EP0786010A1 - Cell-type specific gene transfer using retroviral vectors containing antibody-envelope and wild-type envelope-fusion proteins - Google Patents

Cell-type specific gene transfer using retroviral vectors containing antibody-envelope and wild-type envelope-fusion proteins

Info

Publication number
EP0786010A1
EP0786010A1 EP95913506A EP95913506A EP0786010A1 EP 0786010 A1 EP0786010 A1 EP 0786010A1 EP 95913506 A EP95913506 A EP 95913506A EP 95913506 A EP95913506 A EP 95913506A EP 0786010 A1 EP0786010 A1 EP 0786010A1
Authority
EP
European Patent Office
Prior art keywords
envelope
targeting
retroviral vector
peptide
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP95913506A
Other languages
German (de)
English (en)
French (fr)
Other versions
EP0786010A4 (ja�@�@
Inventor
Ralph C. Dornburg
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Rutgers State University of New Jersey
Rutgers Health
Original Assignee
University of Medicine and Dentistry of New Jersey
Rutgers State University of New Jersey
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Medicine and Dentistry of New Jersey, Rutgers State University of New Jersey filed Critical University of Medicine and Dentistry of New Jersey
Publication of EP0786010A4 publication Critical patent/EP0786010A4/xx
Publication of EP0786010A1 publication Critical patent/EP0786010A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6901Conjugates being cells, cell fragments, viruses, ghosts, red blood cells or viral vectors
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/04Fusion polypeptide containing a localisation/targetting motif containing an ER retention signal such as a C-terminal HDEL motif
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/30Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/40Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/70Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/74Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor
    • C07K2319/75Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor containing a fusion for activation of a cell surface receptor, e.g. thrombopoeitin, NPY and other peptide hormones
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/13011Gammaretrovirus, e.g. murine leukeamia virus
    • C12N2740/13041Use of virus, viral particle or viral elements as a vector
    • C12N2740/13043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/13011Gammaretrovirus, e.g. murine leukeamia virus
    • C12N2740/13041Use of virus, viral particle or viral elements as a vector
    • C12N2740/13045Special targeting system for viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00Vectors comprising a targeting moiety
    • C12N2810/50Vectors comprising as targeting moiety peptide derived from defined protein
    • C12N2810/60Vectors comprising as targeting moiety peptide derived from defined protein from viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00Vectors comprising a targeting moiety
    • C12N2810/50Vectors comprising as targeting moiety peptide derived from defined protein
    • C12N2810/60Vectors comprising as targeting moiety peptide derived from defined protein from viruses
    • C12N2810/6045RNA rev transcr viruses
    • C12N2810/6054Retroviridae
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00Vectors comprising a targeting moiety
    • C12N2810/50Vectors comprising as targeting moiety peptide derived from defined protein
    • C12N2810/80Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates
    • C12N2810/85Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian
    • C12N2810/859Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian from immunoglobulins

