EP0804453A1 - Procede de detection et de traitement du cancer du sein - Google Patents

Procede de detection et de traitement du cancer du sein

Info

Publication number
EP0804453A1
EP0804453A1 EP95910094A EP95910094A EP0804453A1 EP 0804453 A1 EP0804453 A1 EP 0804453A1 EP 95910094 A EP95910094 A EP 95910094A EP 95910094 A EP95910094 A EP 95910094A EP 0804453 A1 EP0804453 A1 EP 0804453A1
Authority
EP
European Patent Office
Prior art keywords
seq
ser
glu
gene
breast cancer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP95910094A
Other languages
German (de)
English (en)
Other versions
EP0804453A4 (fr
Inventor
Jeffrey T. Holt
Roy A. Jensen
David L. Page
Patrice S. Obermiller
Cheryl L. Robinson-Benion
Marilyn E. Thompson
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Vanderbilt University
Original Assignee
Vanderbilt University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Vanderbilt University filed Critical Vanderbilt University
Priority claimed from PCT/US1995/000608 external-priority patent/WO1995019369A1/fr
Publication of EP0804453A1 publication Critical patent/EP0804453A1/fr
Publication of EP0804453A4 publication Critical patent/EP0804453A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57415—Specifically defined cancers of breast
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/82—Translation products from oncogenes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/112—Disease subtyping, staging or classification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the present invention relates generally to methods of detection and diagnosis of breast cancer and more particularly to a diagnostic method which relies on the identification of marker genes expressed in pre-invasive cancers by microscopically- directed cloning. Furthermore, this invention concerns the prevention, detection, and diagnosis of breast cancer by addressing the molecular events which occur during the 10 earliest alterations in breast tissue.
  • the present invention also relates generally to methods of treatment of breast cancer, and more particularly to gene therapy methods and methods for screening compounds that induce expression of the BRCA1 gene product.
  • DCIS expression in ductal carcinoma in situ
  • NBDCIS non- comedo DCIS
  • Pre-malignant breast disease is also characterized by an apparent morphological progression from atypical hyperplasias, to carcinoma in-situ (pre-invasive cancer) to invasive cancer which ultimately spreads and metastasizes resulting in the death of the patient. Careful histologic examination of breast biopsies has demonstrated intermediate stages which have acquired some of these characteristics but not others.
  • DCIS non-comedo carcinoma-in-situ which is associated with a greater than ten-fold increased relative risk of breast cancer compared to control groups.
  • DCIS (sometimes called intraductal carcinoma) is a group of lesions in which the cells have grown to completely fill the duct with patterns similar to invasive cancer, but do not invade outside the duct or show metastases at presentation. DCIS occurs in two forms: comedo DCIS and non-comedo DCIS. Comedo DCIS is often a grossly palpable lesion which was probably considered "cancer" in the 19th and early 20th century and progresses to cancer (without definitive therapy) in at least 50% of patients within three years (Ottesen et al, 1992; Page et al, 1982).
  • Non-comedo DCIS is detected by microscopic analysis of breast aspirates or biopsies and is associated with a 10 fold increased risk of breast cancer, which corresponds to a 25-30% absolute risk of breast cancer within 15 years (Ottesen et al, 1992; Page et al, 1982; and, Ward et al, 1992).
  • NCDCIS now represents the predominant form of DCIS diagnosed in the United States (Ottesen et al, 1992; Page et al, 1982; and
  • the BRCA 1 gene encodes a protein of 1863 amino acids with a predicted zinc finger domain observed in proteins which regulate gene transcription.
  • the function was unknown.
  • NCDCIS of the breast is associated with a ten-fold increased risk of breast cancer (absolute risk of 25-30%). It seems likely that this pre-invasive lesion is a determinate precursor of breast cancer because the subsequent development of breast cancer is regularly in the same region of the same breast in which the NCDCIS lesion was found.
  • Important aspects of the present invention concern isolated DNA segments and those isolated DNA segments inserted into recombinant vectors encoding differentially expressed marker genes in abnormal tissue, specifically in NCDCIS, as compared with those expressed in normal tissue, and the creation and use of recombinant host cells through the application of DNA technology, which express these differentially expressed marker genes (Sambrook et al, 1989).
  • NCDCIS is an ideal target for early diagnosis.
  • This invention therefore, provides a method of detecting and diagnosing pre- invasive breast cancer by analyzing marker genes which are differentially expressed in non-comedo DCIS cells. Histopathologic studies have demonstrated that these morphologic patterns in breast tissue lead to invasive breast cancer in at least 20-30% of patients.
  • the present method analyzes gene expression in normal, pre-malignant and malignant breast biopsies; and, it allows simultaneous comparison and cloning of marker genes which are differentially expressed in pre-invasive breast cancer. These marker genes can then be used as probes to develop other diagnostic tests for the early detection of pre-invasive breast cancer.
  • the present invention concerns DNA segments, isolatable from both normal and abnormal human breast tissue, which are free from total genomic DNA.
  • the isolated DCIS-1 protein product is the regulatory element of the RibRed enzyme.
  • This and all other isolatable DNA segments which are differentially expressed in preinvasive breast cancer can be used in the detection, diagnosis and treatment of breast cancer in its earliest and most easily treatable stages.
  • abnormal tissue refers to pre-invasive and invasive breast cancer tissue, as exemplified by collected samples of non-comedo or comedo DCIS tissues.
  • DNA segment refers to a DNA molecule which has been isolated free of total genomic DNA of a particular species. Therefore, a DNA segment encoding a differentially expressed protein (as measured by the expression of mRNA) in abnormal tissue refers to a DNA segment which contains differentially expressed-coding sequences in abnormal tissue as compared to those expressed in normal tissue, yet is isolated away from, or purified free from, total genomic DNA of Homo sapiens sapiens. Furthermore, a DNA segment encoding a BRCA1 protein refers to a DNA segment which contains BRCA1 coding sequences, yet is isolated away from, or purified free from, total genomic DNA of Homo sapiens sapiens. Included within the term "DNA segment”, are DNA segments and smaller fragments of such segments, and also recombinant vectors, including, for example, plasmids, cosmids, phage, viruses, and the like.
  • a DNA segment comprising an isolated or purified differentially expressed gene or comprising an isolated or purified BRCA1 gene refers to a DNA segment including differentially expressed coding sequences or BRCA1 coding sequences isolated substantially away from other naturally occurring genes or protein encoding sequences.
  • the term "gene” is used for simplicity to refer to a functional protein, polypeptide or peptide encoding unit. As will be understood by those in the art, this functional term includes both genomic sequences and cDNA sequences.
  • isolated substantially away from other coding sequences means that the gene of interest, in this case, any differentially expressed marker gene or the BRCA1 gene, forms the significant part of the coding region of the DNA segment, and that the DNA segment does not contain large portions of naturally-occurring coding DNA, such as large chromosomal fragments or other functional genes or cDNA coding regions. Of course, this refers to the DNA segment as originally isolated, and does not exclude genes or coding regions later added to the segment by the hand of man.
  • the invention concerns isolated DNA segments and recombinant vectors incorporating DNA sequences which encode differentially expressed genes in pre-invasive breast cancer, each which includes within its amino acid sequence an amino acid sequence in accordance with SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:
  • all seq id no:s 1-7 are derived from non-comedo DCIS samples from Homo sapiens sapiens.
  • the invention concerns isolated DNA segments and recombinant vectors incorporating DNA sequences which encode the M2 subunit of human RibRed that includes within its amino acid sequence the similar amino acid sequence of hamster RibRed corresponding to the M2 subunit of hamster RibRed.
  • the invention concerns isolated DNA segments and recombinant vectors which partially or wholly encode a protein or peptide that includes within its amino acid sequence an amino acid sequence essentially as partially or wholly encoded, respectively, by SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7.
  • DNA segment or vector encodes a full length differentially expressed protein, or is intended for use in expressing the differentially expressed protein
  • the most preferred sequences are those which are essentially as set forth in SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7 and which encode a protein that exhibits differential expression, e.g., as may be determined by the differential display or differential sequencing assay, as disclosed herein.
