EP0804593A1 - Rekombinantes hk2 polypeptid - Google Patents

Rekombinantes hk2 polypeptid

Info

Publication number
EP0804593A1
EP0804593A1 EP95921271A EP95921271A EP0804593A1 EP 0804593 A1 EP0804593 A1 EP 0804593A1 EP 95921271 A EP95921271 A EP 95921271A EP 95921271 A EP95921271 A EP 95921271A EP 0804593 A1 EP0804593 A1 EP 0804593A1
Authority
EP
European Patent Office
Prior art keywords
leu
pro
polypeptide
val
gly
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP95921271A
Other languages
English (en)
French (fr)
Inventor
Donald J. Tindall
Charles Yu Fu Young
Mohammad S. Saedi
Kuus-Reichel
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hybritech Inc
Mayo Foundation for Medical Education and Research
Mayo Clinic in Florida
Original Assignee
Hybritech Inc
Mayo Foundation for Medical Education and Research
Mayo Clinic in Florida
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hybritech Inc, Mayo Foundation for Medical Education and Research, Mayo Clinic in Florida filed Critical Hybritech Inc
Publication of EP0804593A1 publication Critical patent/EP0804593A1/de
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6424Serine endopeptidases (3.4.21)
    • C12N9/6445Kallikreins (3.4.21.34; 3.4.21.35)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/40Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against enzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00Uses of viruses
    • C12N2799/02Uses of viruses as vector
    • C12N2799/021Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/026Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a baculovirus