Definitions

  • the retroviral vector particles comprise a retroviral vector having a chimeric envelope protein consisting of an antigen binding site of an antibody or another peptide fused to the envelope protein of the retroviral vector.
  • the antigen binding site or the other peptide replaces or disrupts the natural viral receptor binding site.
  • the resulting chimeric envelope is referred to as the "targeting envelope”.
  • This invention relates to retroviral vectors that contain not only the targeting envelope but also wild-type envelope protein. The presence of wild-type envelope in addition to the targeting envelope acts as a helper molecule by supplying a fully functional membrane fusion domain which may be impaired in targeting envelopes.
  • This helper function enables and/or enhances infection of cells that do not contain a receptor for the wild-type envelope but do contain a receptor for the binding of the targeting molecule.
  • This invention also relates to a method for preparing the retroviral particles and for using the retroviral vectors to introduce genes into vertebrate cells. O 95/23846 . 2 .
  • Retroviral vectors are the most efficient tools to introduce genes into vertebrate cells. Clinical experiments have been conducted to use retrovirus vectors to cure a genetic disease in humans (adenosine deaminase (ADA) deficiency). Besides correcting inborn errors of metabolism, gene therapy is also being tested in clinical trials to cure cancer and various other diseases (Science 1992, Vol. 258, pp. 744-746).
  • ADA adenosine deaminase
  • Retroviral vectors are basically retroviral particles that contain a genome in which all viral protein coding sequences have been replaced with the gene(s) of interest. As a result, such viruses cannot further replicate after one round of infection. Retroviral vector particles are produced by helper cells ( Figure 1). Such helper cells are cell lines that contain plasmid constructs which express all retroviral proteins necessary for replication. After transfection of the vector genome into such helper cells, the vector genome is encapsidated into virus particles (due the presence of specific encapsidation sequences). Virus particles are released from the helper cell carrying a genome contaimng only the gene(s) of interest ( Figure 1). In the last decade, several retroviral vector systems, derived from chicken or murine retro viruses, have been developed for the expression of various genes (for reviews see Temin, 1987; Gilboa, 1990).
  • Retroviral vectors have several limitations. Besides the limited genome size that can be encapsidated into viral particles, the most limiting factor for the application of retroviral vectors is the restricted host range of the vector particle. Some retroviruses can only infect cells of one species (ecotropic retroviruses) or even only one cell-type of one species (e.g. , HTV). Other retroviruses have a very broad host range and can infect many different types of tissues of many different species (amphotropic retroviruses).
  • the initial step of retroviral infection is the binding of the viral envelope (env) glycoprotein to specific cell membrane receptors, the nature of which is unknown for most retroviruses.
  • the interaction of the viral env retroviral proteins necessary to form (a) retroviral core proteins and (b) targeting envelope.
  • B) Helper cells that contain targeting plus wild-type envelope are made by transfecting plasmids expressing genes encoding such proteins. After transfection of the retroviral vector that has the gene of interest, the retroviral vector RNA genome is encapsidated into retroviral vector particles displaying the envelope.
  • Figure 5 is a diagram of a eucaryotic gene expression vector constructed.
  • the gene expression vector was derived from a similar vector described recently (Sheay,W. et al., 1993).
  • Figure 6 is a diagram illustrating plasmids expressing spleen necrosis virus, SNV, core structure proteins, wild-type envelope proteins, and various targeting envelope proteins.
  • the present invention pertains to a retroviral vector particle having defined target cell specificity mediated by the nature of the targeting envelope which can be a chimeric protein consisting of an antigen binding site of an antibody or another peptide that binds to a specific cell surface structure (e.g., the receptor binding domain of another virus) fused to carboxy terminal parts of the retroviral envelope protein.
  • the targeting envelope mediates the first step of retroviral infection which is the binding of the virus to a specific cell-surface receptor.
  • the present invention also pertains to retroviral particles that contain a wild-type envelope in addition to the targeting envelope. The presence of the wild-type envelope serves to act as a helper molecule to improve or supplement a functional membrane fusion domain.
  • the wild-type envelope is only involved in the second step of retroviral infection, which is the efficient fusion of the viral and the cellular membranes.
  • the present invention also pertains to the construction of retroviral vector particles containing a wild-type envelope in addition to a targeting envelope which can compensate for the loss of infectivity observed with retroviral particles that contain targeting envelopes alone.
  • the present invention pertains to a retroviral vector particle having target cell specificity which comprises a retroviral vector protein with the cell surface receptor is very specific and determines cell-type specificity of a particular virus (Weiss et al, 1985).
  • the envelope protein of all known retroviruses is made up of two associated peptides, (e.g. , gp70 and p20(E) in SNV). These peptides are derived by proteolytic cleavage from the same precursor (gPR90env) encoded by the retroviral env gene.
  • One peptide p20(E) also termed TM, anchors the protein in the membrane of the virus and, as shown with HIV, mediates the fusion of the virus and cell membranes.
