated with protease in low-binding 96-well microtiter plates at 30°C for 15-25 min, in lOOmM Tris-HCl, pH 7.5, with 500mM NaCl, 5mM KC1, 5mM CaC12, 5mMMgC12, 0.1% Difco gelatin, and 0.05% Triton X-100. Chromogenic synthetic substrate was then be added, and initial rates at 30°C recorded by the SOFTmax kinetics program via a THERMOmax microplate reader (Molecular Devices Corp., Menlo Park, CA) .
  • the substrates used were N- ⁇ -benzoyl-L-Arg p-nitroanilide
  • TW6166 are 115-fold and 100-fold more potent, respectively, as a human kallikrein inhibitor than wild- type KPI (-4-*57).
  • the least potent variant, KPI (-4 ⁇ 57; I16H, S17W) TW6185 is still 35-fold more potent than wild-type KPI.
  • the substrate was N-benzoyl-He-Glu-Gly-Arg p-nitroaniline hydrochloride and its methyl ester (obtained from Pharmacia Hepar, Franklin, OH) , and corn trypsin inhibitor (Enzyme Research Laboratories, South Bend, IN) was used as a control inhibitor.
  • Factor Xlla was also obtained from Enzyme Research Laboratories.
  • Hgb was significantly increased at 30 and 60 minutes in the control group [6.89 ⁇ 1.44 vs. 4.41 ⁇ 1.45 gm/dl

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
EP96920140A 1995-05-08 1996-05-08 Protease inhibitoren vom kunitz-type Withdrawn EP0827539A2 (de)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US43655595A 1995-05-08 1995-05-08
US436555 1995-05-08
US64373196A 1996-05-06 1996-05-06
US643731 1996-05-06
PCT/US1996/006384 WO1996035788A2 (en) 1995-05-08 1996-05-08 Kunitz type protease inhibitors

Publications (1)

Publication Number Publication Date
EP0827539A2 true EP0827539A2 (de) 1998-03-11

Family

ID=27031013

Family Applications (1)

Application Number Title Priority Date Filing Date
EP96920140A Withdrawn EP0827539A2 (de) 1995-05-08 1996-05-08 Protease inhibitoren vom kunitz-type

Country Status (6)

Country Link
EP (1) EP0827539A2 (de)
JP (1) JPH11504938A (de)
KR (1) KR19990008458A (de)
AU (1) AU5854096A (de)
CA (1) CA2220497A1 (de)
WO (1) WO1996035788A2 (de)