Definitions

  • the glandular kallikreins are a subgroup of serine proteases which are involved in the post-translational processing of specific polypeptide precursors to their biologically active forms.
  • the human kallikrein gene family consists of three members: prostate-specific antigen, human glandular kallikrein, and pancreatic/renal kallikrein. See J.A. Clements, Endocr. Rev.. 10, 393 (1989) and T.M. Chu et al. (U.S. Patent No. 4,446,122). A common nomenclature for these members of the tissue (glandular) kallikrein gene families was recently adopted by T.
  • HSA Human Tissue Kallikrein Gene Family
  • New Previous Designa- Designa ⁇ New Protein tion tions mRNA/cDNA Protein Designation hKLKl KLK1 ⁇ HKl and tissue kalli ⁇ hKl hRKALL phKK25 krein (renal/ cDNAs pancrease sali- vaiy) hKLK2 KLK2 prostate-specific hK2 hGK-1 glandular kalli ⁇ hKK-3 krein
  • APS cDNAs The DNA sequence homology between hKLK2 and hKLK3 (exon regions) is 80%, whereas the homology between hKLK2 and hKLKl is 65%. The deduced amino acid sequence homology of hK2 to hKl is 57%. Amino acid sequences deduced by L.J. Schedlich et al., DNA. 6, 429 (1987) and BJ. Morris, Clin. Exp. Pharmacol. Physiol. 16_, 345 (1989) indicate that hK2 may be a trypsin-like serine protease, whereas hK3 (PSA) is a chymotrypsin-like serine protease. Therefore, if hK2 is indeed secretory, it may have a different physiological function than hK3.
  • the hKLK2 gene is located about 12 kbp downstream from the hKLK3 gene in a head-to-tail fashion on chromosome 19.
  • the similarities of gene structure and deduced ⁇ irnino acid sequences of these human kallikreins suggest that their evolution may involve the same ancestral gene.
  • both hK2 and hK3 may be expressed only in the human prostate, while expression of hKl is limited to the pancreas, submandibular gland, kidney, and other nonprostate tissues.
  • Tremendous interest has been generated in hK3 (PSA) because of the important role it plays as a marker to detect and to monitor progression of prostate carcinoma. Its usefulness as a marker is based on the elevated serum concentration of circulating hK3 proteins which are frequently associated with prostatic cancer. The serum concentration of hK3 has been found to be proportional to the cancer mass in untreated patients, but is also proportional to the volume of hyperplastic tissue in patients with benign prostatic hyperplasia (BPH). The serum levels of hK3 become reduced following prostate cancer therapy.
  • hK2 polypeptide includes pre-pro hK2, pro hK2 and mature hK2 polypeptides.
  • Pre-pro hK2 is secreted by the cell in vivo, and is cleaved during secretion to yield pro hK2, which is then enzymatically cleaved in the extracellular environment to yield "mature" hK2.
  • the hK2 polypeptide is contiguous in amino acid sequence with SEQ ID NO: 16, SEQ ID NO: 6 or SEQ ID NO: 10.
  • the present invention also provides isolated nucleic acid molecules encoding hK2 polypeptide, including (a) a cDNA molecule comprising the nucleotide sequence of the coding region of the hK2 gene; (b) a DNA molecule capable of hybridizing under stringent conditions to a nucleotide sequence complementary to the nucleotide sequence of (a); and (c) a genetic variant of any of the DNA molecules of (a) and (b) which encodes of polypeptide processing an antigenicposition of naturally occurring hK2 polypeptide.
  • the nucleic acid comprises a discrete, isolated DNA or RNA molecule encoding the complete hK2 polypeptide, which can include the pre-pro, pro or mature forms.
  • the nucleic acid is a DNA sequence contiguous with SEQ ID NO: 5, 7 or 9, i.e., as shown in Figs. 5, 6 or 7.
  • SEQ ID NO: 5, 7 or 9 i.e., as shown in Figs. 5, 6 or 7.
  • PCR polymerase chain reaction
  • novel oligonucleotide primers employed in the synthesis are also an embodiment of the invention.
  • the nucleic acid sequence also can comprise a promoter operably linked to the nucleic acid sequence. Therefore, the invention also comprises a chimeric expression vector comprising the above-described nucleic acid sequence, operationally linked to control sequences recognized by a host cell transformed with the vector, as well as said transformed host cell, and methods of its preparation and use to produce recombinant hK2.
  • the present invention also provides a method of using a nucleic acid molecule, such as a cDNA clone encoding hK2 polypeptide, comprising expressing the nucleic acid molecule in a cultured host cell transformed, preferably stably transformed, with a chimeric expression vector comprising said nucleic acid molecule operably linked to control sequences recognized by the host cell transformed with the vector; and recovering the hK2 polypeptide from the transgenic host cell, i.e., from the culture medium.
  • the term "chimeric" means that the vector comprises DNA from at least two different species, or comprises DNA from the same species, which is linked or associated in a manner which does not occur in the "native" form of said species.
  • E. coli and baculovirus insect cells systems have been employed to produce hK2 polypeptides in two forms, i.e. pre-pro hK2 (pphK2) and mature hK2 (mhK2).
  • pphK2 pre-pro hK2
  • mhK2 mature hK2
  • the present invention provides the first example of the overexpression of hK2 in heterologous systems.
  • pphK2 produced in E. coli has proven to be an invaluable resource for generating antibodies to the denatured form of the protein, it is desirable to both discern the steps involved in the biosynthesis of hK2 and to obtain antibodies specific for the folly processed and secreted form of the protein. Therefore, niammalian cell systems have been employed to produce hK2 polypeptides.
  • the present invention also provides the first example of the expression of hK2 in ⁇ ___mmalian cells and purification and ch___acterization of the secreted protein.
  • the high degree of amino acid sequence homology of hK2 with hK3 indicates that measuring serum concentrations of both proteins may be useful in the diagnosis and monitoring of prostate cancer.
  • the antibodies developed against hK3 now used in these assays could theoretically also recognize hK2, because of mutual contamination in the antigenic preparations used to develop the anti-hK3 antibodies or because of antibody cross-reactivity between these two proteins. This could account for the substantial percentage of false positive results which are observed in current hK3 assays.
  • hK2 polypeptide, as well as variants and subunits thereof, produced by the present method can be used to produce populations of antibodies that, in turn, can be used as the basis for assays to detect and quantify hK2 polypeptide (or "protein") in samples derived from tissues such as prostate carcinomas, cells such as prostate cell lines, or from fluids such as seminal fluid or blood.
  • the present invention also provides populations of monoclonal or polyclonal antibodies that specifically bind to hK2 polypeptide, while not significantly binding to hK3.
  • the term "significantly" is defined by reference to the comparative assays discussed below. These antibodies can also be used in affinity chromatography, to purify mammalian hK2 from natural sources.
  • the isolated, substantially homogeneous hK2 can also be employed as a component in diagnostic assays for "native" hK2 in samples derived from human tissues or physiological fluids.
  • the recombinant hK2 can be bound to a detectable label and employed in competitive immunoassays for hK2, as described in U.S. patent application Serial No. 08/096,946, filed July 22, 1993.
  • hK2 polypeptide As used herein with respect to the present invention, the terms "hK2 polypeptide,” “hK2 protein,” and “hK2” are considered to refer to identical human materials, unless otherwise indicated.
  • Figure 1 depicts a time course study of recombinant pphK2 in s 9 cells infected with recombinant pphK2 virus. At each of the time points cells were depleted of methionine and cysteine for 1 hour in deficient media and then supplemented with [ 35 S]-methione and [ 35 S]-cysteine. Protein was determined by Bradford assay. Aliquots of protein (20 ⁇ g) were loaded onto a 12% Tris-Glycine SDS gel. A Phosphorimager cassette was exposed overnight. The band of interest is indicated with an arrow, w. : wild type.
  • Figure 2 depicts the detection of recombinant mhK2 in cell lysate fractions.
  • S 9 cells were infected either with recombinant mhK2, wild type or left uninfected for 48 hours. Methionine and cysteine pools were depleted for 1 hour in deficient media. Cells were supplemented with [ 35 S]- methionine and [ 35 S]-cysteine for 6 hours. Cells were separated into soluble and insoluble fractions using H 2 0 and repeated freeze thaw conditions. Aliquots of protein (50 ⁇ g per lane) were loaded onto a 10% Tris-Glycine SDS gel and electrophoresed. The gel was dried and exposed to x-ray film for 2 days. The band of interest is indicated with an arrow.