  • the second peptide gp70 also termed SU, mediates the binding of the virus to its receptor and, therefore, determines the host range (Weiss et al., 1985; Varmus and Brown, 1989).
  • Figure 1 is a diagram illustrating helper cells expressing retroviral proteins.
  • A) Helper cells are made by the transfection of plasmids expressing all retroviral proteins necessary to form infectious virus particles.
  • C) Helper cells that contain a plasmid express a modified envelope gene.
  • FIG. 2 is a diagram illustrating plasmids expressing mutant envelope genes of spleen necrosis virus (SNV).
  • Figure 3 shows the sequence of the single chain antibody gene (scFv) against the hapten DNP.
  • FIG. 4 is a diagram illustrating helper cells expressing targeting envelopes plus wild-type envelopes. Such helper cells are made by the transfection of plasmids expressing the corresponding proteins.
  • a helper cell expressing all having a targeting peptide fused to the envelope protein of the retroviral vector to form a targeting envelope, wherein the targeting peptide replaces or disrupts the natural viral receptor binding site and the targeting peptide is the antigen binding site of an antibody, the receptor binding peptide of another virus, or is a peptide that specifically binds to a specific receptor of the target.
  • the present invention pertains to a cell type specific method for introducing genes into vertebrate cells using retroviral vectors which comprises administering to the cells a retroviral vector particle having target cell specificity which comprises a retroviral vector having a targeting peptide fused to the envelope protein of the retroviral vector to form a targeting envelope, wherein the targeting peptide replaces or disrupts the natural viral receptor binding site and the targeting peptide is the antigen binding site of an antibody, the receptor binding peptide of another virus, or is a peptide that specifically binds to a specific receptor of the target.
  • the present invention pertains to a method for preparing a retroviral vector particle having target cell specificity which comprises a retroviral vector having a targeting peptide fused to the envelope protein of the retroviral vector to form a targeting envelope, wherein the targeting peptide replaces or disrupts the natural viral receptor binding site and the targeting peptide is the antigen binding site of an antibody, the receptor binding peptide of another virus, or is a peptide that specifically binds to a specific receptor of the target, which comprises the steps of: (a) providing a targeting peptide;
  • the retroviral vector particles comprise a retroviral vector having a chimeric envelope protein consisting of an antigen binding site of an antibody or another peptide fused to the envelope protein of the retroviral vector.
  • the antigen binding site or the other peptide replaces or disrupts the natural viral receptor binding site.
  • the resulting chimeric envelope is referred to as the "targeting envelope”.
  • This invention relates to retroviral vectors that contain not only the targeting envelope but also wild-type envelope protein. The presence of wild-type envelope in addition to the targeting envelope acts as a helper molecule by supplying a fully functional membrane fusion domain which may be impaired in targeting envelopes.
  • This helper function enables and/or enhances infection of cells that do not contain a receptor for the wild-type envelope but do contain a receptor for the binding of the targeting molecule.
  • This invention also relates to a method for preparing the retroviral particles and for using the retroviral vectors to introduce genes into vertebrate cells.
  • retroviral vector particles may be constructed that contain modified envelope proteins that recognize only a cell surface structure (receptor) specific for the target cell of interest. Proteins known to recognize specific structures of proteins are antibody molecules. Hence, to make a retroviral vector particle specific for a cell-type of interest, the viral receptor binding peptide may be replaced with an antigen binding site of an antibody molecule. To test whether vector particles containing such antigen binding sites are competent for infection, model systems were developed using an antigen binding peptide of an antibody against the hapten dinitrophenol (DNP) fused to envelope gene of spleen necrosis virus (SNV).
  • DNP hapten dinitrophenol
  • SNV spleen necrosis virus
  • anti-hapten (anti-DNP) antibody has many advantages. (1) The interaction of this antigen with the antibody is well characterized (Davies and Metzger, 1983). (2) The hapten is easily available. (3) A large variety of cells (which cannot be infected with wild-type vector particles) can be conjugated with this hapten. DNP conjugated cells bind antibodies directed against this hapten. Thus, the hapten may mimic the (abundant) presence of a receptor for the chimeric vector particle. (4) Anti-hapten antibodies are frequently internalized by the cell. Thus, in the case, the construction of chimeric envelope proteins will destroy the membrane fusion domain of TM, this property may compensate for this loss of function. (5) An in vitro binding assay can be easily established to test for virus particle formation and binding of such viruses to DNP.
  • the retroviral vector particles comprise a retroviral vector having a targeting envelope which mediates the binding of the retroviral vector particle to a cell surface receptor of the target cell. This binding is very specific and determines the host range and cell-type specificity.
  • the particles also have a wild type envelope. Using target cells that do not contain a viable receptor for the wild type envelope, the function of the wild-type envelope is only to supply a fully functional membrane fusion domain.
  • This invention also relates to the method for preparing the retroviral vector particles and a method for using the retroviral vectors to introduce genes into vertebrate cells.
  • retroviral particles harvested from DSN cells were used (Dougherty.J.P. and Temin,H.M. 1989) to infect human HeLa and Col-1, as well as hamster CHTG (ret. 1) cells (Tables 1 and 2).