  • sequence essentially as set forth in SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7 means that the sequence substantially corresponds to a portion of SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO: 7, respectively, and has relatively few nucleotides which are not identical to, or a biologically functional equivalent of, the nucleotides of the respective SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7.
  • sequences which have between about 70% and about 80%; or more preferably, between about 81 % and about 90%; or even more preferably, between about 91 % and about 99%; of amino acids which are identical or functionally equivalent to the amino acids of SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7 will be sequences which are "essentially as set forth in SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID
  • the invention concerns a drug screening method and a gene therapy method that use isolated DNA segments and recombinant vectors incorporating DNA sequences which encode a protein that includes within its amino acid sequence an amino acid sequence in accordance with SEQ ID NO: 49, SEQ ID NO: 50
  • the invention concerns isolated DNA sequences and recombinant DNA vectors incorporating DNA sequences wich encode a protein taht includes with its amino acid sequence the amino acid sequence of the BRCAl gene product from human breast tissue.
  • the invention concerns methods using isolated DNA segments and recombinant vectors which partially or wholly encode a protein or peptide that includes within its amino acid sequence an amino acid sequence essentially as set forth in SEQ ID NO: 49.
  • the DNA segment or vector encodes a full length BRCAl protein, or is intended for use in expressing the BRCAl protein
  • the most preferred sequences are those which are essentially as set forth in SEQ ID NO: 47 and which encode a protein that retains activity as a negative growth regulator in human breast cells, as may be determined by antisense assay, as disclosed herein.
  • sequence essentially as set forth in SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7 means that the sequence substantially corresponds to a portion of SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO: 7, respectively, and has relatively few nucleotides which are not identical to, or a biologically functional equivalent of, the nucleotides of the respective SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, or SEQ
  • sequence essentially as set forth in SEQ ID NO:49 means that the sequence substantially corresponds to a portion of SEQ ID NO: 49 and has relatively few amino acids which are not identical to, or a biologically functional equivalent of, the nucleotides of SEQ ID NO:49.
  • biologically functional equivalent is well understood in the art and is further defined in detail herein, for example see pages 24 through 25. Accordingly, sequences which have between about 70% and about
  • amino acids which are identical or functionally equivalent to the amino acids of SEQ ID NO:49 will be sequences which are "essentially as set forth in SEQ ID NO:49".
  • the invention concerns isolated DNA segments and recombinant vectors that include within their sequence a nucleic acid sequence essentially as set forth in SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7.
  • the term "essentially as set forth in SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO: 6, and SEQ ID NO:7" is used in the same sense as described above and means that the nucleic acid sequence substantially corresponds to a portion of SEQ ID NO: 1,
  • DNA segments which encode proteins exhibiting differential expression will be most preferred.
  • the term "functionally equivalent codon” is used herein to refer to codons that encode the same amino acid, such as the six codons for arginine or serine, and also refers to codons that encode biologically equivalent amino acids (see Figure 8).
  • the invention concerns a method for screening drugs and a gene therapy method which involve the use of isolated DNA segments and recombinant vectors that include within their sequence a nucleic acid sequence essentially as set forth in SEQ ID NO:47 and SEQ ID NO:48.
  • the term "essentially as set forth in SEQ ID NO:47 and SEQ ID NO:48" is used in the same sense as described above and means that the nucleic acid sequence substantially corresponds to a portion of SEQ ID NO:47 and SEQ ID NO:48 respectively, and has relatively few codons which are not identical, or functionally equivalent, to the codons of SEQ ID NO:47 and SEQ ID NO:48, respectively.
  • amino acid and nucleic acid sequences may include additional residues, such as additional N- or C-terminal amino acids or 5' or 3' sequences, and yet still be essentially as set forth in one of the sequences disclosed herein, so long as the sequence meets the criteria set forth above, including the maintenance of biological protein activity where protein expression is concerned.
  • the addition of terminal sequences particularly applies to nucleic acid sequences which may, for example, include various non-coding sequences flanking either of the 5' or 3' portions of the coding region or may include various internal sequences, i.e., introns, which are known to occur within genes.
  • sequences which have between about 20% and about 50% ; or more preferably, between about 50% and about 70%; or even more preferably, between about 70% and about 99% ; of nucleotides which are identical to the nucleotides of SEQ
  • SEQ ID NO:l SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO: 6, and SEQ ID NO: 7 will be sequences which are "essentially as set forth in SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7", respectively. Sequences which are essentially the same as those set forth in SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ
  • SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7 may also be functionally defined as sequences which are capable of hybridizing to a nucleic acid segment containing the complement of SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO: 3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, respectively, under relatively stringent conditions. Suitable relatively stringent hybridization conditions will be well known to those of skill in the art (Sambrook et al, 1989).
  • sequences which have between about 20% and about 50%; or more preferably, between about 50% and about 70%; or even more preferably, between about 70% and about 99% ; of nucleotides which are identical to the nucleotides of SEQ
  • SEQ ID NO:47 and SEQ ID NO:48 will be sequences which are "essentially as set forth in SEQ ID NO:47 and SEQ ID NO:48", respectively. Sequences which are essentially the same as those set forth in SEQ ID NO:47 and SEQ ID NO:48 may also be functionally defined as sequences which are capable of hybridizing to a nucleic acid segment containing the complement of SEQ ID NO:47 and SEQ ID NO:48, respectively, under relatively stringent conditions. Suitable relatively stringent hybridization conditions will be well known to those of skill in the art (Sambrook et al, 1989).
  • invasive breast cancer develops in the region of the previous biopsy site in at least 25-30% of patients following diagnosis of non-comedo DCIS providing strong evidence that this pre-malignant lesion is a determinant event in breast cancer progression. While these morphologically defined intermediate endpoints have been widely accepted, progress in defining the molecular correlates of these lesions has been hampered by an inability to identify and sample them in a manner which would allow the application of molecular techniques.
  • the present invention includes a comparison of gene expression between multiple breast tissue biopsy samples as a means to identify differentially expressed genes in pre-malignant breast disease compared with normal breast tissue.
  • BRCAl mRNA is expressed at 5-10 fold higher levels in normal mammary tissue than in invasive breast cancer samples. Having demonstrated that mRNA expression levels of BRCAl are higher in normal mammary cells than in cancer cells, antisense methods were used to test the hypothesis that BRCAl expression inhibits cell growth. These tests showed that diminished expression of BRCAl increased the proliferative rate of breast cells.
  • An object of the present invention is to provide a method of early detection of pre-invasive breast cancer in human tissue. It is a further object of this invention to identify early marker genes for pre- invasive breast disease which can be used in screening methods for early pre-invasive breast cancer.
  • Fig. 1 shows Table I which describes anatomic lesion types in the human breast with pre-malignant implication.
  • Fig. 2 shows a model for pre-malignant conditions, highlighting magnitude of risk for progression to clinical malignancy.
  • Fig. 3 contains color photos of DCIS tissue, before (upper left panel) and after microscopically-directed excisional punch biopsy (upper right panel). The lower panels show tissue samples of normal breast tissue (lower left panel), and invasive breast cancer (lower right panel).
  • Fig. 4 shows expression of collagen III mRNA in tissue mRNA samples, analyzed by RNase protection assay methods.
  • Fig. 5 shows differential display of cDNAs obtained from patient tissue samples and controls.
  • Fig. 6 shows a comparison of the sequence between DCIS-1 and the human and hamster genes.
  • Fig. 7 shows expression of DCIS-1 mRNA in tissue mRNA samples analyzed by RNase protection assay as described in the legend to Figure 4.
  • Fig. 8 is Table ⁇ which displays the genetic code.