  • FIG. 3 depicts the expression of recombinant pphK2 in E. coli.
  • E. coli _rtrain BL21 (DE3) LysS harboring pBppHK2 was grown in LB media to O.D.goo 0.2 and incubated without (lane 2, not-induced (N)) or with (lane 3, induced (I)) 0.4 M IPTG for 2 hrs.
  • Cells were lysed in sample buffer and subjected to SDS/PAGE on a 4-20% gradient gel. Protein bands were visualized by srtaining the gel with Coomassie blue.
  • Figure 4 depicts the ⁇ imino acid sequences of mature hK2 (deduced from cDNA sequence, SEQ ID NO: 16) and hK3 (SEQ ID NO: 1). Underlined sequences denote nonhomologous regions that can be used for preparation of antibodies specific to hK2.
  • Figure 5 depicts pphK2 cDNA containing a BamHl site at the 5' end and a Pstl site at the 3' end (SEQ ID NO: 5) (coding strand is numbered) as well as the amino acid sequence of pre-pro hK2 encoded thereby (SEQ ID NO: 6).
  • the amino acid sequences of pro hK2 and mature hK2 are also shown on the Figure.
  • Figure 6 depicts mhK2 cDNA containing an EcoRl site at the 5' end and Pstl site at the 3' end (SEQ ID NO: 7), as well as the corresponding amino acid sequence (SEQ ID NO: 8) which encompasses the amino acid sequence of mhK2 polypeptide.
  • Figure 7 depicts pro hK2 DNA (SEQ ID NO: 9) (coding strand is numbered) and the amino acid sequence of pro hK2 (SEQ ID NO: 10).
  • Figure 8 depicts a gel coirfirming the expression of recombinant pphK2 in a mammalian cell line.
  • the sample was applied in a bicarbonte buffer, pH 8 and eluted with a salt gradient.
  • the solid line is the A 280 elution profile.
  • the triangle line represents the ELISA assay of individual samples which had been dried onto microtiter plates and developed with rabbit anti-hK2 antibody.
  • Figure 10 depicts the hydrophobic interaction profile of DEAE fractions. The fractions were pooled, concentrated and applied to an HIC column in 1.2 M sodium sulfate, and eluted with a decreasing salt gradient.
  • the solid line is A 280 and the triangle line shows the EUSA assay profile of the fractions using rabbit anti-hK2 antibody.
  • Figure 11 depicts the Size Exclusion Chromatography of HIC purified prohK2, in particular, the A 280 profile of 22 min peak eluted off HIC column. The 19.4 min peak appears homogeneous by SDS-PAGE. After this peak was lyophilized, the N-teirninal sequence and amino acid composition confirmed its identity as the pro form of hK2.
  • Figure 12 depicts the SDS/PAGE analysis of prohK2 and PSA.
  • hK2 polypeptide preferably encompasses the recombinant pre-pro, pro and niature hK2 polypeptides.
  • a mature hK2 polypeptide having the amino acid sequence shown in Fig. 4 (SEQ ID NO: 16), as well as "variant" polypeptides which share at least 90% homology with SEQ ID NO: 16 in the regions which are substantially homologous with hK3, i.e., which regions are not identified by bars as shown in Fig. 4.
  • Such hK2 polypeptides also possess antigenic function in common with the mature hK2 molecule of Fig.
  • polypeptides are also definable by antibodies which bind specifically thereto, but which do not cross-react with hK3 (or hKl).
  • said antibodies react with antigenic sites or epitopes that are also present on the mature hK2 molecule of Fig. 4.
  • Antibodies useful to define common antigenic function are described in detail in Ser. No. 08/096,946, i.e., polyclonal antisera prepared in vivo against hK2 submit 41-56.
  • isolated hK2 nucleic acid is RNA or DNA containing greater than 15, preferably 20 or more, sequential nucleotide bases that encode a biologically active hK2 polypeptide or a variant fragment thereof, that is complementary to the non-coding strand of the native hK2 polypeptide RNA or DNA, or hybridizes to said RNA or DNA and remains stably bound under stringent conditions.
  • the RNA or DNA is isolated in that it is free from at least one contaminating nucleic acid with which it is normally associated in the n ⁇ itural source and is preferably substantially free of any other mammalian RNA or DN
  • the phrase "free from at least one contaminating source nucleic acid with which it is normally associated” includes the case where the nucleic acid is reintroduced into the source or natural cell but is in a different chromosomal location or is otherwise flanked by nucleic acid sequences not normally found in the source cell.
  • isolated hK2 nucleic acid is RNA or DNA that encodes a biologically active hK2 polypeptide sharing at least 90% sequence identity with the hK3-homologous regions of the hK2 peptide of Fig. 4, as described above.
  • isolated, substantially homogenous as used with respect to an hK2 polypeptide is defined in terms of the methodologies discussed herein below.
  • recombinant nucleic acid refers to a nucleic acid, i.e., to DNA that has been derived or isolated from any appropriate tissue source, that may be subsequently chemically altered in vitro, an later introduced into target host cells, such as cells derived from animal, plant, insect, yeast, fungal or bacterial sources.
  • target host cells such as cells derived from animal, plant, insect, yeast, fungal or bacterial sources.
  • An example of recombinant DNA "derived” from a source would be a DNA sequence that is identified as a usefol fragment encoding hK2, or a fragment or variant thereof, and which is then chemically synthesized in essentially pure form.
  • DNA "isolated" from a source would be a useful DNA sequence that is excised or removed from said source by chemical means, e.g, by the use of restriction endonucleases, so that it can be further manipulated, e.g., amplified, for use in the invention, by the methodology of genetic engineering.
  • recombinant DNA includes completely synthetic DNA sequences, semi-synthetic DNA sequences, semi-synthetic DNA sequences, DNA sequences isolated from biological sources, and DNA sequences derived from introduced RNA, as well as mixtures thereof.
  • the recombinant DNA sequence is not originally resident in the genome of the host target cell which is the recipient of the DNA, or it is resident in the genome but is not expressed.
  • the recombinant DNA sequence used for transformation herein, may be circular or linear, double-stranded or single-stranded.
  • the DNA sequence is in the form of chimeric DNA, such as plasmid DNA, that can also contain coding regions flanked by control sequences which promote the expression of the recombinant DNA present in the resultant cell line.
  • the recombinant DNA may itself comprise a promoter that is active in mammalian cells, or may utilize a promoter already present in the genome that is the tr ⁇ uisfo ⁇ nation target.
  • promoters include the CMV promoter, as well as the SV 40 late promoter and retroviral LTRs (long teiminal repeat elements).
  • a portion of the recombinant DNA may be untranscribed, serving a regulatory or a sfructural function.
  • Control sequences is defined to mean DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism.
  • the control sequences that are suitable for prokaiyotic cells include a promoter, and optionally an operator sequence, and a ribosome binding site.
  • Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.
  • "Operably linked” is defined to mean that the nucleic acids are placed in a functional relationship with another nucleic acid sequence.
  • DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation.
  • "operably linked" means that the DNA sequences being linked are contiguous and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accord with conventional practice.
  • a portion of the recombinant DNA may be untranscribed, serving a regulatory or a stmctural function.
  • the recombinant DNA to be introduced into the cells further will generally contain either a selectable marker gene or a reporter gene or both to facilitate identification and selection of transformed cells from the population of cells sought to be transformed.
  • the selectable marker may be carried on a separate piece of DNA and used in a co- tr_u_sformation procedure.
  • Both selectable markers and reporter genes may be flanked with appropriate regulatory sequences to enable expression in the host cells.
  • Usefol selectable markers are well known in the art and include, for example, antibiotic and herbicide-resistance genes, such as nee, hpt, dhfr. bar, aro dapA and the like.
  • Reporter genes are used for identifying potentially transformed cells and for evaluating the functionality of regulatory sequences. Reporter genes which encode for easily assayable proteins are well known in the art.