  • DSN cells are standard retroviral packaging cells containing a plasmid expressing the retroviral core proteins and another plasmid expressing wild-type envelope (Dougherty ,J. P. and Temin,H.M., 1989).
  • Targeting of human cancer cells with SNV retroviral vectors.
  • the antigen binding site of an antibody directed against the hapten DNP was used.
  • the antigen binding site used in the targeting envelope was derived from an antibody (termed B6.2, Bird,R.E. et al., 1988 and Colcher,D. et al., 1990) directed against a cell-surface protein expressed on various human cancers (e.g. HeLa and Col-1 cells, Bird,R.E. et al., 1988 and Colcher,D. et al., 1990).
  • the gene constructs ( Figure 6) for the expression of the targeting envelope are similar to that described above.
  • Targeting CHTG cells that express a receptor for ecotropic murine leukemia virus To test whether retroviral particles derived from SNV displaying targeting molecules other than antigen binding sites of an antibody are infectious, targeting envelopes were constructed that contained the receptor binding peptide of another virus (murine leukemia virus) fused to the envelope of SNV. Infectivity of virus particles displaying such targeting envelopes with and without wild-type envelope was tested.
  • SNV SNV
  • pSelect a vector specifically designed for site directed mutagenesis
  • pSNV-env-mC ( Figure 2a) contains a new restriction enzyme site located between a hydrophobic and a hydrophilic peptide domain. In this mutant, the change in the nucleotide sequence does not alter the amino acid sequence. Thus, pSNV-env-mC can be considered as a positive control.
  • pSNV-env-mD contains a new restriction enzyme site within the cleavage site of the envelope precursor.
  • the introduction of the mutation also altered the amino acid sequence destroying the common motive found in all cleavage sites of all retroviruses investigated. Thus, it was expected that the resulting envelope precursor would not be cleaved, and, therefore, would not to give rise to infectious virus particles.
  • Mutated env genes were inserted into pHB3, a eucaryotic gene expression vector ( Figure 2).
  • a SacII (located in the polylinker of pBluescript) to Smal (located in the 3' PCR primer) fragment was inserted into eucaryotic expression vectors replacing amino terminal parts of the envelope gene as follows: in pTC4, the SacII (located upstream of the ATG codon of the env gene) to Smal fragment of env was replaced with the scFv gene; in pTC5 the SacII to the MscI fragment of env was replaced with the scFv gene ( Figure 2C and 2D, respectively). After cloning, the antibody- envelope junctions were sequenced to verify the maintenance of the correct reading frame of the chimeric gene.
  • DNP-BSA was used to raise the initial antibodies from which the scFv genes have been derived.
  • DNP-BSA was coupled to activated Sepharose following the protocol recommended by the supplier (Sigma).
  • An Elisa assay with a anti-DNP antibody (kindly provided by Dr. S.Pestka) confirmed the successful coupling reaction.
  • 100ml of tissue culture supernatant medium was incubated with 50ml of DNP-BSA-Sepharose for 30 minutes at 37°C. After incubation, the sepharose particles were pelleted by centrifugation in a Qualitron minicentrifuge for 30 seconds. The pellets were rinsed once with PBS.
  • the PBS was removed and reverse transcription assays were performed by adding the reaction to the sepharose pellet.
  • the reverse transcription assay was done using standard procedures; incorporation of 32PdTTP into cDNA was determined by TCA precipitation as described (Schleif and Wensink, 1981).
  • the envelope expression plasmids shown in Figure 2 were transfected into D17 cells (a dog osteosarcoma cell-line) in cotransfection with pBRl and pJD214HY ( Figure 2), plasmids expressing the retroviral core proteins, and containing a retroviral vector for the expression of the hygromycin phosphotransf erase gene, respectively (see also Figure 1). Cells were selected for hygromycin resistance. After selection for hygromycin resistance, virus was harvested from confluent cell cultures and infectivity assays were performed (see below).
  • Infected target cells were selected for hygromycin resistance (D17 cells were incubated with medium contaimng 60mg/ml hygromycin, CHO cells with medium containing 250 mg/ml hygromycin). Hygromycin resistant cell colonies indicate infectious virus particles.
  • DNP Infectivity assays were performed on D17 and CHO cells with and without conjugated DNP.
  • DNP was conjugated to cells as follows: Cells were incubated with 500 ml of a solution containing 1.4 mg/ml DNBS (2,4,-
  • Dinitrobenzene-sulfonic acid 2-hydrate, purchased from Kodak
  • sodium cocodylate buffer (0.25M)
  • the conjugation reaction was stopped by adding 5 ml of medium to the cells.
  • the corresponding single chain antibody gene (termed B6.2, Bird.R.E. et al., 1988 and Colcher,D. et al., 1990) made for expression in E.coli. was modified in the following way: PCR technology was used to amplify the B6.2 scA gene using the original E.coli. expression plasmid as template (Bird,R.E. et al., 1988 and Colcher,D. et al., 1990). The primers used had the following sequence:
  • primerA 5' GGAGCGCTGACGTCGTGATGACCCAGTC3'
  • primerB 5' CCTCGCGATCCACCGCCGGAGACTGTGAGAGTGGTGC3'
  • the PCR amplification results in a fragment that does not contain the bacterial ompA signal sequence and the stop codons present in the original B6.2 gene (Bird,R.E. et al., 1988 and Colcher,D. et al., 1990).
  • the PCR products were cloned into the Smal site of the pBluescript vector (Strata gene) and sequenced to verify a correct reading frame.
  • the plasmid was termed pTC9.
  • the B6.2 gene was isolated by digesting the pTC9 plasmid with Eco47III plus Nrul. The corresponding restriction enzyme recognition sites have been introduced with the primers used for PCR amplification.
  • the B6.2 gene (the Eco47III to Nrul fragment was cloned into pTC13, a gene expression vector ( Figure 5).
