EP0733107A1 - Csa rezeptor antagonisten, die wesentlich keine agonist aktivität besessen - Google Patents

Csa rezeptor antagonisten, die wesentlich keine agonist aktivität besessen

Info

Publication number
EP0733107A1
EP0733107A1 EP94931155A EP94931155A EP0733107A1 EP 0733107 A1 EP0733107 A1 EP 0733107A1 EP 94931155 A EP94931155 A EP 94931155A EP 94931155 A EP94931155 A EP 94931155A EP 0733107 A1 EP0733107 A1 EP 0733107A1
Authority
EP
European Patent Office
Prior art keywords
analogue
human
antibody
seq
derivative
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP94931155A
Other languages
English (en)
French (fr)
Inventor
Jan Van Oostrum
William C. Boyar
Nicholas G. Galakatos
Jane V. Peppard
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novartis Pharma GmbH
Novartis AG
Original Assignee
Novartis Erfindungen Verwaltungs GmbH
Ciba Geigy AG
Novartis AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novartis Erfindungen Verwaltungs GmbH, Ciba Geigy AG, Novartis AG filed Critical Novartis Erfindungen Verwaltungs GmbH
Publication of EP0733107A1 publication Critical patent/EP0733107A1/de
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/472Complement proteins, e.g. anaphylatoxin, C3a, C5a
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/02Drugs for disorders of the urinary system of urine or of the urinary tract, e.g. urine acidifiers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/06Antigout agents, e.g. antihyperuricemic or uricosuric agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/08Vasodilators for multiple indications
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide

Definitions

  • the present invention relates to the field of immunology, and more specifically to the treatment of complement-mediated diseases and inflammatory conditions in mammals.
  • Inflammation is a localized, protective event, elicited by injury, which serves to destroy, dilute or wall off both injurious agents and the injured tissues. It involves a complex series of events, including dilation of arteries, capillaries and venules, with increased vascular permeability, increased blood flow, and exudation of fluids and plasma proteins. These processes are often rapidly followed by adhesion of leukocytes to the vascular endothelium, with subsequent influx of the cells into the surrounding tissue.
  • complement a major immunological defense mechanism against foreign substances, has been shown to influence each of the factors that comprise the inflammatory response.
  • complement comprises a set of proteins that work to eliminate microorganisms and other antigens from tissues and blood. This task is achieved either by complement components alone or in cooperation with antibodies or with cells that express complement receptors. More specifically, the system consists of about 30 plasma proteins, their corresponding cellular receptors and several membrane regulatory proteins.
  • Kinoshita Immunology Today, 12:291-300 (1991).
  • Activation of the complement system by, for example, antigen-antibody complexes or bacterial surface structures, triggers an amplification cascade of proteolytic cleavage and protein assembly events of the complement components, which ultimately leads to the destruction and final elimination of the foreign body. Muller-Eberhard, Annu. Rev. Biochem. 57:321-347 (1988).
  • C5a a glycoprotein containing 74 amino acids and having an M r of about 11,000, is generated by the proteolytic cleavage of the N-terminal end of C5, the fifth component of complement, by C5 convertase. Nilsson et al., J. Immunol. 114:815-822 (1975).
  • the biological properties of C5a extend across a multitude of cells and tissues involved in both acute and chronic inflammatory processes. Hugli, CRC Crit. Rev. Immunol., 1:321-366 (1981). Many of these properties are immunologically beneficial.
  • C5a has been found to mediate host defense mechanisms in response to various pathological conditions.
  • C5a participates in a wide variety of specific biologic functions commonly associated with the inflammatory response, such as smooth muscle contraction, an increase in vascular permeability, wheal and flare generation when injected into human skin, histamine release from mast cells, and induction of the oxidative burst and lysosomal enzyme release from polymorphonuclear leukocytes (PMNLs).
  • C5a stimulates measurable responses from every circulating white blood cell including basophils, eosinophils, monocytes, and neutrophils. Hugli, supra.; Bautsch et al., Immunobiol. 185:41-52 (1992).
  • C5a has further been found to be a potent chemoattractant. Fernandez et al., J. Immunol. 120:109-115 (1978). This protein is a pivotal stimulus to the attraction of PMNLs such as phagocytic cells to the site of inflammation.