  • a reporter gene is a gene which is not present in or expressed by the recipient organism or tissue and which encodes a protein whose expression is manifested by some easily detectable property, e.g., erizymatic activity.
  • Preferred genes include the chloramphenicol acetyl transferase gene (cat) from Tn9 of E. coli. the beta-glucuronidase gene (gus) of the uidA locus of E. coli. and the luciferase gene from firefly Photinus pyralis. Expression of the reporter gene is assayed at a suitable time after the DNA has been introduced into the recipient cells.
  • elements functional in the host cells such as introns, enhancers, polyadenylation sequences and the like, may also be a part of the recombinant DNA Such elements may or may not be necessary for theterio of the DNA, but may provide improved expression of the DNA by affecting transcription, stability of the mRNA, or the like. Such elements may be included in the DNA as desired to obtain the optimal performance of the trarisfor ing DNA in the cell.
  • the recombinant DNA can be readily introduced into the target cells by transfection with an expression vector comprising cDNA encoding hK2, for example, by the modified calcium phosphate precipitation procedure of C. Chen et al., Mol. Cell. BioL 2, 2745 (1987). Transfection can also be accomplished by lipofectin, using commercially available kits, e.g., provided by BRL.
  • Suitable host cells for the expression of hK2 polypeptide are derived from multicellular organisms. Such host cells are capable of complex processing and glycosylation activities. In principle, any higher eukaryotic cell culture is workable, whether from vertebrate or invertebrate culture. Examples of invertebrate cells include plant and insect cells.
  • a variety of viral strains for transfection are publicly available, e.g., the L-1 variant of Autographa calif omicaNPW and the Bm-5 strain of Bombyx mori NPV, and such viruses may be used, preferably for transfection of Spodopterafrugiperda cells.
  • Recovery or isolation of a given fragment of DNA from a restriction digest can empoly separation of the digest on polyacrylamide or agarose gel by electrophoresis, identification of the fragment of interest by comparison of its mobility versus that of marker DNA fragments of known molecular weight, removal of the gel section containing the desired fragment, and separation of the gel from DNA.
  • DNA DNA sequence
  • Southern analysis or “Southern blotting” is a method by which the presence of DNA sequences in a restriction endonuclease digest of DNA or DNA- ⁇ ntaining composition is confirmed by hybridization to a known, labeled oligonucleotide or DNA fragment.
  • Southern analysis typically involves electrophoretic separation of DNA digests on agarose gels, denaruration of the DNA after electrophoretic separation, and transfer of the DNA to nitrocellulose, nylon, or another suitable membrane support for analysis with a radiolabeled, biotinylat ⁇ d, or enzyme-labeled probe as described in sections 9.37-9.52 of Sambrook et al., supra.
  • RNA sequences that hybridize to a known probe such as an oligonucleotide, DNA fragment, cDNA or fragment thereof, or RNA fragment.
  • the probe is labeled with a radioisotope such as 32-P, by biotinylation or with an enzyme.
  • the RNA to be analyzed can be usually electrophoretically separated on an agarose or polyacrylamide gel, transferred to nitrocellulose, nylon, or other suitable membrane, and hybridized with the probe, using standard techniques well known in the art such as those described in sections 7.39-7.52 of Sambrook et al., supra
  • PCR Polymerase chain reaction
  • RNA and/or DNA are amplified as described in U.S. Patent No. 4,683,195.
  • sequence Mormation from the ends of the region of interest or beyond is employed to design oligonucleotide primers. These primers will be identical or similar in sequence to opposite strands of the template to be amplified.
  • PCR can be used to amplify specific RNA sequences, specific DNA sequences from total genomic DNA, and cDNA transcribed from total cellular RNA, bacteriophage or plasmid sequences, and the like. See generally Mullis et al., Cold Spring Harbor Symp. Quant. Biol, 51, 263 (1987); Erlich, ed., PCR Technology, (Stockton Press, NY, 1989).
  • “Stringent conditions” are those that (1) employ low ionic strength and high temperature for washing, for example, 0.015 M NaCl/0.0015 M sodium citrate (SSC); 0.1% sodium lauryl sulfate (SDS) at 50°C, or (2) employ during hybridization a denaturing agent such as fo ⁇ riamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin/0.1%> Ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42°C.
  • SSC 0.015 M NaCl/0.0015 M sodium citrate
  • SDS sodium lauryl sulfate
  • Another example is use of 50%) formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 ⁇ gfoil), 0.1% SDS, and 10% dextran sulfate at 42°C, with washes at 42°C in 0.2 x SSC and 0.1% SDS.
  • hK2 polypeptide is expressed in a recombinant cell other than one of human origin, the hK2 polypeptide is completely free of proteins or polypeptides of human origin.
  • hK2 polypeptide it is necessary to purify hK2 polypeptide from recombinant cell proteins or polypeptides to obtain preparations that are substantially homogeneous as to hK2 polypeptide.
  • the culture medium or lysate can be centrifoged to remove particulate cell debris.
  • the membrane and soluble protein fractions are then separated.
  • the hK2 polypeptide may then be purified from the soluble protein fraction and, if necessary, from the membrane fraction of the culture lysate.
  • HK2 polypeptide can then be purified from contaminant soluble proteins and polypeptides by fractionation on immiinoaffinity or ion-exchange columns; ethanol precipitation; reverse phase HPLC; chromatography on silica or on a cation-exchange resin such as DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; gel filtration using, for example, Sephadex G-75; or ligand affinity chromatography.
  • amides of the hK2 polypeptides of the present invention may also be prepared by techniques well known in the art for converting a carboxylic acid group or precursor, to an amide.
  • a preferred method for amide formation at the C-temiinal carboxyl group is to cleave the polypeptide from a solid support with an appropriate amine, or to cleave in the presence of an alcohol, yielding an ester, followed by aminolysis with the desired amine.
  • Salts of carboxyl groups of the hK2 polypeptide may be prepared in the usual manner by contacting the peptide with one or more equivalents of a desired base such as, for example, a metallic hydroxide base, e.g., sodium hydroxide; a metal carbonate or bicarbonate base such as, for example, sodium carbonate or sodium bicarbonate; or an amine base such as, for example, triethylamine, trieth ⁇ molamine, and the like.
  • a desired base such as, for example, a metallic hydroxide base, e.g., sodium hydroxide
  • a metal carbonate or bicarbonate base such as, for example, sodium carbonate or sodium bicarbonate
  • an amine base such as, for example, triethylamine, trieth ⁇ molamine, and the like.
  • N-acyl derivatives of an amino group of the present polypeptides may be prepared by utilizing an N-acyl protected amino acid for the final condensation, or by acylating a protected or unprotected peptide.
  • O- acyl derivatives may be prepared, for example, by acylation of a free hydroxy peptide or peptide resin. Either acylation may be carried out using standard acylating reagents such as acyl halides, anhydrides, acyl imidazoles, and the like. Both N- and 0-acylation may be carried out together, if desired.
  • the invention can be modified by substituting one or two conservative amino acid substitutions for the positions specified, including substitutions which utilize the D rather than L form.
  • the invention is also directed to variant or modified forms of the hK2 polypeptide of Fig. 4.
  • One or more of the residues of this polypeptide can be altered, so long as antigenic function is retained.
  • Conservative amino acid substitutions are preferred-that is, for example, aspartic-glutamic as acidic amino acids; lysine arginine histidine as basic amino acids; leucine/ isoleucine, meth onine/valine as hydrophobic amino acids; serine/glycme/alanine threonine as hydrophilic amino acids.
  • Acid addition salts of the polypeptides may be prepared by contacting the polypeptide with one or more equivalents of the desired inorganic or organic acid, such as, for example, hydrochloric acid.
  • Esters of carboxyl groups of the polypeptides may also be prepared by any of the usual methods known in the art.
  • hK2 polypeptide and its antigenically active variants, derivatives and fragments thereof can be used in assays for hK2 in samples derived from biological materials suspected of containing hK2 or anti-hK2 antibodies, as disclosed in detail in Serial No. 08/096,946.