  • the corresponding vector (termed pTC23) contains the ER transport signal sequence of the SNV envelope protein fused to the B6.2 gene to enable transport through the endoplasmatic reticulum.
  • the cloning reconstituted the Nrul site at the 3' end of the B6.2 gene.
  • Carboxy terminal parts of the SNV envelope gene were isolated and fused to the B.2 gene (Nrul site) to give plasmids pTC24, pTC25, and pTG26 ( Figure 6).
  • Plasmids pTC24 and pTC25 retain exactly the same portions of the retroviral envelope as plasmids pTC4 and pTC5 which contain the anti-DNP antibody.
  • the antibody is fused to codon 168 of the SNV envelope. O 95/23846 _ u -
  • Targeting envelopes containing the receptor binding peptide of another virus were made as follows: the gene segment of ecotropic murine leukemia virus (a Hindlll-Ball fragment comprising almost the complete region coding for the SU peptide, including its ER transport signal sequence, Ott,D., and Rein, A. 1992) was isolated and inserted into the vectors pSNV-env-mC and pSNV-env-mD (pSNV-env-mC and pSNV-env-mD was described in Figure 2) replacing the amino terminal parts of the SNV envelope gene.
  • the resulting constructs are identical to plasmids pTC4 and pTC5, respectively, except that the anti-DNP antibody peptide
  • anti-DNP scA is replaced by the receptor binding peptide of ecoMLV ( Figure 6, pSNV-MLV-chiC and pSNV-MLV-chi-D, respectively).
  • helper cells were made as described above by transfecting plasmids expressing retroviral gag-pol proteins, the retroviral targeting envelope, and the wild-type envelope into D17 cells in co-transfection with a selectable marker to obtain helper cell lines containing targeting envelope only or helper cells containing both targeting and wild-type envelope.
  • Infectivity assays were performed on a variety of different cell-lines which included D17 cells, CHTG-cells expressing the ecotropic murine leukemia virus receptor (Albritton,L.M. et al., 1989) and human HeLa and Col-1 cells. Infectivity was determined with a retroviral vector expressing the bacterial beta-galactosidase gene as described (Mikawa,T. et al.).
  • virus particles also infected D17 cells conjugated with DNP.
  • efficiency of infection was three orders of magnitude less than that of cells not conjugated with DNP.
  • This drop in virus titer is mainly due to difficulties of selecting DNP conjugated cells with the antibiotic. It appears that the conjugation reaction makes cells very vulnerable to the drug and more than 90% of the cells died two to three days after the conjugation reaction.
  • Virus particles with wild-type envelope do not infect CHO cells.
  • virus particles that do not contain envelope (termed "no env")
  • virus particles that contain wild-type envelope alone (termed wt-env - DSN)
  • virus particles that contain targeting envelopes alone which are antibody-envelope fusion proteins (termed TC24, TC25, and TC26 as described in Figure 6)
  • particles that contain wild-type plus targeting envelopes (termed TC24+ wt-env, TC25+wt-env, and TC26+ wt-env).
  • Particles that do not contain any envelope were found to be basically not infectious.
  • Particles that contain wild-type envelope were infectious only on D17 cells which contain a viable receptor for wild-type SNV. The particles were not infectious on HeLa cells or Col-1 cells.
  • Particles that contained targeting envelopes only were infectious on D17 and HeLa cells. The efficiency of infection on D17 cells was less than 5% of that of virus containing wild-type envelope. Such particles were not infectious on Col-1 cells.
  • the addition of wild-type envelope increased efficiency of infection 10 to 50 fold.
  • Col-1 cells that could not be infected with particles containing either envelope alone could be infected with particles containing both wild-type env and targeting env. This data indicates that the wild-type envelope adds a function improving or even completely enabling virus penetration (Table 2). These data also show that the level of infectivity is dependent on the position within the envelope gene at which the antibody is fused to the envelope.
  • the cells of interest were isolated from the patient, purified from other cell types, and infected in tissue culture with retroviral vector particles which were harvested from helper cells. After expansion of the treated cells in tissue culture, they were re-injected into the patient.
  • the infection of cells has to be done in vitro, since the retroviral vector particles used (derived from amphotropic murine retroviruses) have a broad host range.
  • retroviral vector particles used derived from amphotropic murine retroviruses
  • This clinical gene therapy protocol may be sufficient to obtain insight into how efficient and how beneficiary gene therapy will be for the patient. Indeed, the clinical data look very promising (Eglitis, personal communication). However, the current clinical protocol is very laborious, time consuming, very costly, and, therefore, not suitable for general clinical application. For general clinical application, it will be necessary to inject the gene transfer vehicle directly into the body of the patient.
  • the development of a retroviral vector particle that only infects one specific cell type, may allow the direct injection of the vector into the patient's blood stream.
  • the development of vector particles containing antibody-envelope chimeras may be the first step towards this goal and may open a new area of possible applications of gene therapy in vivo.
  • Retroviral vector particles which display an antigen binding site of an antibody can specifically infect cells that contain a antigen specific for the antibody.
  • the efficiency of the gene transfer can be low.
  • the fusion of the targeting peptide to the envelope impaired the natural fusion function of the envelope which is essential for efficient penetration of the virus.
  • the addition of a wild-type envelope may complement this shortcoming was tested.