  • Complement is beneficial when directed against an appropriate target such as invading microorganisms or tumor cells, but has clear pathogenic potential if activated inappropriately.
  • anaphylatoxins e.g., C5a
  • C5a have been implicated as causative or aggravating factors in the pathogenesis of several inflammatory diseases such as adult respiratory distress syndrome and rheumatoid arthritis. Bautsch et al., Biochem. J. 288:261-266 (1992); Haslett et al., J. Immunol. 142:3510-3517 (1989).
  • C5a has been found to be a principal inflammatory mediator produced by complement activation by virtue of additional activities that include recruitment and stimulation of inflammatory leukocytes and augmentation of antibody production. See Mollison et al., Proc. Natl. Acad. Sci. USA 86:292-296 (1989).
  • the in vivo or pharmacologic control of inflammation is presumed to be dependent on the modulation of chemotaxis.
  • Three levels at which inhibition can occur have been recognized. These are (1) suppression of the leukocytic response to chemotactic stimuli; (2) prevention of chemotaxin generation; and (3) inactivation of the chemotaxins.
  • C5a exerts its various functions by binding to a specific C5a receptor found in the membrane of several human cells such as neutrophils, eosinophils and monocyte-derived cells, the inhibition of C5a-mediated chemotaxis, and in particular, the design of C5a receptor antagonists have attracted considerable attention.
  • U.S. 4,772,584 to Cleary et al. discloses polypeptides isolated from group A streptococci which inhibit the binding of C5a to PMNLs by cleaving a six amino acid peptide from the C-terminus of C5a.
  • U.S. 4,692,511 to Hahn teaches polypeptide receptor antagonists to C5a which contain an essential core tetrapeptide Tyr-Asp-Gly-Ala (SEQ ED NO. 1) or Asp-Gly-Ala-Tyr (SEQ ED NO. 2), or core tripeptide Asp-Gly-Ala which display C5a blocking activity.
  • One aspect of the present invention is directed to polypeptidic analogues of human C5a which are C5a receptor antagonists and exhibit substantially no anaphylatoxin or agonist activity, derivatives of the analogues, and dimeric forms of the analogues and derivatives.
  • DNA molecules encoding the polypeptides, (i.e., the analogues and derivatives thereof) plasmids, vectors and host cells transformed with the DNA molecules, and methods of preparing the C5a analogues are also provided.
  • compositions containing a C5a analogue, derivative or dimer thereof are advantageously used in methods for the treatment of C5a-mediated inflammatory conditions and diseases in mammals, and as a prophylactic to prevent such inflammation.
  • Another aspect of the present invention is directed to antibodies specific to the C5a analogue and derivatives thereof, which exhibit substantially no cross-reactivity with human C5a.
  • the antibodies are used to detect or quantify circulating C5a analogues and derivatives in subjects (previously administered with same) as well as to modify, e.g., neutralize, the activity of the C5a analogues and derivatives in vivo.
  • Fig. 1 is a flow diagram that illustrates the synthesis of a synthetic gene encoding human C5a via oligonucleotide coupling
  • Fig. 2 is a plasmid map of pB-6/C5a.
  • the C5a polypeptide analogues of the present invention are C5a receptor antagonists which have substantially no agonist activity.
  • C5a receptor is understood in the art as referring to the sites on the surfaces of human blood cells such as PMNLs and monocytic cells, to which C5a, its degradation product C5a-desArg, and the instant antagonists bind. See, for example, U.S. 5,177,190; and Oppermann et al, J. Immunol. 151(7):3785-3794 (1993).
  • C5a is converted enzymatically to C5a-desArg in human serum by a carboxypeptidase B-like enzyme, and is the major physiological end product in man. Chenoweth et al., Mol. Immunol. 17:151-161 (1980).
  • the instantly disclosed polypeptides are inhibitors of C5a. That is, they interfere with the binding of C5a to the C5a receptor. While not intending to be bound by any particular theory, Applicants believe that the C5a analogues are competitive inhibitors of C5a in that they compete with C5a for binding to the C5a receptor.