  • Fig. 9 is a Table which lists differentially expressed marker genes.
  • Figs. 10A and 10B shows expression of BRCAl mRNA during breast cancer progression by PCR detection and nuclease protection assay, respectively.
  • Figs. 11A and 1 IB is a comparison of BRCAl expression in normal breast and invasive breast cancer using nuclease protection assay of RNA, respectively.
  • Figs. 12A, 12B, and 12C show that antisense inhibition of BRCAl accelerates mammary cell proliferation.
  • Figs. 13A and 13B includes a Northern blot of mRNA and nuclear runon studies that show that ribonucleotide reductase M2 mRNA is cell cycle regulated in MCF-7 cells.
  • Fig. 14 includes a nuclease protection assay that shows that antisense inhibition of BRCAl in human mammary cells decreases BRCAl mRNA and increases ribonucleotide reductase mRNA. I ⁇ L ⁇ STATEMENT
  • differentially expressed genes in pre-invasive breast tissue specifically in non-comedo ductal carcinoma in situ as compared to genes expressed in normal tissue
  • Such differentially expressed genes are effective marker genes indicating the significantly increased risk of breast cancer in a patient expressing these differentially expressed marker genes. These marker genes are useful in the detection, early diagnosis, and treatment of breast cancer in humans.
  • the discovery of the function of the BRCA 1 gene has broad utility including, in the present invention, development of methods to treat familial and sporadic breast cancers as well as screen for therapeutic drugs through production of important indicator compounds.
  • DCIS-1 encodes a gene similar to the M2 subunit of hamster ribonucleotide reductase.
  • the M2 subunit of ribonucleotide reductase (RibRed, hereafter) is responsible for regulation of RibRed.
  • the differential levels of expression of the marker genes described in this invention (Seq ID No.s 1-7), indicate genetic changes which have been linked to the presence of pre-invasive breast cancer.
  • the BRCAl gene (Seq. ID No. 47) is differentially expressed in invasive breast cancer cells.
  • the BRCAl gene product is a negative regulator of mammary cell proliferation which is expressed at diminished levels in sporadic breast cancer.
  • Nucleic acid sequences which are "complementary" are those which are capable of base-pairing according to the standard Watson-Crick complementarity rules. That is, that the larger purines will always base pair with the smaller pyrimidines to form only combinations of Guanine paired with Cytosine (G:C) and Adenine paired with either Thymine (A:T) in the case of DNA or Adenine paired with Uracil (A:U) in the case of RNA.
  • G:C Guanine paired with Cytosine
  • A:T Thymine
  • A:U Adenine paired with Uracil
  • Hybridization techniques refer to molecular biological techniques which involve the binding or hybridization of a probe to complementary sequences in a polynucleotide. Included among these techniques are northern blot analysis, southern blot analysis, nuclease protection assay, etc.
  • Probes which are hybridized or bound to denatured DNA are aggregated to complementary sequences in the polynucleotide. Whether or not a particular probe remains aggregated with the polynucleotide depends on the degree of complementarity, the length of the probe, and the stringency of the binding conditions. The higher the stringency, the higher must be the degree of complementarity and/or the longer the probe.
  • Probe refers to an oligonucleotide or short fragment of DNA designed to be sufficiently complementary to a sequence in a denatured nucleic acid to be probed and to be bound under selected stringency conditions.
  • Label refers to a modification to the probe nucleic acid that enables the experimenter to identify the labeled nucleic acid in the presence of unlabeled nucleic acid. Most commonly, this is the replacement of one or more atoms with radioactive isotopes. However, other labels include covalently attached chromophores, fluorescent moeities, enzymes, antigens, groups with specific reactivity, chemiluminescent moeities, and electrochemically detectable moeities, etc.
  • Marker gene refers to any gene selected for detection which displays differential expression in abnormal tissue as opposed to normal tissue. It is also referred to as a differentially expressed gene.
  • Marker protein refers to any protein encoded by a “marker gene” which protein displays differential expression in abnormal tissue as opposed to normal tissue.
  • tissue homogenization probe describes a tissue homogenization probe.
  • Abnormal tissue refers to pathologic tissue which displays cytologic, histologic and other defining and derivative features which differ from that of normal tissue. This includes in the case of abnormal breast tissue, among others, pre-invasive and invasive neoplasms.
  • Normal tissue refers to tissue which does not display any pathologic traits.
  • PCR technique describes a method of gene amplification which involves sequenced-based hybridization of primers to specific genes within a DNA sample (or library) and subsequent amplification involving multiple rounds of annealing, elongation and denaturation using a heat-stable DNA polymerase.
  • RT-PCR is an abbreviation for reverse transcriptase-polymerase chain reaction. Subjecting mRNA to the reverse transcriptase enzyme results in the production of cDNA which is complementary to the base sequences of the mRNA.
  • “Microscopically-directed” refers to the method of tissue sampling by which the tissue sampled is viewed under a microscope during the sampling of that tissue such that the sampling is precisely limited to a given tissue type, as the investigator requires. Specifically, it is a collection step which involves the use of a punch biopsy instrument. This surgical instrument is stereotactically manually-directed to harvest exclusively from abnormal tissue which exhibits histologic or cytologic characteristics of pre-invasive cancer. The harvest is correlated with a companion slide, stained to recognize the target tissue.
  • “Differential display” describes a method in which expressed genes are compared between samples using low stringency PCR with random oligonucleotide primers.
  • “Differential screening” describes a method in which genes within cDNA libraries are compared between two samples by differential hybridization of cDNAs to probes prepared from each library.
  • Nuclease protection assay refers to a method of RNA quantitation which employs strand specific nucleases to identify specific RNAs by detection of duplexes.
  • Downlink expression describes the phenomenon of differential genetic expression seen in abnormal tissue in comparison to that seen in normal tissue.
  • isolated tissue structure refers to a tissue structure which when visualized microscopically or otherwise is able to be isolated from other different surrounding tissue types.
  • RNA In situ hybridization of RNA refers to the use of labeled DNA probes employed in conjunction with histological sections on which RNA is present and with which the labeled probe can hybridize allowing an investigator to visualize the location of the specific RNA within the cell.
  • Codo DCIS cells refers to cells comprising an in situ lesion with the combined features of highest grade DCIS.
  • Non-comedo DCIS cells refers to cells of DCIS lesions without comedo features.
  • “Cloning” describes separation and isolation of single genes. “Sequencing” describes the determination of the specific order of nucleic acids in a gene or polynucleotide.
  • the present invention provides a method for detecting and diagnosing cancer by analyzing marker genes which are differentially expressed in early, pre-invasive breast cancer, specifically in non-comedo DCIS cells. Our histopathologic studies have demonstrated that certain morphologic patterns in breast tissue are pre-malignant, leading to invasive breast cancer in at least 20-30% of patients. We have developed a new method for analyzing gene expression in normal, pre-malignant and malignant breast biopsies which allows simultaneous comparison and cloning of marker genes which are differentially expressed in pre-invasive breast cancer. These marker genes (which appear as differentially expressed genes in pre-invasive breast cancer) can be used as probes to develop diagnostic tests for the early detection of pre-invasive breast cancer (Sambrook, 1989).
  • the present invention thus comprises a method of identification of marker genes which are expressed in the majority of pre-invasive breast cancer tissue samples. It involves cDNA library preparation followed by a modified differential display method.
  • the present invention also encompasses DNA segments which are complementary, or essentially complementary, to the sequence set forth in SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6,
  • nucleic acid sequences which are "complementary” are those which are capable of base-pairing according to the standard Watson-Crick complementarity rules.
  • complementary sequences means nucleic acid sequences which are substantially complementary, as may be assessed by the same nucleotide comparison set forth above, or as defined as being capable of hybridizing to the nucleic acid segment of SEQ ID NO: 1 , SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:47 and SEQ ID NO:48 under relatively stringent conditions such as those described herein.
  • nucleic acid fragments may be prepared which include a short stretch complementary to SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:47 and SEQ ID NO:48, such as about 10 nucleotides, and which are up to 10,000 or 5,000 base pairs in length, with segments of 500 being preferred in most cases. DNA segments with total lengths of about 1 ,000, 500, 200, 100 and about 50 base pairs in length are also contemplated to be useful.