  • New retroviral vector particles containing two different types of targeting envelopes were constructed. These targeting envelopes were: (1) fusion proteins containing the antigen binding site of an antibody fused to various carboxy terminal portions of the envelope protein of spleen necrosis virus, SNV; and (2) fusion proteins consisting of the receptor binding domain of ecoMLV fused to various carboxy terminal portions of the SNV, similar to the antibody envelope constructs ( Figure 6).
  • Targeting envelopes alone are little or not infectious on cells that contain a receptor for the targeting envelope.
  • the addition of wild-type envelope to particles containing targeting envelopes dramatically increased or even completely enabled infectivity on target cells that could hardly or not at all infected with virus particles containing either envelope alone.
  • This data show that the construction of particles containing mixed envelopes dramatically improves the efficiency of gene transfer into specific target cells and, therefore, provides a valuable tool to introduce genes into specific target cells.
  • This method can be probably be improved by mutating the natural receptor binding domain of the wild-type envelope (e.g., by site directed mutagenesis).
  • Using a wild-type envelope containing a non-functional receptor binding site in mixed envelope retroviral vector particles may enable to also target cells that contain a receptor for the wildtype envelope without loosing target cell specificity.
  • Virus was harvested from tissue culture cells expressing SNV gag-pol and the envelope protein indicated in the left column (see also Figure 2). All cells contained pJD214HY, a retroviral vector expressing the hygromycin B phosphotransferase gene. Infected cells were selected for hygromycin resistance. The number of hygromycin resistant cell colonies was determined two to three weeks after infection (after all cells had died in uninfected control plates). DNP binding of vector particles was the determined by measuring reverse transcriptase activity bound to DNP-BSA-Sepharose particles. nd: not determined; 0: no hygromycin resistant colonies were detected. Virus titers are expressed as colony forming units (cfu) per ml of tissue culture supernatant medium.
  • Plasmid constructs pTC24, pTC25, and pTC26 were transfected into D17 cells that express retroviral core proteins (gag-pol) and the vector pCXL (Mikawa.T.), or into the retroviral packaging line DSN also containing the pCXL vector (in co-transfection with a plasmid expressing an antibiotic resistance gene).
  • the pCXL vector transfers the bacterial ,B-galactosidase (taco gene.
  • Virus was harvested from stable transfected cell-lines and fresh D17 cells, HeLa cells, or Col-1 cells were infected. Two days after infection, cells were stained with X-gal. Blue cells indicate infected cells expressing the lacZgene.
  • Virus titers are expressed as colony forming units per ml tissue culture supernatant medium harvested from helper cells (cfulml). -* experiment not done. nd: no infected cells were detected in infection experiments using a total of 2 ml supernatant tissue culture medium. Table 3
  • Virus was harvested from tissue culture cells expressing SNV gag-pol and the envelope protein indicated in the left column (see also Figure 6). All experiments were performed with pJD214HY a retroviral vector transferring the hygromycin resistance gene. Virus titers are expressed as hygromycin resistant colony forming units per ml of tissue culture supernatant medium. SNV-MLV-chiC+wt SNV and SNV-MLV-chiD+wt SNV are cell lines expressing chimeric envelopes of MLV and SNV plus the envelope of wild type (wt) SNV. DSN cells are SNV based helper cells expressing gag-pol and SNV env from two different plasmid constructs.
  • Virus titers are expressed as colony forming units (cfu) per ml of tissue culture supernatant medium, nd: no hygromycin resistant colonies were detected using a total of 5ml tissue culture medium.
  • oligonucleotide refers to primers, probes, oligomer fragments to be detected, oligomer controls, and unlabeled blocking oligomers. Oligonucleotide are molecules comprised of two or more deoxyribonucleotides or ribonucleotides.
  • primer refers to an oligonucleotide, preferably an oligodeoxyribonucleotide, either naturally occurring such as a purified restriction digest or synthetically produced, which is capable of acting as a point of initiation of synthesis when subjected to conditions in which synthesis of a primer extension product, which is complementary to a nucleic acid strand, is induced, i.e. , in the presence of nucleotides, an agent for polymerization such as a DNA polymerase, and a suitable temperature and pH.
  • the primer must be sufficiently long to prime the synthesis of extension products in the presence of the polymerization agent.
  • Methods for amplifying and detecting nucleic acid sequences by polymerase chain reaction (PCR) are described in detail in United States patents no. 4,683,195, 4,683,202, and 4,965,188, which disclosures are incorporated herein by reference.
  • Figure 1 is a diagram illustrating helper cells expressing retroviral proteins.
  • Helper cells are made by the transfection of plasmids expressing all retroviral proteins necessary to form infectious virus particles.
  • One plasmid is designed to express all core/proteins (expression of gag and pol).
  • the other plasmid is designed to express the envelope precursor/protein.
  • Both plasmid constructs do not contain retroviral cis/acting sequences for virus replication (e.g. , encapsidation sequences, a primer binding site etc.). Polyadenylation takes place in non/retroviral polyadenylation recognition sequences.
  • the helper cell is producing retroviral particles that only contain the vector genome with the gene(s) of interest.
  • the vector contains all cis/acting sequences for replication.
  • the vector genome is reverse transcribed and integrated into the genome. Due to the lack of retroviral protein coding genes in the vector genome, no virus particles are produced from infected target cells.