  • the antagonism of the instant C5a analogues may be quantified as an IC50 in the calcium rise assay disclosed in Seligmann et al., Agents and Actions 21:375-378 (1987), described in detail in Example 7.
  • the IC50 is defined as the concentration of C5a analogue which inhibits 50% of the intracellular mobilization of calcium ions by the PMNLs bearing the C5a receptor, after a challenge dose with 100 pM human C5a.
  • the C5a receptor antagonists of the present invention exhibit an IC50 of no greater than about 2.0 x 10 " ⁇ M in the calcium rise assay disclosed in Seligmann et al.
  • anaphylatoxin activity or “substantially no agonist activity,” it is meant that the binding of the C5a analogue (hereinafter used interchangeably with C5a receptor antagonist) to the receptor does not result in an endogenous signal transduction event ultimately resulting in the physiological responses commonly associated with anaphylatoxin-induced inflammation caused by binding of C5a to its receptor, such as activation of phagocytic cells, smooth muscle contraction, increase in vascular permeability, and excessive production of inflammatory mediators, e.g., histamines, prostaglandins, thromboxanes, leukotrienes, interleukin (IL)-l, IL-6 and IL-8.
  • C5a analogue hereinafter used interchangeably with C5a receptor antagonist
  • EC50 is a measure of agonistic activity.
  • the EC50 value is that concentration of C5a analogue which produces 50% of the maximum response caused by that same C5a analogue.
  • Applicants have not detected agonist activity of the instant C5a analogues up to a concentration of at least about 8.0 x 10 " ' M, and preferably at least about 3.0 x 10 " " M in the same calcium rise assay.
  • the C5a analogues of the present invention are those for which the EC50 is not measurable in the Seligmann calcium rise assay up to C5a analogue concentrations of at least about 8.0 x 10 " ' M, and preferably at least about 3.0 x 10 " " M, since no response can be detected in the assay.
  • C5a is a 74-amino acid polypeptide, the sequence of which has been disclosed in Fernandez et al., J. Biol. Chem. 253:6955-6964 (1978).
  • Synthetic genes constructed based upon the deduced nucleotide sequences, are disclosed in Mandecki et al, Proc. Nat'l Acad. Sci. USA 82:3543-3547 (1985) and U.S. 4,937,189 to Davidow et al.
  • the amino acid sequence of C5a disclosed in Fernandez, and the corresponding synthetic nucleotide sequence disclosed in Davidow et al. are set forth in Table 1, below.
  • Table 1 1 2 3 4 5 6 7 8 9 10 EcoRI thr leu gin lys lys ile glu glu ile ala
  • Hindlll GCT AAC ATT TCT CAC AAG GAC ATG CAA CTC GGC CGC TAA A CGA TTG TAA AGA GTG TTC CTG TAC GTT GAG CCG GCG ATT TTCGA Applicants have unexpectedly and surprisingly discovered that certain analogues of human C5a, produced by mutagenizing the portion of a synthetic C5a gene encoding the C-terminal region, i.e., amino acids 64-74, of human C5a (hereinafter used interchangeably with "C5a(l-74)"), have dramatically different properties than C5a. That is, they exhibit excellent antagonistic properties and substantially no agonist activity.
  • the C5a analogues of the present invention are defined in terms of two modifications or mutations to the C-terminal region of C5a ( 1 -74 ) , N' -Asn-Ile-Ser-His-Lys-Asp-Met-Gln-Leu-
  • amino acids 64-74 of C5a (1-74) amino acids 64-74 of C5a (1-74).
  • the C-terminal amino acid of the polypeptide i.e., the C-terminus
  • SH thiol
  • the respective corresponding embodiments may be designated as follows: C5a (1-72, Leu72Cys), C5a (1-71, Gln71Cys), C5a (1-70, Met70Cys), C5a (1-69, Asp69Cys) and C5a (1-68, Lys68Cys).
  • the C-terminal region is truncated to and including Met70, Gln71 or Leu72, which correspond to the three former designated embodiments.
  • An even more preferred embodiment is C5a (1-71, Gln71Cys).