  • Recombinant vectors and isolated DNA segments may therefore variously include the differentially expressed coding regions or the BRCAl coding regions themselves, coding regions bearing selected alterations or modifications in the basic coding region, or they may encode larger polypeptides which nevertheless include differentially expressed-coding regions and the BRCAl coding regions or may encode biologically functional equivalent proteins or peptides which have variant amino acids sequences.
  • DNA segments of the present invention encompass biologically functional equivalent differentially expressed proteins and peptides biologically functional equivalent proteins of BRCAl. Such sequences may arise as a consequence of codon redundancy and functional equivalency which are known to occur naturally within nucleic acid sequences and the proteins thus encoded. Alternatively, functionally equivalent proteins or peptides may be created via the application of recombinant DNA technology, in which changes in the protein structure may be engineered, based on considerations of the properties of the amino acids being exchanged.
  • Changes designed by man may be introduced through the application of site-directed mutagenesis techniques, e.g., to introduce improvements to the antigenicity of the protein or to test site-directed mutants or others in order to examine carcinogenic activity of the differentially expressed marker genes at the molecular level.
  • fusion proteins and peptides e.g., where the differentially expressed marker gene coding regions are aligned within the same expression unit with other proteins or peptides having desired functions, such as for purification or immunodetection purposes (e.g., proteins which may be purified by affinity chromatography and enzyme label coding regions, respectively).
  • Recombinant vectors form important further aspects of the present invention.
  • Particularly useful vectors are contemplated to be those vectors in which the coding portion of the DNA segment is positioned under the control of a promoter.
  • the promoter may be in the form of the promoter which is naturally associated with a RIBRED gene, e.g., in human cells, as may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment or exon, for example, using recombinant cloning and/or PCR technology, in connection with the compositions disclosed herein.
  • a recombinant or heterologous promoter is intended to refer to a promoter that is not normally associated with a differentially expressed marker gene or the BRCAl gene in its natural environment.
  • Such promoters may include MMTV promoters normally associated with other genes, and/or promoters isolated from any other bacterial, viral, eukaryotic, or mammalian cell.
  • promoters that effectively directs the expression of the DNA segment in the cell type chosen for expression.
  • the use of promoter and cell type combinations for protein expression is generally known to those of skill in the art of molecular biology, for example, see Sambrook et al. (1989).
  • the promoters employed may be constitutive, or inducible, and can be used under the appropriate conditions to direct high level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins or peptides.
  • Appropriate promoter systems contemplated for use in high-level expression include, but are not limited to appropriate bacterial promoters.
  • differentially expressed marker gene encoded proteins and peptides As mentioned above, in connection with expression embodiments to prepare recombinant differentially expressed marker gene encoded proteins and peptides, it is contemplated that longer DNA segments will most often be used, with DNA segments encoding the entire differentially expressed protein or subunit being most preferred.
  • DNA segments which encode peptide antigens from about 15 to about 50 amino acids in length, or more preferably, from about 15 to about 30 amino acids in length are contemplated to be particularly useful.
  • the C terminus of proteins provide an excellent region for peptide antigen recogition (Harlow et al, 1988).
  • DNA segments encoding peptides will generally have a minimum coding length in the order of about 45 to about 147, or to about 90 nucleotides.
  • DNA segments encoding partial length peptides may have a minimum coding length in the order of about 50 nucleotides for a polypeptide in accordance with seq id no: 3, or about 264 nucleotides for a polypeptide in accordance with SEQ ID NO: 1.
  • nucleic acid sequences disclosed herein also have a variety of other uses. For example, they also have utility as probes or primers in nucleic acid hybridization embodiments. As such, it is contemplated that oligonucleotide fragments corresponding to the sequences of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7 for stretches of between about 10 to 15 nucleotides and about 20 to 30 nucleotides will find particular utility. Longer complementary sequences, e.g., those of about 40, 50, 100, 200, 500, 1000, and even up to full length sequences of about 2,000 nucleotides in length, will also be of use in certain embodiments.
  • nucleic acid probes to specifically hybridize to differentially expressed marker gene sequences will enable them to be of use in detecting the presence of complementary sequences in a given sample.
  • sequence information for the preparation of mutant species primers, or primers for use in preparing other genetic constructions.
  • Nucleic acid molecules having stretches of 20, 30, 50, or even of 500 nucleotides or so, complementary to SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7 are particularly contemplated as hybridization probes for use in, e.g., Southern and Northern blotting. This would allow differentially expressed structural or regulatory genes to be analyzed, both in patients and sample tissue from pre-invasive and invasive breast tissue. The total size of fragment, as well as the size of the complementary stretch(es), will ultimately depend on the intended use or application of the particular nucleic acid segment.
  • hybridization probe of about 10 nucleotides in length allows the formation of a duplex molecule that is both stable and selective.
  • Molecules having complementary sequences over stretches greater than 10 bases in length are generally preferred, though, in order to increase stability and selectivity of the hybrid, and thereby improve the quality and degree of specific hybrid molecules obtained.
  • Hybridization probes may be selected from any portion of any of the sequences disclosed herein. All that is required is to review the sequences set forth in SEQ ID NO:
  • SEQ ID NO: l SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7 and to select any continuous portion of one of the sequences, from about 10 nucleotides in length up to and including the full length sequence, that one wishes to utilise as a probe or primer.
  • probe and primer sequences may be governed by various factors, such as, by way of example only, one may wish to employ primers from towards the termini of the total sequence, or from the ends of the functional domain-encoding sequences, in order to amplify further DNA; one may employ probes corresponding to the entire DNA, or to the 5' region, to clone marker- type genes from other species or to clone further marker-like or homologous genes from any species including human; and one may employ randomly selected, wild-type and mutant probes or primers with sequences centered around the RibRed M2 subunit encoding sequence to screen DNA samples for differentially expressed levels of RibRed, such as to identify human subjects which may be expressing differential levels of RibRed and thus may be susceptible to breast cancer.
  • nucleic acid segment which includes a sequence from within SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7 may alternatively be described as "preparing a nucleic acid fragment".
  • fragments may also be obtained by other techniques such as, e.g., by mechanical shearing or by restriction enzyme digestion. Small nucleic acid segments or fragments may be readily prepared by, for example, directly synthesizing the fragment by chemical means, as is commonly practiced using an automated oligonucleotide synthesizer.
  • fragments may be obtained by application of nucleic acid reproduction technology, such as the PCR technology of U.S. Patent 4,603,102 (incorporated herein by reference), by introducing selected sequences into recombinant vectors for recombinant production, and by other recombinant DNA techniques generally known to those of skill in the art of molecular biology.
  • the nucleotide sequences of the invention may be used for their ability to selectively form duplex molecules with complementary stretches of differentially expressed marker genes or cDNAs.
  • relatively stringent conditions e.g., one will select relatively low salt and ⁇ or high temperature conditions, such as provided by 0.02M-0.15M NaCl at temperatures of 50°C to 70°C.
  • Such selective conditions tolerate little, if any, mismatch between the probe and the template or target strand, and would be particularly suitable for isolating specific differentially expressed marker genes.
  • hybridization conditions can be readily manipulated, and thus will generally be a method of choice depending on the desired results.
  • an appropriate means such as a label
  • a wide variety of appropriate indicator means are known in the art, including fluorescent, radioactive, enzymatic or other ligands, such as avidin/biotin, which are capable of giving a detectable signal.