  • Helper cells that contain a plasmid express a modified envelope gene.
  • the helper cell is very similar to that shown above.
  • chimeric envelope genes were constructed that contain the antigen binding domain of an antibody at the amino terminus fused to the carboxy terminus of the envelope gene. Such particles may only bind to and infect target cells that contain an antigen structure which is recognized by the antibody moiety of the chimeric envelope protein.
  • FIG 2 is a diagram illustrating plasmids expressing mutant envelope genes of spleen necrosis virus (SNV). Genes are expressed from the Rous sarcoma virus promoter (RSV/pro) and polyadenylated within the polyadenylation signal of herpes simplex virus thymidine kinase gene (TK/poly(A)). The polylinker of pBluescript was inserted between the promoter and the polyadenylation sequence to allow the easy cloning of genes into this vector (plasmid sequences that abut the vector are not shown), a/b) point mutations were introduced into the env gene by site directed mutagenesis to create new restriction enzyme recognition sites (indicated by an *).
  • RSV/pro Rous sarcoma virus promoter
  • TK/poly(A) herpes simplex virus thymidine kinase gene
  • Figure 3 shows the sequence of the single chain antibody gene (scFv) against the hapten DNP.
  • Figure 4 illustrates retroviral packaging cells.
  • A) A eucaryotic cell containing two different plasmids for the production of retroviral vector particle proteins.
  • a retroviral vector transfected into such cells and carrying the gene of interest is encapsidated by retroviral core proteins.
  • the envelope expression vectors expresses targeting envelopes (e.g., a antigen binding peptide fused to the envelope).
  • Virus particles are produced that infect a target cell only that contains a receptor specific for the antigen binding site.
  • the helper shown under B) is similar to that shown above except that it also contains a gene expression vector coding for the wild-type envelope.
  • Virus particles produced from such helper cells contain "mixed" envelopes which consist of the targeting envelope and the wild-type envelope. Formation of mixed oligomers is possible because both, the targeting as well as the wild-type envelope contain a complete TM peptide which mediates the formation of oligomers.
  • Figure 5 illustrates a eucaryotic gene expression vector (pTC13) to obtain high level of gene products that contain a ER recognition sequence.
  • the vector shown has been derived from a another gene expression vector (termed pRD114) which is described in Sheay,W. et al., 1993.
  • the vector shown differs from pRD114 in that it contains a gene fragment coding for a ER recognition signal sequence to enable the transport of proteins through the endoplasmatic reticulum. It contains two recognition sites for the restriction enzymes Nrul and StuI which cut between two codons downstream of the ER signal sequence coding region. DNA fragments coding for any peptide can be inserted into this vector. Translation of the inserted gene is terminated by using one of the three stop codons.
  • MLV-U3-pro promoter and enhancer of murine leukemia virus; Ad. V. leader: tripartite leader sequence of adenovirus; SV40 poly (A): polyadenylation signal sequence of
  • Figure 6 illustrates plasmid vectors expressing targeting envelope proteins.
  • the PCR product of the gene coding for the single chain antibody B6.2 (a Eco47III to Nrul fragment, see Material and Methods) was cloned into the Nrul site of ⁇ TC13 ( Figure 5) to give plasmid pTC23.
  • Carboxy terminal parts of the SNV envelope gene were isolated and cloned into the Nrul site downstream of the B6.2 antibody gene.
  • the resulting targeting antibody-envelope fusion gene of pTC24 and pTC25 are similar to pTC4 and pTC5.
  • pTC24 and pTC25 retain exactly the same amount of SNV envelope as pTC4 and pTC5, respectively.
  • pTC26 the antibody coding genes abuts the envelope coding region at codon 167 of the envelope gene.
  • Plasmids pSNV-MLVchiC and pSNV-MLV-chiD are identical to pTC4 and pTC5, except that the antibody gene is replaced with a gene fragment encoding for almost the complete SU peptide of MLV.
  • the ER transport signal sequence (L) is from MLV.
  • MLV-pro promoter and enhancer of murine leucemia virus
  • AVtl tripartite leader sequence of adenovirus
  • L ER transport signal sequence
  • B6.2scFV gene encoding the single chain antibody B6.2
  • TM transmembrane coding region of the SNV envelope
  • RSV promoter and enhancer of Rous sarcoma virus.
  • a putative murine ecotropic retrovirus receptor gene encodes a multiple membrane-spanning protein and confers susceptibility to virus infection. Cell 57:659-666.
  • Plasmid encoded hygromycin B resistance the sequence of hygromycin B phosphotransferase gene and its expression in Escherichia coli and Saccharomyces cerevisiae. Gene 25, 179- 188.
  • variable region heavy chain gene segments by predominant 2,4-dinitrophenyl-specific BALB/c nneonatal antibody clonotypes.
  • Retrovirus vectors for gene transfer efficient integration into and expression of exogenous DNA in vertebrate cell genomes, in "Gene Transfer” (R.Kucherlapatl,ed.) Plenum Press, New York. Varmus,H.E., and Brown,P. 1988 Retroviruses, in "Mobile DNA” (M.Howe and D.Berg, eds.) ASM, Washington DC.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Virology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Hematology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicinal Preparation (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
EP95913506A 1994-03-04 1995-03-03 Cell-type specific gene transfer using retroviral vectors containing antibody-envelope and wild-type envelope-fusion proteins Withdrawn EP0786010A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US20598094A 1994-03-04 1994-03-04
US205980 1994-03-04
PCT/US1995/002537 WO1995023846A1 (en) 1994-03-04 1995-03-03 Cell-type specific gene transfer using retroviral vectors containing antibody-envelope and wild-type envelope-fusion proteins