  • the C-terminal region can be further truncated N-terminally to Lys 68, which would correspond to the representative designated embodiments C5a (1-67, His67Cys), C5a (1-66, Ser66Cys), C5a (1-65, Ile65Cys) and 65a (1-64, Asn64Cys), provided that the resultant C5a analogue exhibits the forementioned requisite antagonist property (an IC50 of no greater than about 2.0 x 10 " " M) and substantially no anaphylatoxin or agonist activity (a non-measurable EC50 up to C5a analogue concentrations of at least 3.0 x 10 " ⁇ M).
  • analogues of human C5a do not include antibodies specific to C5a or to sites on the C5a receptor.
  • Derivatives of the human C5a analogues as described herein are included within the scope of the present invention. These include modifications such as point mutations, substitutions, additions and deletions in the N-terminal 63 amino acid region (amino acids 1-63 of C5a(l-74)), Carney et al., Protein Science 2:1391-1399 (1993), and further amino acid substitutions in the thus-mutagenized C-terminal region.
  • the type and extent of the modifications are generally not important, so long as the resultant derivative remains a C5a receptor antagonist with substantially no agonist activity, both as defined above.
  • the Cys27 residue in the N-terminal region of C5a (1-74) can be changed, e.g., to a serine residue, in order to minimize complications during refolding.
  • the C5a analogue derivative is designated C5a(l-71, Cys27Ser, Gln71Cys).
  • the N-terminus may be changed to a Methionine residue, either by substitution or addition, to allow for expression of a C5a analogue-encoding gene in various host cells.
  • An example of a further modification of the C-terminal region is the substitution of a Phenylalanine residue for the native Histidine at position 67 of C5a(l-74).
  • the C5a analogue derivative is designated C5a (1-71, Cys27Ser, His67Phe, Gln71Cys).
  • the C5a analogues (hereinafter referring collectively to the analogues and derivatives thereof) of the present invention can be prepared via numerous procedures standard in the art. For instance, they may be prepared via direct chemical synthesis. They may also be prepared by expression of DNA molecules, i.e., synthetic genes, encoding the polypeptides in suitable host cells. These DNA molecules, deducible from the amino acid sequences of the C5a analogues, in turn may be prepared via known techniques. The DNAs may be synthesized chemically as disclosed in Narang, Tetrahedron 39:3-22(1983) and EPA 146,785; Mandec et al., Proc. Natl. Acad. Sci.
  • DNAs encoding the C5a analogues of the present invention can also be prepared by mutagenesis of known synthetic or natural genes encoding C5a, such as those disclosed in Fernandez, Mandecki and Davidson, for example. See Ausubel et al., supra.; Volume II, Chapter 15 of Maniatis et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor, NY (1989); and Mollison et al., Proc. Natl. Acad. Sci. USA 86:292-296 (1989). Further, the DNAs may be prepared via PCR techniques. PCR Protocols, Innis et al. (Eds.), Academic Press, San Diego, CA (1990).
  • the DNA molecules encoding the C5a analogues of the present invention are operably linked to known regulatory sequences, e.g., promoter, enhancer, 3 '-untranslated sequences, and 5' translated sequences, e.g., signal and leader sequences, and then transformed into host cells capable of expressing the genes, in accordance with art-recognized techniques. Then, the transformed host cells are cultured under conditions suitable for expression of the antagonist encoding gene.
  • Representative host cells include prokaryotes such as E. coli and Bacillus, e.g., B.
  • subtilis and eukaryotes such as filmentous fungi, e.g., Aspergillus niger;, yeast, e.g., Saccharomyces cerevisiae, Pichia pastoris and Yarrowia lipolytica; baculovirus/insect cell cultures (Summers et al., A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures, Texas Agricultural Experiment Station (1987)); mammalian cell lines; and plants (J. Vandekerckhove et al., BIO/TECHNOLOGY 7:929-932 (1989)).
  • C5a analogue gene expression In general, the procedures for expression of C5a in E. coli are applicable to C5a analogue gene expression. See, Mandecki, Proc. Natl. Acad. Sci. USA 82:3543-3547 (1985); Mollison et al., Proc. Natl. Acad. Sci. USA 86:292-296 (1989); and Bautsch et al., Immunobiol. 185:41-52 (1992).
  • Suitable regulatory sequences such as promoter (e.g., T7 polymerase, UV5-D, trp or lac), ribosome binding site, as well as suitable plasmid vectors containing transcriptional stop sites, e.g., pKK223-2, are within the level of skill in the art.