  • fluorescent label or an enzyme tag such as urease, alkaline phosphatase or peroxidase, instead of radioactive or other environmental undesirable reagents.
  • enzyme tags colorimetric indicator substrates are known which can be employed to provide a means visible to the human eye or spectrophotometrically, to identify specific hybridization with complementary nucleic acid-containing samples.
  • the hybridization probes described herein will be useful both as reagents in solution hybridization as well as in embodiments employing a solid phase.
  • the test DNA or RNA
  • the test DNA is adsorbed or otherwise affixed to a selected matrix or surface.
  • This fixed, single-stranded nucleic acid is then subjected to specific hybridization with selected probes under desired conditions.
  • the selected conditions will depend on the particular circumstances based on the particular criteria required (depending, for example, on the G+C contents, type of target nucleic acid, source of nucleic acid, size of hybridization probe, etc.).
  • specific hybridization is detected, or even quantified, by means of the label. (Sambrook et al, 1989).
  • certain preliminary procedures are necessary to prepare the sample tissue and the probes before the detection of differential expression of marker genes in abnormal tissue as compared to that in normal tissue can be accomplished.
  • RNA purification RNA was isolated from frozen tissue samples by mincing of microdisected frozen tissue fragments with a razor blade and then adding 800 microliter of 5.6M guanidinium to increase mixing, followed by a 30 second microcentrifuge centrifugation at 14,000 rpm to remove particulate matter. The supernatant was then removed and the viscosity was reduced by multiple aspirations through a 22 gauge needle and then 200 ul of chloroform was added and the sample was incubated on ice for 15 minutes (during this time the sample was vortexed multiple times). Following incubation with chloroform, the sample was centrifuged for 15 minutes at 14,000 rpm and the aqueous layer was removed and ethanol precipitated.
  • RNA which is primarily derived from cells of epithelial origin.
  • the particulate material (remaining in the pellet from the 30 second centrifugation) was homogenized with a tissuemizer, washed with PBS, treated with collagenase at 37 °C for 30 minutes, sonicated, extracted with phenol/chloroform and ethanol precipitated.
  • cDNA libraries were constructed in lambda phage using polyA-selected mRNA from the following samples; cultured human breast epithelial cells, tissue from three reduction mammoplasty patients, tissue from three DCIS patients, and tissue from one
  • DCIS patient (patient #10) that showed a focus of microinvasion adjacent to an area of DCIS. Multiple punches were needed to obtain sufficient RNA for polyA selection and library construction. 200 ug of total RNA was obtained by pooling 20 punches from normal breast tissue (reduction mammoplasty samples) and 5-8 punches from DCIS lesions, presumably reflecting the greater cellularity of the DCIS samples.
  • cDNA libraries were constructed by first and second strand cDNA synthesis followed by the addition of directional synthetic linkers (ZAP-cDNA Synthesis Kit, Stratagene, La Jolla, California). The Xho I-Eco Rl linkered cDNA was then ligated into lambda arms, packaged with packaging extracts, and then used to infect XLl-blue bacteria resulting in cDNA libraries.
  • Random 25 bp primers were generated by a computer-based algorithm (Jotte and Holt, unpublished). Samples were denatured for two minutes at 95 °C followed by 40 cycles, each cycle consisting of denaturation for 1 minute at 94 °C, annealing for 2 minutes at 25 °C, and extension for 1 minute at 72 °C. The samples were then run on an 6% non-denaturing polyacrylamide gel, which was dried and autoradiographed. Specific bands were excised then reamplified with the same primers used for their generation.
  • Figure 2 shows this model for the induction and progression of pre-invasive breast disease based on study of the Vanderbilt cohort (Dupont et al, 1985) of more than 10,000 breast biopsies (follow-up rate 85 % ; median time of 17 years; 135 women developed breast cancer).
  • EXAMPLE 2 Identification of genes which are differentially expressed in DCIS Construction of cDNA libraries from DCIS lesions In order to study differential gene expression in DCIS, we collected cases of NCDCIS. The diagnosis of DCIS is made on histomorphologic grounds based on architectural, cytologic, and occasionally extent criteria. NCDCIS lacks comedo features and consists of microscopic intraductal lesions which fill and extend the duct, contain rigid internal architecture, and often have hyperchromatic and monomorphic nuclei. Study of non-comedo DCIS for differential marker gene expression indicates the diagnostic utility of comparison of marker gene expression in these tissues.
  • breast cancer Although the morbidity and mortality of breast cancer clearly results from invasion and metastasis, the development of breast cancer is clearly significant in its early stages for two basic reasons: 1) The molecular changes will presumably be simpler in early lesions than in later lesions which may have acquired numerous mutations or "hits"; and 2) Successful prevention strategies may require attacking cancer before it develops the capacity to invade or metastasize.
  • Non-comedo DCIS is the earliest deteirninant lesion which recurs locally as invasive cancer. Although comedo DCIS may be technically easier to study because the tumors are larger, its aggressiveness and the presence of numerous genetic alterations (such as p53 and erbB2) suggest that it may have advanced beyond the earliest stages of carcinogenesis.
  • Control mRNA was obtained from frozen tissue samples obtained from reduction mammoplasties and from cultured human breast epithelial cells. Because non-comedo DCIS is a microscopic lesion, we had to microlocalize regions of DCIS in biopsy samples. To accomplish this we prepared frozen sections in which we located regions of DCIS and then employed a 2 mm punch to obtain an abnormal tissue sample only from those regions that contained DCIS. This selective harvesting was accomplished by carefully aligning the frozen section slide with the frozen tissue block and identifying areas of interest. The harvest of the appropriate area was then confirmed with a repeat frozen section. A similar approach was used to isolate mRNA from lobules of normal breast in samples collected from a reduction mammoplasty.
  • FIG. 3 contains color photos of DCIS (abnormal) tissue, before (upper left panel) and after excisional punch biopsy (upper right panel). The lower panels show tissue samples of normal breast tissue (lower left panel), and invasive breast cancer (lower right panel).
  • RNA was isolated, purified, and employed to construct cDNA libraries.
  • RNA was isolated following mincing of tissue in 5.6M guanidinium isothiocyanate and 40% phenol, centrifugation to remove particulate matter, viscosity reduction by repeated aspiration through a 22 gauge needle, chloroform extraction and ethanol precipitation. In most samples there was particulate matter resistant to guanidinium-phenol extraction that was white in color and fibrous in appearance and was presumed to represent breast stroma. This stromal material was sparse in DCIS samples but abundant in samples obtained from normal breast tissue derived from reduction mammoplasties.
  • stromal material was minced with a tissuemizer, washed with PBS, treated with collagenase at 37°C for 30 minutes, sonicated, extracted with phenol/chloroform and ethanol precipitated. 200 ug of total RNA was obtained by pooling 20 punches from normal breast tissue (reduction mammoplasty samples) and 5-8 punches from DCIS lesions, presumably reflecting the greater cellularity of the DCIS samples. All libraries had greater than 50% inserts and contained between 2 X 10° and 7 X 10 7 phage recombinants with an average insert size varying between 500 and 1000 base pairs.
  • Plasmid DNA was prepared from the cDNA libraries following helper phage rescue and screened by two independent methods.
  • Figure 5 shows the results of differential display comparing cDNAs of several patient DCIS samples with cDNA obtained from normal breast epithelial cells and an early invasive cancer. Although few genes shown in this Figure are differentially expressed in the majority of samples with DCIS, the heterogeneity of gene expression in patient samples is seen.
  • the differential display method (Liang et al, 1992a and 1992b) allows simultaneous comparison of multiple tissue samples. Initial studies using this method (reverse transcriptase followed by PCR) were unsatisfactory because of unwanted amplification of contaminating DNA in tissue samples and the small size of many of the fragments identified by display. To circumvent some of these problems, we have attempted to combine the advantages of cDNA library screening with the advantages of differential display by:
  • Reduction mammoplasty 11 year old with virginal hyperplasia
  • Reduction mammoplasty 28 year old patient
  • DCIS patient #10 DCIS patient #10 from an area of invasive cancer adjacent to DCIS;
  • differential display method allows comparison of multiple tissue samples of pre-invasive or invasive breast cancer.
  • use of this method has successfully demonstrated that the M2 subunit ribonucleotide reductase gene is differentially expressed in 4 out of 5 pre-invasive breast cancer tissue samples.