Families Citing this family (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5663143A (en) * 1988-09-02 1997-09-02 Dyax Corp. Engineered human-derived kunitz domains that inhibit human neutrophil elastase
US6057287A (en) 1994-01-11 2000-05-02 Dyax Corp. Kallikrein-binding "Kunitz domain" proteins and analogues thereof
YU8997A (sh) 1996-03-11 1999-09-27 Bayer Corporation Prečišćen protein koji ima serinsku proteaznu inhibitorsku aktivnost i farmaceutski preparat koji ga sadrži
AU4207499A (en) * 1998-05-28 1999-12-13 Zymogenetics Inc. Kunitz domain polypeptide and materials and methods for making it
CA2330191A1 (en) * 1998-06-03 1999-12-09 Scios, Inc. Protease inhibitor peptides
ATE477020T1 (de) 2002-06-07 2010-08-15 Dyax Corp Prevention und verringerung von ischemia
US7153829B2 (en) 2002-06-07 2006-12-26 Dyax Corp. Kallikrein-inhibitor therapies
ES2368941T3 (es) 2003-01-06 2011-11-23 Angiochem Inc. Angiopep-1, compuestos relacionados y utilizaciones correspondientes.
US7235530B2 (en) 2004-09-27 2007-06-26 Dyax Corporation Kallikrein inhibitors and anti-thrombolytic agents and uses thereof
CN104311653B (zh) * 2005-02-18 2017-12-05 安吉奥开米公司 转运化合物穿过血脑屏障的分子
BRPI0613005A8 (pt) 2005-07-15 2017-12-26 Angiochem Inc uso de polipeptídeos de aprotinina como veículos em conjugados farmacêuticos.
US9365634B2 (en) 2007-05-29 2016-06-14 Angiochem Inc. Aprotinin-like polypeptides for delivering agents conjugated thereto to tissues
EP2231702A1 (de) * 2007-12-21 2010-09-29 Ifxa A/s Proteasehemmer
RU2011118056A (ru) 2008-10-15 2012-11-27 Ангиокем Инк. Конъюгаты агонистов glp-1 и их применение
CA2745524C (en) 2008-12-05 2020-06-09 Angiochem Inc. Conjugates of neurotensin or neurotensin analogs and uses thereof
EP2385843A4 (de) 2009-01-06 2013-02-27 Dyax Corp Behandlung von mukositis mit kallikrein-hemmern
CN102510759A (zh) 2009-04-20 2012-06-20 安吉奥开米公司 利用与血管肽-2类似物结合的抗癌剂治疗卵巢癌
JP5932642B2 (ja) 2009-07-02 2016-06-08 アンジオケム インコーポレーテッド 多量体ペプチドコンジュゲートおよびその使用
CA3168591A1 (en) 2010-01-06 2011-07-14 Takeda Pharmaceutical Company Limited Plasma kallikrein binding proteins
JP2014506257A (ja) 2011-01-06 2014-03-13 ダイアックス コーポレーション 血漿カリクレイン結合タンパク質
US9687561B2 (en) 2012-08-14 2017-06-27 Angiochem Inc. Peptide-dendrimer conjugates and uses thereof
JP6823055B2 (ja) 2015-06-15 2021-01-27 アンジオケム インコーポレーテッド 軟髄膜癌腫症の治療方法
US20180362616A1 (en) * 2015-12-10 2018-12-20 The National Institute for Biotechnology in the Negev Ltd. VARIANTS OF AMYLOID beta-PROTEIN PRECURSOR INHIBITOR DOMAIN
EP3387018A1 (de) 2015-12-11 2018-10-17 Dyax Corp. Plasma-kallikrein-inhibitoren und verwendungen davon zur behandlung von hereditärem angioödem
CN110051830A (zh) * 2019-03-14 2019-07-26 苏州新凝生物医药科技有限公司 一种protease nexin II\KPI蛋白突变体的应用

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE3912638A1 (de) * 1989-04-18 1990-10-31 Bayer Ag Gentechnologisch hergestellte homologe des alzheimer protease inhibitors, wirtstaemme sowie expressionsvektoren fuer ihre herstellung und ihre verwendung als arzneimittel
IL104326A0 (en) * 1992-01-07 1993-05-13 Novo Nordisk As Variant of human kunitz-type protease inhibitor
IL104327A0 (en) * 1992-01-07 1993-05-13 Novo Nordisk As Variant of human kunitz-type protease inhibitor
US5795954A (en) * 1994-03-04 1998-08-18 Genentech, Inc. Factor VIIa inhibitors from Kunitz domain proteins

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9635788A3 *

Also Published As

Publication number Publication date
JPH11504938A (ja) 1999-05-11
WO1996035788A2 (en) 1996-11-14
KR19990008458A (ko) 1999-01-25
CA2220497A1 (en) 1996-11-14
AU5854096A (en) 1996-11-29
WO1996035788A3 (en) 1996-12-12

Similar Documents

Publication Publication Date Title
US6376648B2 (en) Protease inhibitor peptides
EP0827539A2 (de) Protease inhibitoren vom kunitz-type
EP0621871B1 (de) Inhibitorvariante der menschlichen protease vom kunitz-typ
US5780265A (en) Kunitz type plasma kallikrein inhibitors
US5550213A (en) Inhibitors of urokinase plasminogen activator
US5373090A (en) Aprotinin analogues and a process for the production thereof
JP2001521367A (ja) ヒト ビクニン
WO1993014122A1 (en) A human kunitz-type protease inhibitor variant
EP1082431A2 (de) Protease-inhibitor-peptiden
US5876971A (en) Thrombin inhibitor from the saliva of protostomia
AU2004225718B2 (en) Inhibitor proteins of a protease and use thereof
WO2007101602A9 (en) Chimeric kunitz domains and their use
JP2798573B2 (ja) ヒト好中球エラスターゼ阻害活性を有する天然型ポリペプチドおよびそれを含有する医薬製剤
TW200846356A (en) Preparation and use of variants of the kunitz domain 2 of the human placental bikunin gene

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19971110

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL PAYMENT 971110

RAX Requested extension states of the european patent have changed

Free format text: AL PAYMENT 971110;LT PAYMENT 980302;LV PAYMENT 980302;SI PAYMENT 980302

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: SCIOS INC.

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20061219