  • promoter e.g., T7 polymerase, UV5-D, trp or lac
  • ribosome binding site e.g., ribosome binding site
  • suitable plasmid vectors containing transcriptional stop sites e.g., pKK223-2
  • the DNA molecule should be synthesized using E. coli-preferred codons as disclosed in Guoy et al., Nucleic Acids Res. 10:7055-7074 (1982), and to allow for several restriction endonuclease sites to facilitate characterization of the synthesized DNA and possibly mutagenesis of the DNA sequence.
  • E. coli strains e.g., Ion, which are deficient in one of several proteases present in wild-type cells offer the advantage of increased yield of protein. Franke et al., Meth. Enzymol. 162:653-658 (1988).
  • the C5a analogue-encoding synthetic genes can be expressed in yeast by following known procedures. See, for example, Romanos et al., Yeast 8:423-488 (1992); Section IV of Goeddel (Ed.), Meth. Enzymol. 185:231-484 (1990); Davidow et al., supra. and U.S. 4,775,622.
  • the DNA molecule should be prepared using yeast-preferred codons, particularly to avoid Arg- Arg pairs which are targets for endogenous KEX2 proteases.
  • glutamine as opposed to methionine, as the N-terminus, facilitates proteolytic cleavage from the signal sequence, e.g., alpha factor signal sequence. It is further preferred to eliminate any potential glycosylation sites such as the Asparagine at position 64 of various embodiments of the instant C5a receptor antagonists.
  • C5a analogue-encoding gene of the present invention in mammalian cells can be performed in accordance with known procedures. See Chapter 16, "Expression of Cloned Genes in Mammalian Cells," in Maniatis et al., supra. A representative method of expression in human cells is disclosed in Berg et al., BioTechniques 14(6):972-978 (1993). Suitable human cells include publicly available cell lines such as HeLA S3 (ATCC CCL2.2) and HEK293 (ATCC CRL1573). Expression in CHO cells is disclosed, for example, in Asselbergs et al., Fibrinolysis 7:1-14 (1993).
  • Suitable hamster cell lines include CHO-K1 (ATCC CCL61), BHK (ATCC CRL6281), BHK-21 (ATCC 6281, CCL10 and CRL8544).
  • Representative monkey cells are CV-1 (ATCC CCL70), COS-7 (ATCC CRL1650), and VERO cells (ATCC CCL81).
  • a suitable mouse cell line is C127 (ATCC 1804).
  • Preferred cell lines are DHFR-minus CHO lines as disclosed in Uriaub et al., Proc. Natl. Acad. Sci. USA 77:4216-4220 (1980). Serum-independent cell lines are more preferred. See Kurano et al., Bio/Technology 16:245-258 (1990). In mammalian hosts, glycosylated or non-glycosylated forms of the C5a analogues can be produced.
  • the C5a analogues isolated from transformed E. coli cells are renatured to assume biological activity wherein the C-terminal cysteine is in reduced form, i.e., it contains a free thiol group, preferably by using a convenient one-step procedure.
  • Applicants have unexpectedly discovered that treating the denatured C5a analogue with a redox couple in a molar ratio of reducing agent to oxidizing agent from at least about 100:1 to about 500:1 results in a biologically active C5a analogue having a C-terminal cysteine in reduced form.
  • This ratio is from about 10-fold to about 50-fold greater than known ratios (a preferred ratio of reduced sulfhydryl to oxidized sulfhydryl compound of 10:1 is disclosed on col. 17, lines 43-45 of Builder et al., U.S. 4,620,948).
  • the transformed E. coli cells after culturing under conditions sufficient to cause production of the C5a analogue, are mixed with a denaturing and solubilizing agent, e.g., 6M guanidine HCl, to produce denatured C5a analogue, optionally with further disruption by any known technique such as sonication, French Press or DynoMill.
  • the thus-mixed or thus-disrupted cells containing the denatured C5a analogue are then mixed with a redox couple in a molar ratio by weight of reducing agent/oxidizing agent of from at least about 100:1 to about 500:1 under suitable conditions to produce renatured, biologically active C5a analogue.