  • the hK2 polypeptide can be labelled with a detectable label, such as via one or more radiolabelled peptidyl residues, and can be used to compete with endogenous hK2 for binding to anti-hK2 antibodies, i.e., as a "capture antigen" to bind to anti-hK2 antibodies in a sample of a physiological fluid, via various competitive immunoassay format for hK2 which uses immobilized anti-hK2 antibodies is carried out by:
  • step (f) detem ⁇ iing from the result in step (e) the presence or amount of said hK2 in said sample.
  • a known amount of anti- hK2 antibody is added to a sample containing an unknown amount of endogenous hK2.
  • the known amount is selected to be less than the amount required to complex all of the hK2 suspected to be present, e.g., that would be present in a sample of the same amount of physiological fluid obtained from a patient known to be prostate cancer.
  • a known amount of the hK2 polypeptide of the invention or a subunit thereof, comprising a detectable label is added.
  • endogenous hK2 is present in the sample, fewer antibodies will be available to bind the labelled hK2 polypeptide, and it will remain free in solution. If no endogenous hK2 is present, the added labelled polypeptide will complex with the added anti-hK2 antibodies to form binary complexes. Next, the binary antibody-antigen complexes are precipitated by an anti- mammal IgG antibody (sheep, goat, mouse, etc.). The amount of radioactivity or other label in the precipitate (a ternary complex) is inversely proportional to the amount of endogenous hK2 that is present in the sample, e.g., a pellet containing reduced amounts of radioactivity is indicative of the presence of endogenous hK2.
  • monoclonal antibodies against hK2 polypeptide can be prepared using known hybridoma cell culture techniques.
  • this method involves prepared an antibody-producing fused cell line, e.g., of primary spleen cells fused with a compatible continuous line of myeloma cells, and growing the fused cells either in mass culture or in an animal species from which the myeloma cell line used was derived or is compatible.
  • Such antibodies offer many advantages in comparison to those produced by inoculation of animals, as they are highly specific and sensitive and relatively "pure” immunochemically.
  • Immunologically active fragments of the present antibodies are also within the scope of the present invention, e.g., the f(ab) fragment, as are partially humanized monoclonal antibodies.
  • a cDNA (approximately 820 bp long) encoding the entire prepro-hK2 (pphK2) (from nucleotide #40 to #858 relative to the start site of the pphK2 transcript), as shown in Fig. 5, was synthesized from RNA of human BPH tissue using reverse-transcription polymerase chain reaction (RT- PCR) technology with a pair of hK2 specific oligonucleotide primers (S'ACGCGGATCCAGCATGTGGGACCTGGTTCTCTS' SEQ ID NO: 2 and 5 * ACAGCTGCAGTTTACTAGAGGTAGGGGTGGGAC 3' SEQ ID NO:3).
  • RT- PCR reverse-transcription polymerase chain reaction
  • This cDNA was generated such that 5' and 3' ends (with respect to pphK2 sense sequence) were bracketed with BamHl and Pst 1 sequences respectively.
  • the cDNA was then purified by agarose gel electrophoresis, and digested with BamHl and Pst 1 restriction enzymes.
  • the restricted cDNA was ligated with the BamHl-Pst 1 digested pVL1393 plasmid vector and transformed into the E. coli HB101 strain.
  • E. coli harboring pphK2 cDNA/pVL1393 plasmid vector were selected and verified by restriction enzyme mapping and DNA sequencing. Plasmid pphK2 cDNA/pVL1393 was mass-produced in E.
  • cDNA encoding the mature hK2 was synthesized using PCR with the aforementioned pphK2 cDNA as the template plus a pair of hK2 oligonucleotides (S'ACGCGGATCCAGCATGTGGGACCTGGTTCTCTS' SEQ ID NO: 2 and 5'ACCGGAATTCATGATTGTGGGAGGCTGGGAGTGT3' SEQ ID NO: 4).
  • the 3' end oligonucleotide was the same 3' end oligonucleotide used for synthesizing the pphK2 cDNA.
  • the 5' end oligonucleotide was different from the 5' oligonucleotide used for the pphK2 cDNA, and therefore generates a cDNA coding for the mature form of hK2 (mhK2), as shown in Fig. 6.
  • the mhK2 cDNA was bracketed with EcoRl and Pstl sequences at the 5' and 3' ends respectively.
  • the protein produced from the mhK2 cDNA will gain an exogenous methionine at its N-te ⁇ __ ⁇ inus.
  • the mhK2/pVL1393 vector was generated and purified as described for pphK2/pVL1393.
  • pphK2/pVL1393 or mhK2/pVL1393 DNA (2 ⁇ g) were cotransfected with a linearized Baculogold DNA (0.5 ⁇ g; Pha ⁇ ningen, San Diego, CA) into S ⁇ insect cells according to Pharmingen instructions (S. Gruenwold et al., baculovirus expression vector system: Procedures and Methods Manual, Pharmingen, San Diego, CA (1993)).
  • __ ⁇ 9 cell spent medium containing viral particles was harvested and used to infect fresh 1 ⁇ 9 cells to amplify viral titers.
  • Total RNA was isolated for Northern blot analysis of authentic pphK2 or mhK2 transcript using hK2 cDNA as a probe. Further proof of pphK2 or mhK2 transcript expressed in recombinant virus infected S j 59 cells was obtained by RT-PCR and DNA sequencing. Pure recombinant baculovirus containing pphK2 or mhK2 were obtained by secondary or tertiary plaque purification protocol according to instructions from Phamiingen (S. Gruenwold et al., cited above).
  • a 0.8 kb fragment representing the entire preprohK2 (pphK2) coding sequence was generated by polymerase chain reaction (PCR) using primers A (5 ATACATATGTGGGACCTGGTTCTCTCC3 * SEQ ID NO.: 11) and B (S'ATATGGATCCTCAGGGGTTGGCTGCGATGGTS' SEQ ID NO: 12) and plasmid pVL1393 containing pphK2 as the template.
  • the pphK2 bacterial expression vector (pBPPHK2) was prepared by standard DNA cloning technology, (Sambrook, cited above), to subclone this 0.8 kb fragment into the Ndel/BamHl site of the plasmid pPHS579 (a gift from Dr.
  • a 0.8 kb fragment representing the entire preprohk2 (pphK2) coding sequence was generated by PCR using primers A(5'ATATGGATCCATATGTCAGCATGTGGGACCTGGTTCTCTCCA3') (SEQ ID NO: 17) and
  • the mammalian expression vector (pGThK2) was prepared using standard DNA cloning technology (Sambrook, 1989), to clone this 0.8 kb fragment into the Bel 1 site of the plasmid pGT-d (a gift from Dr. Brian Grinnell, Eli Lilly, Inc.) under control of the GBMT promotor.
  • PCR AV12-664 ATCC CR___ ⁇ 9595
  • D10F fetal bovine serum
  • S 9 cells (7xl0 6 /plate) were seeded onto 100 mm Corning plates with 10% fetal calf serum - Graces medium at room temperature for 1 hr. After attachment on culture plates, cells were infected with wild type or recombinant baculovirus in serum free Excell-400 medium and incubated at 27°C. Control cells were grown in the absence of virus.
  • sample buffer U.K. Laemmli, Nature. 227. 680 (1970)
  • sample buffer U.K. Laemmli, Nature. 227. 680 (1970)
  • Northern blot analysis was routinely used to screen and isolate clonal recombinant baculoviruses expressing pphK2 or mhK2 mRNA.
  • a comparison of the corresponding lanes in both autoradiographs of the Northern blot and photographs of ethidium bromide staining of RNA shows that mRNA for pphK2 or mhK2 was present in recombinant virus infected S 9 but not in wild type virus-infected cells.
  • each of the pphK2 or mhK2 mRNA positive lanes represents RNA isolated from S 9 cells infected with recombinant viruses derived from a single viral plaque.
  • the protein was detected in cytosol when subcellular fractions (cytosol vs. insoluble fraction) was prepared by lysing cells with H 2 0 and freeze-thaw, whereas this 28 KD protein was detected in insoluble fraction when prepared by a detergent buffer and freeze-thaw (data not shown).
  • the mhK2 protein was also expressed in the insect cell S[9, 35 S- labeling of de novo synthesized protein was performed. As seen in the autoradiograph (Fig. 2), a unique protein (about 28 KDa) was found in the insoluble fraction of mhK2-recombinant virus-infected S9 cells at 48 hours post-infection. This band was missing in uninfected cells or cells infected with wild type virus.
  • the viral polyhedron protein (about 32 KDa) was found in wild type virus-infected cells, whereas it was not expressed in cells infected with recombinant virus (Fig. 1). When the cytosol fraction was examined, no 28 KDa band was observed.
  • Plasmid pBPPHK2 was transformed into E. coli BL21 (DE3) pLysS (Novagen, Inc., Madison, WI). This strain contains a chromosomal copy of T7 RNA polymerase under the control of inducible LacUV5 promoter. Upon addition of IPTG (isopropyl- ⁇ -D-thiogalactopyranoside) the expression of the T7 RNA polymerase is induced which in turn activates the T7 promoter resulting in overproduction of the gene product under control of this promoter. To determine whether the product of the ppHK2 gene would be expressed from pBPPHK2, single colonies of BL21 E.