Publications (2)

Publication Number Publication Date
EP0786010A4 EP0786010A4 (ja�@�@) 1997-07-30
EP0786010A1 true EP0786010A1 (en) 1997-07-30

Family

ID=22764474

Family Applications (1)

Application Number Title Priority Date Filing Date
EP95913506A Withdrawn EP0786010A1 (en) 1994-03-04 1995-03-03 Cell-type specific gene transfer using retroviral vectors containing antibody-envelope and wild-type envelope-fusion proteins

Country Status (4)

Country Link
EP (1) EP0786010A1 (ja�@�@)
JP (1) JPH10501403A (ja�@�@)
CA (1) CA2184354A1 (ja�@�@)
WO (1) WO1995023846A1 (ja�@�@)

Families Citing this family (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6534051B1 (en) 1992-11-20 2003-03-18 University Of Medicine And Dentistry Of New Jersey Cell type specific gene transfer using retroviral vectors containing antibody-envelope fusion proteins and wild-type envelope fusion proteins
GB9604354D0 (en) * 1996-02-29 1996-05-01 Isis Innovation Targeting adapters
US6096548A (en) 1996-03-25 2000-08-01 Maxygen, Inc. Method for directing evolution of a virus
WO1997038119A1 (en) * 1996-04-08 1997-10-16 The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services Reagent and method for targeting retrovirus
EP0927044A4 (en) * 1996-04-16 1999-09-08 Immusol Inc DEFINED TARGET VIRAL VECTORS
FR2762851B1 (fr) * 1997-04-30 1999-10-29 Inst Nat Sante Rech Med Construction et expression d'enveloppe chimerique de retrovirus par des vecteurs et compositions pharmaceutiques les contenant
DE19752854C2 (de) * 1997-11-28 2000-07-06 Bundesrepublik Deutschland Let Zellspezifische retrovirale Vektoren mit Antikörperdomänen und Verfahren zu ihrer Herstellung für den selektiven Gentransfer
DE19752855C2 (de) * 1997-11-28 2003-04-03 Bundesrepublik Deutschland Let Retrovirale Pseudotyp-Vektoren mit modifizierten Oberflächen-Hüllproteinen und Verpackungszelle zu ihrer Herstellung für den selektiven Gentransfer
WO1999055893A1 (en) * 1998-04-29 1999-11-04 University Of Southern California Retroviral vectors including modified envelope escort proteins
US7078483B2 (en) 1998-04-29 2006-07-18 University Of Southern California Retroviral vectors including modified envelope escort proteins
CA2341356C (en) * 2000-04-14 2011-10-11 Transgene S.A. Poxvirus with targeted infection specificity
JP4802401B2 (ja) * 2000-11-07 2011-10-26 トランスジェン・ソシエテ・アノニム 標的化感染特異性を有するポックスウイルス
US12590321B2 (en) 2016-03-19 2026-03-31 Exuma Biotech Corp. Methods and compositions for genetically modifying and expanding lymphocytes and regulating the activity thereof
US11325948B2 (en) 2016-03-19 2022-05-10 Exuma Biotech Corp. Methods and compositions for genetically modifying lymphocytes to express polypeptides comprising the intracellular domain of MPL
US11111505B2 (en) 2016-03-19 2021-09-07 Exuma Biotech, Corp. Methods and compositions for transducing lymphocytes and regulating the activity thereof
CN112955174A (zh) 2018-07-09 2021-06-11 旗舰先锋创新V股份有限公司 融合剂脂质体组合物和其用途
CN113631718A (zh) 2018-11-14 2021-11-09 旗舰先锋创新V股份有限公司 用于特定隔室货物递送的组合物和方法
AU2019378883A1 (en) * 2018-11-14 2021-06-03 Flagship Pioneering Innovations V, Inc. Fusosome compositions for T cell delivery
US20220008557A1 (en) * 2018-11-14 2022-01-13 Flagship Pioneering Innovations V, Inc. Fusosome compositions for cns delivery

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993000103A1 (en) * 1991-06-21 1993-01-07 The Wistar Institute Of Anatomy And Biology Chimeric envelope proteins for viral targeting
JPH08504098A (ja) * 1992-11-20 1996-05-07 ユニバーシティー オブ メディスン アンド デンティストリー オブ ニュー ジャージー 抗体−エンベロープ融合蛋白を含有するレトロウィルスベクターを用いた細胞種特異的な遺伝子転移

Also Published As

Publication number Publication date
JPH10501403A (ja) 1998-02-10
WO1995023846A1 (en) 1995-09-08
EP0786010A4 (ja�@�@) 1997-07-30
CA2184354A1 (en) 1995-09-08

Similar Documents

Publication Publication Date Title
EP1104482B1 (en) Cell type specific gene transfer using retroviral vectors containing antibody-envelope fusion proteins and wild-type envelope fusion proteins
US5869331A (en) Cell type specific gene transfer using retroviral vectors containing antibody-envelope fusion proteins and wild-type envelope fusion proteins
WO1995023846A1 (en) Cell-type specific gene transfer using retroviral vectors containing antibody-envelope and wild-type envelope-fusion proteins
AU689755B2 (en) Recombinant viruses displaying a nonviral polypeptide on their external surface
Russell et al. Modifying the host range properties of retroviral vectors
Sandrin et al. Targeting retroviral and lentiviral vectors
EP0840797B1 (en) Methods and means for targeted gene delivery
US6146885A (en) Cell-type specific gene transfer using retroviral vectors containing antibody-envelope fusion proteins
CN111315761A (zh) 用于选择性转导靶细胞的基于衔接子的逆转录病毒载体系统
JPH09509329A (ja) 遺伝子搬送媒体を標的とする組成物及び方法
US6448390B1 (en) Stable envelope proteins for retroviral, viral and liposome vectors and use in gene drug therapy
CA2208519C (en) Viral vector complexes having adapters of predefined valence
Mazari et al. Library screening and receptor-directed targeting of gammaretroviral vectors
US6762031B2 (en) Targeting viral vectors to specific cells
EP1059356B1 (en) Replicating retroviral constructs, preparation and uses for gene delivery
Dingli et al. Genetic targeting of retroviral vectors
Jiang The construction and applications of cell-type-specific retroviral gene-transfer vectors derived from spleen necrosis virus: From in vitro to in vivo
Dornburg Reticuloendotheliosis virus-derived vectors for human gene therapy
Benedict et al. Development of Retroviral Vectors that Target Hematopoietic Stem Cells
CA2253874A1 (en) Viral particles which are masked or unmasked with respect to a cell receptor
CA2199989A1 (en) Expression of a foamy virus envelope protein
Chu Engineered retroviruses enable cell-specific gene transfer through antigen-antibody interaction
Katane Studies on the Receptor Specificity of the Mouse Retrovirus Envelope Protein
Kingsman et al. Retrovirus Vectors in Gene Therapy: Targeting to Specific Cells
Benedict The murine leukemia virus envelope protein: engineering for vector targeting and analysis of interactions with viral core proteins

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19960930

A4 Supplementary search report drawn up and despatched

Effective date: 19970415

AK Designated contracting states

Kind code of ref document: A4

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE

17Q First examination report despatched

Effective date: 20021007

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20040323