  • Suitable redox couples include cysteine/cystine and reduced glutathione/oxidized glutathione. Others skilled in the art will appreciate that other redox couples can be used.
  • the glutathione redox couple is preferred.
  • Suitable conditions include a pH of from 6.5 to 7.5, preferably 7.4. The mixture is allowed to stand at room temperature for a time sufficient to maximize the yield of protein.
  • the preferred time is from about 1/2 hour to about 4 hours.
  • the C5a analogues may be renatured according to standard refolding and purification schemes such as disclosed in Builder et al., U.S. 4,620,948, for example.
  • the C-terminal cysteine will be in the form of an adduct, e.g., cys-cys or cys-glutathione. Therefore, the adduct must be further reduced to yield the free thiol group.
  • adducts of the disclosed C5a analogues also function as C5a receptor antagonists which exhibit substantially no agonist activity as defined herein, and thus are included within the scope of the present invention. However, the further reduction would be necessary to prepare the preferred embodiments if these standard renaturation techniques were used.
  • the C5a analogues may be purified to the extent desired.
  • Representative purification schemes include ultrafiltration, diafiltration, gel electrophoresis, chromatographic processes such as ion exchange chromatography, size exclusion chromatography, HPLC, reverse phase HPLC, treatment with Sephadex, dialysis, affinity chromatography, etc. Those skilled in the art would appreciate that a combination of purification schemes can be used.
  • C5a analogues having a C-terminal cysteine residue can be oxidized to form dimers in accordance with standard techniques.
  • the dimers To prepare the dimers, the thiol (-SH) groups of the C-terminal cysteines of the respective monomers (analogues) are oxidized to produce a disulfide linkage.
  • Homodimers and heterodimers are embraced by the term "dimer”.
  • the C5a analogues and dimers thereof of the present invention are useful in the treatment and/or prevention of injurious conditions or diseases in which the complement system, and more particularly C5a and analphylatoxin, are involved. They are therapeutically most effective when administered to any mammalian patient, especially humans, who face a high risk of C5a-mediated tissue destruction and death. In general, the conditions or diseases are those such as inflammatory disorders where C5a is generated in the serum proteolytically.
  • Representative conditions responsive to C5a analogue therapy include pneumonitis, adult respiratory distress syndrome (ARDS), idiopathic pulmonary fibrosis, pulmonary inflammation or injury, chronic progressive pulmonary dis-cystic fibrosis, byssinosis, asbestos-induced inflammation, myocardial infarction, post-myocardial infarction inflammation, ischemic heart damage, hepatic cirrhosis, primary biliary cirrhosis inflammation, chronic hepatitis, pancreatitis, hemorrhagic pancreatitis, inflammatory bowel disease, colitis, ischemic brain damage, encephalitis, cranial nerve damage in memingitis, meningitis, uvetis, Purtscher's retinopathy, immune complex-mediated glomerulonephritis, renal cortical necrosis, gout, vasculitis, serum sickness, angio-edema, myasthenia gravis, systemic lupus erythematos
  • the analogues and dimers thereof have further therapeutic utility as prophylactics, particularly in conditions caused by reperfusion, e.g., reperfusion following ischemia, and circulatory contact with medical devices, as well as to prevent transplant rejection.
  • the C5a analogue is administered suitably prior to or substantially simultaneously with the event that is known to cause the inflammation or aggravate an existing inflammatory condition.
  • the C5a analogues and dimers thereof of the present invention can be administered by any therapeutically effective route for a proteinaceous pharmaceutical, e.g., parenterally, intranasally, rectally or buccally, in dosage unit formulations containing conventional nontoxic pharmaceutically acceptable carriers, adjuvants and vehicles as desired.
  • parenteral embraces delivery modes such as subcutaneous, intravenous, intramuscular, instrasternal, in tra- arterial injection and infusion techniques.
  • Dosage amounts of the C5a analogues (and dimers) of the present invention may be varied to achieve the desired therapeutic response for a particular patient. This will depend, for instance, on the activity of the particular antagonist, the mode of administration, the severity of the condition being treated, as well as the medical condition of the patient.