  • Lysozyme (4 mg/ml) was added to this suspension (at 1 ml/gm cell pellet) and the suspension was stirred at r.t. for 30 min followed by incubation on ice for 30 min. The suspension was sonicated for 2 min at 150 watts and centrifoged at 3000xg to isolate the inclusion bodies. Inclusion bodies were resuspended in running buffer (25 mM Tris, 192 mM glycine, 0.1% SDS) and after centrifogation both the pellet and the supernatant were analyzed by SDS/PAGE. About 90% of the pphK2 was found to be in the supernatant fraction which indicated that pphK2 is soluble in 0.1% SDS.
  • Plasmid pGThK2 was transformed into hamster cell line AV12- 664 (ATCC-CRL-9595). To determine whether the product of the ppHK2 gene would be expressed from pGThK2, AV12-pGThK2 #2 was grown in D10F + 200nM MTX. At about 60% confluency the cells were washed with Hank's balanced salt solution and resuspended in serum-free HH4 medium. The spent medium was collected after 7 days (serum-free spent medium) and stored at -20°C.
  • Figure 8 depicts a SDS-PAGE coiifirming expression of recombinant pphK2 in a m___r ⁇ malian cell line.
  • AV12-pGThK2 (Lane 4-6) and AV12-pGT-d (Lane 3) clonal cell lines were grown in D10F media. About 300 ⁇ l of spent medium from the above clones were concentrated and subjected to SDS/PAGE along with See Blue MW marker (lane 1) and pphK2 lysate from E. coli cells (lane 2). The gel was blotted onto nitrocellulose paper and immunoblotted using a 1/1000 dilution of anti-pphK2 rabbit antiserum. HRP-goat anti-rabbit was used as the secondary probe and the blot was developed by DAB plus H 2 0 2 . Lane 3 (AV12- ⁇ GT-d) is AV12 transfected with vector without insert.
  • the serum-free spent medium was concentrated from 5-10 fold by ultrafiltration with a 10 kDa molecular weight cutoff membrane then dialyzed overnight at 4°C versus 50 mM sodium bicarbonate, pH 8.
  • Samples were filtered with 0.2 ⁇ filters and then pumped directly onto a TSK DEAE-5PW HPLC column (21 mm X 150 mm) at a flow rate of 5 mlVmin.
  • Buffer A contained 50 mM sodium bicarbonate
  • Buffer B contained 50 mM sodium bicarbonate plus 0.5 M sodium chloride, pH 7.6.
  • the elution profile shown in Figure 9 was developed with a gradient from 0-50% Buffer B over 35 min; 50-100% B from 35-40 min and isocratic elution at 100% B for 5 min before re-equilibration in Buffer A.
  • the flow rate was 5r__I min throughout.
  • DEAE fractions were assayed for the presence of hK2 by ELISA using rabbit anit-pphK2 as primary antibodies.
  • the ELISA assayed showed a peak of hK2 activity which eluted at approximately 0-2M NaCl (shown as the triangle line in Figure 9), which correlated well with the appearance of a 34 kDa band of protein seen by SDS-PAGE in the same fractions (data not shown).
  • the elution gradient was 0-20% B over 5 min; 20- 55%) B from 5-20 min, isocratic at 55% B from 20-23 min, 55-100% B from 23-25 min; isocratic at 100%) B for 2 min before re-equilibration Buffer A.
  • the flow rate was 0.7 mL/min. Greater than 90% of the A ⁇ was not retained on HIC column. The main peak retained on HIC, which eluted at 22 min, also showed the highest peak of activity by ELISA assay (triangle line, Figure 10).
  • HIC fractions which tested positive for hK2 on ELISA were pooled, ultrafilter concentrated as above to a volume less than 1 mL then injected on a 10/30 Pharmacia S12 size exclusion column equilibrated in 100 mM ammonium acetate. The flow rate was 0.7 ml-Vmin.
  • 22 min peak from HIC was resolved by size exclusion chromatography, typically about 80-90%) of the protein A 280 eluted at 19.4 min, a retention time consistent with a protein of approximately 34 kDa ( Figure 11).
  • the only other protein peak on SEC, eluting at 16.7 min corresponded to an about 70KDa protein seen also in previous purification steps.
  • Recombinant phK2 is recognized by rabbit anti-pphK2, rabbit anti-PSA and a murine monoclonal antibody directed against a polypeptide covering amino acids 41-56 of hK2, when analyzed on WESTERN blots or when dried down on microtiter plates.
  • phK2 was not detectable by these antibodies in sandwich assays.
  • These results further demonstrate that the phK2 and PSA are conformationally different and the antibodies currently available to PSA or hK2 can not detect phK2 in its native form.
  • phK2 was not detectable by the Tandem R or free-PSA assays (immunological assays for detection of PSA in serum).
  • pphK2 for rabbit immunization, the inclusion bodies obtained from bacterial cultures of BL21 (pBpphK2) after IPTG induction as in Example 4B were resuspended in lOO ⁇ l SDS/PAGE sample buffer/ml bacterial culture and electrophoresed on preparative SDS/PAGE.
  • the pphK2 band was excised and electroeluted from the gel into ninning buffer (25mM Tris, 192 mM glycine, 0.1% SDS) and used as the immunogen.
  • the antiserum contained antibodies highly specific for the pphK2 protein since a protein band at about 28kd corresponding to pphK2 was recognized only in the induced lysate.
  • the antiserum also recognized the purified pphK2 fttrther showing the specificity of the antibodies to pphK2.
  • the above data demonstrate that the antibodies recognize the prepro-form of hK2.
  • mhK2 hK2
  • GST-mhK2, 58kd glutathione S-transferase fusion protein
  • the cell lysate was immunoblotted using anit-pphK2 rabbit antiserum. It was evident that anti-pphK2 antiserum recognized the GST-mkK2, demonstrating that antibodies were at least in part against the mature region of pphK2.
  • seminal fluid was prepared from pooled semen as described by Sensabaugh and Blake, J. Urology. 149.
  • the antibodies cross-reacting to PSA were absorbed out of the antiserum by a PSA affinity resin.
  • 1ml of the sera was diluted with lmL 100 mM HEPES, pH. 7.5 and incubated with native PSA-bound Affigel-10 for 3.5 hours at 4°C.
  • the mixture was used poured into a column, the flow-through was collected and the column was washed with 30 ml HEPES buffer.
  • Antibodies bound to the column (eluate) were eluted by acetic acid (IN, pH 4.0) and neutralized to pH. 6.6 with NFLtOH.
  • ppPSA Native PSA was isolated from seminal fluid as described by Sensabaugh and Blake, cited above.
  • ppPSA was purified from E. coli transformed with plasmid pPHS579 (containing ppPSA under control of T7 promoter) using a procedure analogous to pphK2 purification.
  • the method of the invention enables production of large quantities of substantially pure hK2 polypeptide.
  • the polypeptide can be used both to study its biological functions and to produce immunodetection reagents such as labelled hK2 polypeptide, labelled fragments thereof and antibodies thereto.
  • the immunoreagents can provide a method to purify native hK2 and to study the properties of the purified native hK2 polypeptide.
  • the pphK2 overproduced in E. coli can be readily solubilized in 0.1% SDS, thus solubility is not a problem. This is in contrast to the expression of human salivary kallikrein protein, hKl, in E. coli, which was found in insoluble inclusion bodies (J. Wang, et al Biochem. J., 276. 63 (1991)). In contrast, the present invention yields almost pure protein which can be purified to homogeneity by preparative SDS-PAGE. This purified recombinant pphK2 can be used for the generation of monoclonal and polyclonal antibodies.
  • Baculogold viral DNA can be used to generate a recombinant baculovirus containing pphK2 or mhK2.
  • Use of Baculogold viral DNA provides high selection of positive recombinant baculoviruses. Indeed, Northern blot analysis showed a high frequency of recombinant virus expressing pphK2 or mhK2 mRNA. Moreover, SDS-PAGE analysis showed that both pphK2 and mhK2 recombinant viruses produced unique proteins with sizes similar to the calculated molecular weights for pphK2 or mhK2. Although the levels of the recombinant hK2 expressed in insect system may not be as high as in E. coli, the hK2 protein produced in baculovirus-insect system may contain the secreted form which would be more like the natural form of the protein.
  • Plasmids pphK2/pVL1393 in E. col. H13101 has been deposited in the American Type Culture Collection, Rockville, MD, USA on May 2, 1994 under the provisions of the Budapest Treaty and have been assigned accession number ATCC 69614.
  • ADDRESSEE Schwegman, Lundberg S_ Woessner, P.A.
  • CAC AGC TTC CCA CAC COG CTC TAC AAT ATG AGC CTT CTG AAG CAT CAA 336 His Ser Phe Pro His Pro Leu Tyr Asn Met Ser Leu Leu Lys His Gin 95 100 105
  • GTG TAC ACC AAG GTG GTG CAT TAC CGG AAG TGG ATC AAG TAC ACC ATC 720 Val Tyr Thr Lys Val Val His Tyr Arg Lys Trp He Lys Tyr Thr He 225 230 235 240