  • M2 subunit is involved in the regulation of the ribonucleotide reductase gene and is found to be over-expressed in abnormal tissue samples.
  • differentially expressed genes may lead to discovery of genes which are potentially useful for breast cancer screening. Of particular interest are genes whose expression is restricted to breast epithelial cells and whose gene products are secreted. Screening for secreted proteins is possible by using the known hydrophobic sequences which encode leader sequences as one primer for differential display. The identification of secreted proteins which are specific for early breast pre- malignancy (or even early invasive cancer) would provide an important tool for early breast cancer screening programs. If a differentially expressed gene has not been cloned previously (or if details of its expression are unknown or uncertain) then nuclease protection assays or Northern blots can be performed on RNA prepared from tissue samples from a variety of tissues to determine if expression of this gene is restricted to breast. If necessary cDNA libraries prepared from other tissues can be added to the differential display screen as a way to identify only those genes which are expressed in early breast cancer and, in addition, are only expressed in breast tissue.
  • differentially expressed genes have been initially characterized for expression in pre-malignant and malignant breast disease
  • antibodies to the protein products of potentially useful genes can be developed and employed for immunohistochemistry (Harlow et al, 1988). This will provide an additional test to determine whether the expression of this gene is restricted to the breast. Subsequently, these antibodies will be used to detect the presence of this protein present in the blood of patients with pre- invasive and/or invasive cancer. By assaying for serum protein levels in the same patients who exhibited elevated expression of the gene in their tissue samples it will be possible to determine whether a gene product is being secreted into the blood.
  • EXAMPLE 7 Decreased expression of BRCAl accelerates growth and is observed during breast cancer progression
  • the BRCA 1 gene encodes a protein of 1863 amino acids with a predicted zinc finger domain observed in proteins which regulate gene transcription.
  • Fig. 1 The legend of Fig. 1 is as follows.
  • tissue samples were used for mRNA isolation: Normal tissue samples: NLl-cultured human breast epithelial cells, NL2- Histologically normal breast tissue from an 11 year old undergoing a reduction mammoplasty, NL4- histologically normal breast tissue from an 14 year old undergoing a reduction mammoplasty. Carcinoma-in-situ samples are #6, #8, #10, #12, #23 (comedo type), #41, #55; and invasive cancer samples #10CA (invasive cancer from the same patient with carcinoma- in-situ), 36CA, 1CA. All of these tissue samples were obtained from patients who had no family history of hereditary breast cancer and RNA preparation was performed as described above. PCR detection of BRCAl exon 24 in cDNA libraries from the following tissue samples is described in Figure 10A. Lane 1: human genomic DNA, lane 2: NLl, lane
  • Fig. 10B Nuclease protection assays of microdissected mRNA from tissue samples are described in Fig. 10B. One ug of mRNA from each tissue sample was hybridized with
  • NL4 were intensity in each sample relative to 1.
  • Sample 1 employs human leukocyte mRNA;
  • Samples 2-4 are NLl, NL2, and NL4;
  • Samples 5-9 are #6(2.8), 8(3.7), 10(2.8), 12 (5.9), and 55 (1.4); and
  • 10-12 are #10CA (0.07), 36CA (0.13), and 1CA (0.2).
  • Fig. 10 shows that BRCAl exon 24 mRNA is expressed at 5-10 fold higher levels in normal mammary tissue than in invasive breast cancer samples.
  • Initial studies showed detectable levels of BRCAl cDNA in a cDNA library prepared from a tissue sample with preinvasive carcinoma-in-situ but not in normal breast cancer invasive breast cancer cDNA libraries ( Figure 10A). Because this method is relatively insensitive we directly quantitated BRCAl mRNA by nuclease protection assays in
  • RNA samples obtained by our microdissection method described above indicate that expression of BRCAl mRNA in micro-dissected normal mammary epithelial tissue (lanes 2-4, Figure 10B) is 5-15 fold higher than that in breast cancer (lanes 10-12, Figure 10B).
  • the highest levels of BRCAl are observed in samples from non-comedo ductal carcinoma-in-situ (lanes 5-9, Figure 10B), a premalignant breast lesion with a finite, but relatively low rate of progression to invasion (Betsill et at. ,
  • RNA obtained from paired samples of invasive breast cancer and histologically normal breast tissue are shown in Fig. 11 A.
  • Samples in lanes 2 and 3 (first patient), 4 and 5 (second patient), 6 and 7 (third patient) are from invasive cancer and normal breast tissue respectively.
  • Lane 1 is NLl mRNA as described in legend to Fig. 10 and lane 8 is human leukocyte mRNA. Ratios of
  • RNA from a series of invasive breast cancer tissue samples (lanes 2-9 compared with NLl (lane 1) and leukocyte mRNA (lane 10) are shown in Fig. 11B.
  • Ratios of BRCAl/GAPD for each sample lane 1: 19.1, lane 2: 0.3, lane 3: 1.8, lane 4: 1.6, lane 5: 0.2, lane 6: 0.3, lane 7: 1.9, lane 8: 0, lane 9: 0.6.
  • RNA levels were four to eight fold higher in samples derived from normal breast than in samples derived from invasive breast cancer.
  • Figure 11B lanes 2-7.
  • FIG. 12 is graph showing growth rate of human primary mammary epithelial cells (A), MCF-7 cells (B), retinal pigmented epithelial cells (C), cultured as described below.
  • Points and bars represent the mean and the 95% confidence interval of triplicate counts of cells incubated with a single bolus of the indicated concentration of antisense or control sense deoxyribonucleotide .
  • the morphologic appearance of the cell lines was not noticeably changed by addition of antisense oligonucleotide, but the proliferative rate was faster.
  • Incubation of cells with 40 uM anti-BRCAl oligonucleotide produced accelerated growth of both normal ( Figure 12A) and malignant mammary cells (Figure 12B), but did not affect the growth of human retinal pigmented epithelial cells ( Figure 12C).
  • An intermediate dose of anti-BRCAl oligonucleotide produced a less pronounced but significant increase in cell growth rate.
  • ribonucleotide reductase constitutes the rate limiting step in DNA synthesis, we reasoned that it might be cell cycle regulated in a synchronous growth model such as MCF-7 cells which can be growth arrested by tamoxifen and then restimulated by estrogen (Aitken et al. 1985, Arteaga et al. 1989). MCF-7 cells were growth arrested by tamoxifen for 48 hours and then stimulated at time zero (0) with luM estradiol (+E) or control vehicle (-E). Inhibition of DNA synthesis by tamoxifen and induction of synthesis by estrogen were confirmed by nuclear labelling studies with tritiated thymidine.
  • Fig. 13 panels A and B show that transcription of the ribonucleotide reductase M2 gene is cell cycle regulated, inhibited by tamoxifen, and induced by estrogen.
  • Fig. 13 A is a Northern blot of mRNA from synchronized MCF-7 cells. At the indicated time in hours, total cellular RNA was isolated and Northern blotting performed using the 1.6 Kb Eco Rl fragment from our cloned human ribonucleotide reductase cDNA described above. Two mRNA species of 1.6 and 3.4 Kb are observed in these studies.
  • Fig. 13B shows nuclear runon studies of synchronized MCF-7 cells were performed by our published methods (Holt et al 1988) employing the 1.6 Kb fragment of ribonucleotide reductase described above (RR); the 1.8 Kb fragment of Topoisomerase H (Topo) described in the Olsen et al. 1993); the 1.0 Kb cyclophilin gene (Thompson et al. 1994) used as a constitutive control; and 18S ribosomal RNA (Thompson et al. 1994).
  • Con represents cells which were grown for 48 hours but not treated with tamoxifen.
  • Ribonucleotide reductase mRNA levels are highest in samples treated with 40 uM anti-BRCAl oligonucleotide for both primary mammary epithelial cells and for MCF-7 cells (Fig. 14).
  • Antisense inhibition of BRCAl results in a 70-90% inhibition of mRNA levels in anti-BRCAl treated cells compared with cells treated with the "sense" control oligonucleotide (compare lanes 9 and 10, Fig. 14).
  • MCF-7 cells have lower levels of BRCAl than the normal mammary epithelial cells (compare lanes 1 and 5, Fig. 14) anti-BRCA 1 since the antisense inhibition may drop BRCAl levels below a critical threshold which normally functions to inhibit growth.
  • RNA samples Freshly obtained breast biopsy or reduction mammoplasty specimens were frozen and then RNA was obtained following the microdissection method described above. Lesions were selected which were microlocalized and homogenous so that pure lesions could be obtained by 2 mm punches. Samples which had admixed normal epithelial, carcinoma-in-situ, or invasive cancer were not used for this study. Family history was obtained by chart review and/or interview to exclude familial breast cancer cases.
  • PCR primers were derived from BRCAl sequence in GenBank (Accession number U 14680); forward 5'
  • CAATTGGGCAGATGTGT 3' and reverse 5' CTGGGGGATCTGGGGTATCA 3' which amplify a 113 bp region from exon 24, corresponding to bases 5587 to 5699 of the human BRCAl. This region was selected because this exon has not been reported to be differentially spliced unlike more 5' exons.
  • the BRCAl probe was cloned by subcloning this 113 bp band from normal human genomic DNA into PCRscriptSK and screening for correct orientation.