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)
EP95921271A 1994-05-10 1995-05-09 Rekombinantes hk2 polypeptid Withdrawn EP0804593A1 (de)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US241174 1981-03-06
US24117494A 1994-05-10 1994-05-10
US42776795A 1995-05-02 1995-05-02
PCT/US1995/006157 WO1995030758A1 (en) 1994-05-10 1995-05-09 Recombinant hk2 polypeptide
US427767 1999-10-27

Publications (1)

Publication Number Publication Date
EP0804593A1 true EP0804593A1 (de) 1997-11-05

Family

ID=26934066

Family Applications (1)

Application Number Title Priority Date Filing Date
EP95921271A Withdrawn EP0804593A1 (de) 1994-05-10 1995-05-09 Rekombinantes hk2 polypeptid

Country Status (6)

Country Link
US (2) US6093796A (de)
EP (1) EP0804593A1 (de)
JP (1) JPH10500294A (de)
AU (1) AU699748B2 (de)
CA (1) CA2189774A1 (de)
WO (1) WO1995030758A1 (de)

Families Citing this family (41)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6103237A (en) * 1993-07-22 2000-08-15 Hybritech Incorporated Stable variant hK2 polypeptide
US5516639A (en) * 1993-07-22 1996-05-14 Mayo Foundation For Medical Education And Research Antibodies specific for human prostate glandular kallkrein
US20040259113A1 (en) * 1993-07-22 2004-12-23 Mayo Foundation For Medical Education And Research, Hybritech Incorporated Method for detection of metastatic prostate cancer
EP0804593A1 (de) * 1994-05-10 1997-11-05 Mayo Foundation For Medical Education And Research Rekombinantes hk2 polypeptid
US5866679A (en) * 1994-06-28 1999-02-02 Merck & Co., Inc. Peptides
US5599686A (en) * 1994-06-28 1997-02-04 Merck & Co., Inc. Peptides
US6143864A (en) * 1994-06-28 2000-11-07 Merck & Co., Inc. Peptides
US5614372A (en) * 1995-02-24 1997-03-25 Lilja; Hans Early detection of prostate cancer (CAP) by employing prostate specific antigen (PSA) and human glandular kallikrein (hGK-1)
US5807978A (en) * 1995-06-07 1998-09-15 Kokolus; William J. Immunogenic peptides of prostate specific antigen
GB2302874B (en) 1995-06-29 1999-11-10 Orion Yhtymae Oy Novel proteins
EP0974057B1 (de) * 1996-07-15 2005-09-21 Mayo Foundation For Medical Education And Research Verfahren zur detektion der hk2 polypeptide
WO1998021365A2 (en) * 1996-11-14 1998-05-22 Mayo Foundation For Medical Education And Research Method for detection of metastatic prostate cancer
US6479263B1 (en) * 1996-11-14 2002-11-12 Baylor College Of Medicine Method for detection of micrometastatic prostate cancer
US5840871A (en) * 1997-01-29 1998-11-24 Incyte Pharmaceuticals, Inc. Prostate-associated kallikrein
US7033827B2 (en) 1997-02-25 2006-04-25 Corixa Corporation Prostate-specific polynucleotide compositions
US7202342B1 (en) 1999-11-12 2007-04-10 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
ES2248891T3 (es) 1997-02-25 2006-03-16 Corixa Corporation Compuestos para inmunodiagnostico de cancer de prostata y metodos para su uso.
US6818751B1 (en) 1997-08-01 2004-11-16 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
US6894146B1 (en) 1997-02-25 2005-05-17 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
CN1195851C (zh) * 1997-02-25 2005-04-06 科里克萨有限公司 用于前列腺癌免疫疗法的化合物及其用途
US6329505B1 (en) 1997-02-25 2001-12-11 Corixa Corporation Compositions and methods for therapy and diagnosis of prostate cancer
US6657056B2 (en) 1997-02-25 2003-12-02 Corixa Corporation Compounds for immunotherapy of prostate cancer and methods for their use
US6800746B2 (en) 1997-02-25 2004-10-05 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
US20030185830A1 (en) 1997-02-25 2003-10-02 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
US6630305B1 (en) 1999-11-12 2003-10-07 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
US6613872B1 (en) 1997-02-25 2003-09-02 Corixa Corporation Compounds for immunotherapy of prostate cancer and methods for their use
US6261562B1 (en) 1997-02-25 2001-07-17 Corixa Corporation Compounds for immunotherapy of prostate cancer and methods for their use
US6465611B1 (en) 1997-02-25 2002-10-15 Corixa Corporation Compounds for immunotherapy of prostate cancer and methods for their use
US7270980B2 (en) 1997-02-25 2007-09-18 Corixa Corporation Compounds for immunodiagnosis of prostate cancer and methods for their use
US7517952B1 (en) 1997-02-25 2009-04-14 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
US6620922B1 (en) 1997-02-25 2003-09-16 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
US6943236B2 (en) 1997-02-25 2005-09-13 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
US6759515B1 (en) 1997-02-25 2004-07-06 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
US6395278B1 (en) 1997-02-25 2002-05-28 Corixa Corporation Prostate specific fusion protein compositions
US7008772B1 (en) 1997-02-25 2006-03-07 Corixa Corporation Compounds for immunodiagnosis of prostate cancer and methods for their use
US6235486B1 (en) 1997-06-20 2001-05-22 Mayo Foundation For Medical Education & Research Method for detection of breast cancer
US6194152B1 (en) 1997-08-20 2001-02-27 Dendreon Corporation Prostate tumor polynucleotide compositions and methods of detection thereof
AU767587B2 (en) * 1999-01-28 2003-11-20 Gen-Probe Incorporated Nucleic acid sequences for detecting genetic markers for cancer in a biological sample
US7048931B1 (en) 2000-11-09 2006-05-23 Corixa Corporation Compositions and methods for the therapy and diagnosis of prostate cancer
US7834169B2 (en) * 2001-09-25 2010-11-16 Sony Corporation P300 histone acetylase inhibitor
DE10211818B4 (de) * 2002-03-16 2006-07-06 peS Gesellschaft für medizinische Diagnose-Systeme mbH Verfahren zur quantitativen Bestimmung mehrerer Analyten