  • RNA from each tissue sample was hybridized with 32P-labelled, T7 polymerase-generated RNA probes for BRCAl and human glyceraldehyde-3-phosphate dehydrogenase (GADP) which would produce expected protected fragments of 113 and 140 respectively.
  • GADP human glyceraldehyde-3-phosphate dehydrogenase
  • the construction and use of the GADP probe for RNA standardization has been described above.
  • the probe for ribonucleotide reductase M2 mRNA is the same as above and detects a 200 bp protected fragment.
  • Unmodified deoxyribonucleotide were analyzed by gel electrophoresis and UV shadowing and shown to be homogenous and of appropriate size. These oligonucleotide were purified by multiple lyophilization and solubilized in buffered media as described (Holt et al. 1988). Sequence of the unmodified antiBRCAl oligonucleotide 5' AAGAGCAGATAAATCCAT 3' and the complementary sense oligonucleotide 5' ATGGATTTATCTGCTCTT 3' correspond to the presumed translation initiation site at bases 12-137 of the GenBank sequence.
  • oligonucleotide sequence was searched against Genbank and no significant homologies were identified to genes except BRCAl. Oligonucleotides were used according to our published methods (Holt et al. 1988).
  • Primary mammary epithelial cells were cultured in serum-free medium supplemented with epidermal growth factor, insulin, hydrocortisone, ethanolamine, phosphorylethanolamine, and bovine pituitary extract.
  • MCF-7 cells were cultured in Minimum Essential Medium Eagle (Modified) with Earle's salts and 2g/L sodium bicarbonate m supplemented with 2mM L- glutamine, GMS-A (Gibco Cat.
  • Example 8 Gene Therapy method based on determination of the function of the BRCAl Gene
  • Viral vectors containing a DNA sequence that codes for a protein having an amino acid sequence as essentially set forth in SEQ ID NO:49 can be constructed using techniques that are well known in the art. This sequence includes the BRCAl gene product. Viral vectors containing a DNA sequence essentially as set forth in SEQ ID NO:47 (the BRCAl gene) can be also constructed using techniques that are well known in the art. Retroviral vectors, adenoviral vectors, or adeno-associated viral vectors are all useful methods for delivering genes into breast cancer cells. An excellent candidate for use in breast cancer gene therapy is a Moloney-based retroviral vector with a breast selective MMTV promoter which we have reported previously (Wong et al).
  • the viral vector is constructed by cloning the DNA sequence essentially as set forth in SEQ ID:47 into a retroviral vector such as a breast selective vector. Most preferably, the full-length (coding region) cDNA for BRCAl is cloned into the retroviral vector.
  • the retroviral vector would then be transfected into virus producing cells in the following manner: Viruses are prepared by transfecting PA317 cells with retroviral vector DNAs which were purified as described in Wong et al. Following transfection, the PA317 cells are split and then treated with G418 until individual clones can be identified and expanded.
  • Each clone is then screened for its titer by analyzing its ability to transfer G418 resistance (since the retroviral vector contains a Neomycin resistance gene).
  • the clones which have the highest titer are then frozen in numerous aliquots and tested for sterility, presence of replication-competent retrovirus, and presence of mycoplasm.
  • the methods generally employed for construction and production of retroviral vectors have been described in Muller, 1990.
  • Viral vector expressing BRCAl is infused into either solid tumors or infused into malignant effusions as a means for altering the growth of the tumor (since it is shown above that the BRCAl gene product decreases the growth rate of breast cancer cells). Because viral vectors can efficiently transduce a high percentage of cancer cells, the tumors would be growth inhibited.
  • a method for screening compounds that activate the promoter of the BRCAl gene is designed in the following way.
  • a promoter sequence is a DNA segment that upregulates the expression of a gene.
  • a sequence essentially as set forth in SEQ ID NO:48 can be ligated into a suitable vector, such as a plasmid, that contains a reporter gene using standard recombinant DNA techniques of restriction enzyme digests, ligation of fragment into vector, and transformation of bacteria.
  • SEQ ID NO:48 includes the promoter sequence of the BRCAl gene.
  • a reporter gene is a gene that produces a readily detectable product. Examples of appropriate reporter genes which could be employed for this purpose include Beta-galactosidase or the chloramphenicol acetyltransferase gene.
  • the BRCAl promoter/reporter gene combination can then be cloned into an expression vector or viral vector by standard recombinant DNA methods.
  • Breast cancer cells can then be transfected with the expression vector containing the BRCAl promoter/reporter gene using standard transfection methods which we have reported previously (Holt et al. PNAS 1986).
  • a stable transformant with appropriate low level expression will be identified and then characterized to demonstrate proper DNA integration and expression. Methods of establishing and characterizing stable transformants have been described (Holt. MCB, 1994). Once an appropriate stable transformant cell line is identified, then we can plate the cell line in a manner than permits screening of hundreds or thousands of drugs or biological agents (for example in multiple 96 well microtiter plates). Level of expression of the reporter gene can be quantitated and agents which activate expression are thus identified.
  • a positive result results in increased levels of the reporter gene resulting in either an increase in color (Beta-galactosidase assay) or specific radioactivity (Chloramphenicol acetyltransferase activity) through a reaction between the protein encoded by the reporter gene and a compound in the reaction medium.
  • the compound produced by the reaction between the reporter gene protein and the compound in the reaction medium is the cause of the increase in color or specific radioactivity.
  • These compounds can be called indicator compounds in that their presence indicates that the drug or biologial agent activated the BRCAl promoter.
  • Beta-galactosidase or chloramphenicol acetyltransferase assays have been reported (Holt et. al. MCB 1994). This method would be useful for initial screening of agents which increase BRCAl expression. These agents could then be tested in more rigorous assays of breast cancer growth such as nude mouse tumor assays (Arteaga et al). This approach allows mass screening of large numbers of agents, sparing more rigorous animal tests for only promising compounds which score in the reporter gene assay described herein.
  • Cheickh MB P Rouanet, G Louason, P Jeanteur, and C Theillet. 1992. An attempt to define sets of cooperating genetic alterations in human breast cancer. Int. J. Cancer 51:542-547. Chen L-C, W Kurisu, B-M Ljung, ES Goldman, Dmorre H, and HS Smith.
  • Figure 2 Model for premalignant conditions, highlighting magnitude of risk for progression to clinical malignancy.
  • Terms from human breast neoplasia are used: no proliferative disease (No Pro), proliferative disease without alypia (PDWA), typical hyperplasia (AH), carcinoma in situ (CIS).
  • No Pro no proliferative disease
  • PDWA proliferative disease without alypia
  • AH typical hyperplasia
  • CIS carcinoma in situ
  • Figure 5 Differential display of cDNAs obtained from patient tissue samples and controls. Rescued cDNA library samples were used as templates for low stringency PCR with the primers 5'GATGAGTTCGTGTCCGTACAACTGG3' and 5' GGTTATCGAAATCAGCCACAGCGCC3'; 40 cycles were performed at conditions described above. Samples (See legend to Figure 4): Lane 1 - #12; Lanes 2 and 3: separate phage rescues of NLl to show reproducibility of the assay; Lane 4 - #8; Lane 5 - #10; Lane 6 - #10CA; Lane 7 - control from the rescued phage vector without cDNA inserts. Arrows mark cDNAs which are overexpressed in DCIS versus normal. Arrowheads mark cDNAs which are differentially expressed in the invasive cancer (note this may reflect contamination from stromal cells). The bar marks a cDNA which is expressed in normal breast cells at higher levels than in DCIS or invasive cancer.
  • Figure 7 Expression of DCIS-1 mRNA in tissue mRNA samples analyzed by RNase protection assay. Probes: GADH probe and DCIS-1 clone probe which was generated by linearizing the rescued plasmid with Pvu H and should generate a 200 bp protected fragment. RNA samples were labeled as in the legend to Figure 4. SEQUENCE LISTINGS
  • ORGANISM Homo sapiens sapiens
  • CELL TYPE ductal carcinoma in situ
  • H CELL LINE: not derived from a cell line
  • ORGANISM Homo sapiens sapiens
  • CELL TYPE ductal carcinoma in situ
  • H CELL LINE: not derived from a cell line
  • ORGANISM Homo sapiens sapiens
  • ORGANISM Homo sapiens sapiens
  • ORGANISM Homo sapiens sapiens
  • TITLE A strong candidate gene for the breast and ovarian cancer susceptibility gene BRCAl.
  • 850 855 860 aag cgc cag tea ttt get ccg ttt tea aat cca gga aat gca gaa gag 2759 Lys Arg Gin Ser Phe Ala Pro Phe Ser Asn Pro Gly Asn Ala Glu Glu
  • 900 905 910 aat gag tct aat ate aag cct gta cag aca gtt aat ate act gca ggc 2903 Asn Glu Ser Asn He Lys Pro Val Gin Thr Val Asn He Thr Ala Gly 915 920 925 ttt cct gtg gtt ggt cag aaa gat aag cca gtt gat aat gcc aaaa tgt 2951 Phe Pro Val Val Gly Gin Lys Asp Lys Pro Val Asp Asn Ala Lys Cys
  • 930 935 940 agt ate aaa gga ggc tct agg ttt tgt eta tea tct cag ttc aga ggc 2999 Ser He Lys Gly Gly Ser Arg Phe Cys Leu Ser Ser Gin Phe Arg Gly
  • Gin Glu Met Ala Glu Leu Glu Ala Val Leu Glu Gin His Gly Ser Gin