Family Cites Families (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
NL154598B (nl) * 1970-11-10 1977-09-15 Organon Nv Werkwijze voor het aantonen en bepalen van laagmoleculire verbindingen en van eiwitten die deze verbindingen specifiek kunnen binden, alsmede testverpakking.
US3817837A (en) * 1971-05-14 1974-06-18 Syva Corp Enzyme amplification assay
US3901654A (en) * 1971-06-21 1975-08-26 Biological Developments Receptor assays of biologically active compounds employing biologically specific receptors
US3862925A (en) * 1973-07-05 1975-01-28 American Home Prod Preparation of somatotropin release inhibiting factor and intermediates therefor
US3842067A (en) * 1973-07-27 1974-10-15 American Home Prod Synthesis of(des-asn5)-srif and intermediates
JPS5726506B2 (de) * 1974-03-08 1982-06-04
US3935074A (en) * 1973-12-17 1976-01-27 Syva Company Antibody steric hindrance immunoassay with two antibodies
US3996345A (en) * 1974-08-12 1976-12-07 Syva Company Fluorescence quenching with immunological pairs in immunoassays
US4034074A (en) * 1974-09-19 1977-07-05 The Board Of Trustees Of Leland Stanford Junior University Universal reagent 2-site immunoradiometric assay using labelled anti (IgG)
US4105602A (en) * 1975-02-10 1978-08-08 Armour Pharmaceutical Company Synthesis of peptides with parathyroid hormone activity
US4092408A (en) * 1975-08-28 1978-05-30 New England Nuclear Corporation Method for solid phase immunological assay of antigen
US3984533A (en) * 1975-11-13 1976-10-05 General Electric Company Electrophoretic method of detecting antigen-antibody reaction
US4098876A (en) * 1976-10-26 1978-07-04 Corning Glass Works Reverse sandwich immunoassay
US4371515A (en) * 1978-12-26 1983-02-01 E-Y Laboratories, Inc. Method for forming an isolated lectin-immunological conjugate
US4446122A (en) * 1979-12-28 1984-05-01 Research Corporation Purified human prostate antigen
US4353982A (en) * 1980-04-10 1982-10-12 Hoffmann-La Roche Inc. Immunochemical assay for creatine kinase-MB isoenzyme
US4757049A (en) * 1981-10-05 1988-07-12 Tni Pharmaceuticals, Inc. Process for using endogenous enkephalins and endorphins to stimulate the immune system of patients with aids
US4792528A (en) * 1982-05-21 1988-12-20 The Trustees Of Columbia University In The City Of New York Methods for obtaining monoclonal antibodies useful in enhanced sensitivity immunoassays
US4487715A (en) * 1982-07-09 1984-12-11 The Regents Of The University Of California Method of conjugating oligopeptides
US4629783A (en) * 1985-04-29 1986-12-16 Genetic Systems Corporation Synthetic antigen for the detection of AIDS-related disease
US4757048A (en) * 1985-11-05 1988-07-12 Biotechnology Research Associates J.V. Synthetic analogs of atrial natriuretic peptides
DE3684578D1 (de) * 1985-12-17 1992-04-30 Eastern Virginia Medical Autho Monoklonale antikoerper mit bindungsspezifitaet fuer menschliche prostatatumorantigene und methoden fuer ihre verwendung.
KR890701731A (ko) * 1987-06-30 1989-12-21 로버트 디. 웨이스트 칼리크레인의 제조방법
CA2096497A1 (en) * 1992-05-26 1993-11-27 Patricia Anne Spears Mycobacteria probes
US5321684A (en) * 1992-09-15 1994-06-14 Sri International Bidirectional sinusoidal scanning system
ATE231187T1 (de) * 1992-10-29 2003-02-15 Univ Jefferson Methoden zur detektion von mikrometastasen bei prostata-krebs
US5516639A (en) * 1993-07-22 1996-05-14 Mayo Foundation For Medical Education And Research Antibodies specific for human prostate glandular kallkrein
US6103237A (en) * 1993-07-22 2000-08-15 Hybritech Incorporated Stable variant hK2 polypeptide
CA2187775A1 (en) * 1994-04-15 1995-10-26 Aaron E. Katz Method for molecular staging of prostate cancer
EP0804593A1 (de) * 1994-05-10 1997-11-05 Mayo Foundation For Medical Education And Research Rekombinantes hk2 polypeptid
AU4897896A (en) * 1995-01-04 1996-07-24 Trustees Of Boston University Primers for the pcr amplification of metastatic sequences
US5614372A (en) * 1995-02-24 1997-03-25 Lilja; Hans Early detection of prostate cancer (CAP) by employing prostate specific antigen (PSA) and human glandular kallikrein (hGK-1)
AU717937B2 (en) * 1995-02-24 2000-04-06 Sloan-Kettering Institute For Cancer Research Prostate-specific membrane antigen and uses thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9530758A1 *

Also Published As

Publication number Publication date
US6093796A (en) 2000-07-25
JPH10500294A (ja) 1998-01-13
US6013471A (en) 2000-01-11
CA2189774A1 (en) 1995-11-16
AU699748B2 (en) 1998-12-10
WO1995030758A1 (en) 1995-11-16
AU2639095A (en) 1995-11-29

Similar Documents

Publication Publication Date Title
EP0804593A1 (de) Rekombinantes hk2 polypeptid
WO1995030758A9 (en) Recombinant hk2 polypeptide
AU734220B2 (en) Cloning and characterization of napsin, an aspartic protease
WO1998022597A9 (en) Cloning and characterization of napsin, an aspartic protease
JP4205738B2 (ja) 安定hk2ポリペプチド変異体
JP2001520515A (ja) 再発性前立腺癌の検出のための方法
EP0816504B1 (de) Acetylhydrolase des Plättchen aktivierenden Faktors, und entsprechendes Gen
US5567602A (en) Recombinant production of chymase
AU737659B2 (en) Method for detection of metastatic prostate cancer
JP3955636B2 (ja) Hk2ポリペプチドを検出するための方法
WO1998002748A9 (en) Methods to detect hk2 polypeptides
MXPA96005473A (en) Polipeptido hk2 recombina
WO1994012647A2 (en) Novel serine protease from lymphocyte granules and use thereof
Very et al. Analysis of monoclonal antibodies to prostate-specific antigen: reactivity with native and recombinant prostate-specific antigen
MXPA99000659A (es) Metodos para detectar polipeptidos de hk2
US20040259113A1 (en) Method for detection of metastatic prostate cancer
MXPA99004504A (en) Method for detection of metastatic prostate cancer

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19961120

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE

17Q First examination report despatched

Effective date: 20001124

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20060411