Abstract

La présente invention concerne un procédé pour détecter et diagnostiquer un cancer du sein pré-invasif en identifiant, les gènes exprimés, de manière différentielle, dans les tissus cancéreux pré-invasifs du sein. Les gènes exprimés de manière différentielle peuvent être utilisés comme marqueurs génétiques pour indiquer la présence de tissus cancéreux pré-invasifs. Des techniques de prélèvement de tissus, effectuées au microscope, combinées à des techniques de visualisation différentielle ou de dosage différentiel de bibliothèques d'ADNc sont utilisées pour déterminer l'expression différentielle de gènes dans les premières étapes du cancer du sein. L'expression différentielle des gènes dans les tissus cancéreux préinvasifs du sein est confirmée par l'amplification de type transcriptase inverse - PCR, les dosages de protection de la nucléase et l'hybridation in situ de l'épithélioma dendritique dans l'ARN des tissus in situ et dans l'ARN des tissus témoins. La présente invention fournit également un procédé de dosage des composés qui induisent l'expression du gène BRCA1 dont le produit régule négativement la croissance cellulaire dans les cellules épithéliales mammaires normales et malignes. L'invention concerne également un procédé de thérapie génique utilisant ce gène.
EP95910094A 1995-01-17 1995-01-17 Procede de detection et de traitement du cancer du sein Withdrawn EP0804453A4 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US373799 1989-06-29
US37379995A 1995-01-17 1995-01-17
PCT/US1995/000608 WO1995019369A1 (fr) 1994-01-14 1995-01-17 Procede de detection et de traitement du cancer du sein

Publications (2)

Publication Number Publication Date
EP0804453A1 true EP0804453A1 (fr) 1997-11-05
EP0804453A4 EP0804453A4 (fr) 2004-08-11

Family

ID=23473920

Family Applications (1)

Application Number Title Priority Date Filing Date
EP95910094A Withdrawn EP0804453A4 (fr) 1995-01-17 1995-01-17 Procede de detection et de traitement du cancer du sein

Country Status (3)

Country Link
EP (1) EP0804453A4 (fr)
AU (1) AU707348B2 (fr)
CA (1) CA2210396A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2002503943A (ja) * 1994-08-12 2002-02-05 ミリアド・ジェネティックス・インコーポレイテッド １７ｑ−連鎖乳癌および卵巣癌感受性遺伝子におけるイン・ビボ突然変異および多形性

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994006910A1 (fr) * 1992-09-18 1994-03-31 Canji, Inc. Therapie genique au moyen d'un vecteur retroviral a gene de suppression tumorale
WO1994016080A1 (fr) * 1993-01-08 1994-07-21 Exemplar Corporation Procede in vitro/in vivo d'identification de medicaments anti-neoplasiques
EP0705903A1 (fr) * 1994-08-12 1996-04-10 Myriad Genetics, Inc. Mutations in vivo et polymorphismes du gène de susceptibilité associé au cancer du sein et des ovaires associé au 17Qq

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994006910A1 (fr) * 1992-09-18 1994-03-31 Canji, Inc. Therapie genique au moyen d'un vecteur retroviral a gene de suppression tumorale
WO1994016080A1 (fr) * 1993-01-08 1994-07-21 Exemplar Corporation Procede in vitro/in vivo d'identification de medicaments anti-neoplasiques
EP0705903A1 (fr) * 1994-08-12 1996-04-10 Myriad Genetics, Inc. Mutations in vivo et polymorphismes du gène de susceptibilité associé au cancer du sein et des ovaires associé au 17Qq

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BROWN M A ET AL: "Regulation of BRCA1." NATURE. ENGLAND 1994 DEC 22-29, vol. 372, no. 6508, 22 December 1994 (1994-12-22), page 733 XP002283560 ISSN: 0028-0836 *
KUMAR C C: "SETTING UP REPORTER-GENE BASED ASSAY SYSTEMS FOR SCREENING ANTINEOPLASTIC DRUGS" PHARMACEUTICAL TECHNOLOGY, EUGENE, OR, US, vol. 15, June 1991 (1991-06), pages 26-28,32-34, XP009010062 *
See also references of WO9519369A1 *
THOMPSON M E ET AL: "DECREASED EXPRESSION OF BRCA1 ACCELERATES GROWTH AND IS OFTEN PRESENT DURING SPORADIC BREAST CANCER PROGRESSION" NATURE GENETICS, NEW YORK, NY, US, vol. 9, no. 4, April 1995 (1995-04), pages 444-450, XP001011260 ISSN: 1061-4036 *

Also Published As

Publication number Publication date
AU707348B2 (en) 1999-07-08
EP0804453A4 (fr) 2004-08-11
CA2210396A1 (fr) 1995-07-20
AU1831795A (en) 1995-08-01

Similar Documents

Publication Publication Date Title
US6342483B1 (en) Method for detection and treatment of breast cancer
US5677125A (en) Method of detection and diagnosis of pre-invasive cancer
US7807373B2 (en) Prostate specific gene, PCGEM1, and methods of using PCEGM1 to detect, treat, and prevent prostate cancer
EP1814909B1 (fr) Utilisation de aimp2dx2 pour diagnostiquer et traiter un cancer
EP1426381A1 (fr) Protéine épithéliale, ADN en provenant, et leur utilisation pour la détéction précoce du cancer
KR20070057132A (ko) 암에 대한 유전자 ｈｏｘｂ１３의 중요성
EP1365034A2 (fr) Procédés et compositions pour la prédiction, le diagnostic, le pronostic, la prévention et le traitement de neoplasie maligne
CA2428112A1 (fr) Methodes et compositions pour la prevision, le diagnostic, le pronostic, la prevention et le traitement de la neoplasie maligne
US20060035292A1 (en) Differential diagnosis of cancer and other conditions based on expression of p63
JP2007512804A (ja) 癌研究のための方法及びキット
AU6833794A (en) Von hippel-lindau (vhl) disease gene and corresponding cdna and methods for detecting carriers of the vhl disease gene
WO1999045147A1 (fr) Nouveau procede de detection et de surveillance d'un cancer endometrial ou uterin
US6312890B1 (en) Partial intron sequence of von hippel-lindau (VHL) disease gene and its use in diagnosis of disease
JP4942248B2 (ja) 前立腺特異的遺伝子、ｐｃｇｅｍ１、ならびに前立腺癌を検出、治療および予防するための、ｐｃｇｅｍ１の使用方法
JP2003510075A (ja) 良性および悪性の前立腺組織におけるｐｃａ３メッセンジャーｒｎａ種
AU707348B2 (en) Method for detection and treatment of breast cancer
EP1354962B1 (fr) Utilisation du gene slug ou de ses produits de transcription ou d'expression dans la detection et/ou le traitement de cellules cancereuses
US20040235073A1 (en) Kruppel-like transcriptional factor KLF4/GKLF and uses thereof
JP2003528630A (ja) ヒト遺伝子および発現産物
JP2004313167A (ja) 薬剤耐性マーカーおよびその利用
JP2003530077A (ja) Ｐｃａｍ−１マーカータンパク質、ｐｃａｍ−１をコードする核酸配列及びｐｃａｍ−１の検出のための免疫アッセイ
US20030219761A1 (en) Novel prostate-specific or test-specific nucleic acid molecules, polypeptides, and diagnostic and therapeutic methods
US20030198961A1 (en) Determining cancer aggressiveness
WO2003025217A1 (fr) Procede de pronostic
Liu Isolation of candidate genes related to human tumor invasiveness from breast cancer cell lines by mRNA differential display

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19970806

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE

RIC1 Information provided on ipc code assigned before grant

Ipc: 7C 07K 14/47 B

Ipc: 7G 01N 33/574 B

Ipc: 7C 12Q 1/68 A

A4 Supplementary search report drawn up and despatched

Effective date: 20040629

17Q First examination report despatched

Effective date: 20040923

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20060303