  • the determination of a therapeutically effective dosage amount for a given condition and patient is within the level of skill in the art. In general, dosage levels of from about 1 ug to 100 mg per kilogram of body weight per day are administered daily to the mammalian host. Preferred dosage levels range from about 0.1 mg/kg to about 20 mg/kg of body weight per day.
  • the C5a analogue is administered to the patient as a single continuous dose over a prolonged period of time. However, the total effective dosage may be divided into multiple doses, e.g., two to four separate doses per day, if desired.
  • compositions for parenteral administration comprise pharmaceutically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, as well as sterile powders for reconstitution into sterile injectable solutions or dispersions immediately prior to use.
  • aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols, e.g., glycerol, propylene glycol, polyethylene glycol, and suitable mixtures thereof, vegetable oils, e.g., olive oil, and injectable organic esters such as ethyl oleate. Fluidity may be maintained by various means including the use of coating materials such as lecithin, the maintenance of required particle size (in the case of dispersions), and surfactants.
  • compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents, dispersing agents, antibacterial and antifungal agents such as paraben, chlorobutanol, phenol and sorbic acid, isotonic agents such as sugars, sodium chloride, or agents which delay absorption such as aluminum monostearate and gelatin.
  • adjuvants such as preservatives, wetting agents, emulsifying agents, dispersing agents, antibacterial and antifungal agents such as paraben, chlorobutanol, phenol and sorbic acid, isotonic agents such as sugars, sodium chloride, or agents which delay absorption such as aluminum monostearate and gelatin.
  • the C5a receptor antagonists may be incorporated into slow or sustained release or targeted delivery systems such as polymer matrices, liposomes, and microspheres.
  • Injectable formulations can be sterilized by numerous means, including filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium just prior to use.
  • Suspensions in additon to the C5a analogue and any other active ingredient, may contain suspending agents such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, tragacanth and mixtures thereof.
  • compositions for rectal or vaginal administration are usually in the form of suppositories which can be prepared by mixing the polypeptides of the present invention with suitable non-irritating excipients or carriers such as cocoa butter, polyethylene glycol or a suppository wax which is solid at room temperature but liquid at body temperature, and therefore melts in the rectum or vaginal cavity, and releases the receptor antagonist.
  • suitable non-irritating excipients or carriers such as cocoa butter, polyethylene glycol or a suppository wax which is solid at room temperature but liquid at body temperature, and therefore melts in the rectum or vaginal cavity, and releases the receptor antagonist.
  • Opthalmic formulations, eye ointments, powders and solutions are also included within the scope of the disclosed invention.
  • the polyclonal and monoclonal antibodies specific to the C5a analogues also exhibit substantially no cross-reactivity with human C5a.
  • substantially no cross-reactivity it is meant that the anti-C5a analogue antibodies exhibit extremely low (negligible) cross-reactivity with human C5a such that no interference by endogenously produced C5a with the assay for the instant C5a analogues in biological samples can be detected.
  • the C5a analogue-specific antibodies of the present invention are particularly useful to detect and quantify circulating C5a analogue in a subject previously administered with same, as well as in modulating, e.g., neutralizing, the activity of the circulating C5a analogue.
  • Circulating C5a analogue can be detected in accordance with standard immunological techniques which utilize antibodies.
  • a fluid or tissue sample is obtained from the subject and then reacted with an antibody specific to the C5a analogue which was administered to the subject, under conditions suitable to allow for the detectable formation of an immune complex between the analogue and the antibody.
  • the formation of such an immune complex is indicative of the presence of the analogue in the sample.
  • the use of plasma or serum samples in such assays are preferred.
  • tissue such as certain blood cells, e.g., PMNL's
  • the presence and/or extent of reaction can be determined in a variety of methods known in the art such as radioimmunoassay, enzyme immunoassay, fluorescent immunoassay, fluorescent microscopy, etc., and the like.
  • Qualitative and quantitative suitable immunological assay methods are disclosed in J. Butler, Immunochemistry of Solid-Phase Immunoassay, CRC Press (1991)
  • Assays to detect circulating C5a analogue are typically employed to monitor levels of the analogue during treatment.
  • the antibodies of the present invention can be advantageously used in a pharmaceutical composition to modulate or neutralize the activity of the circulating C5a analog.
  • the amount of antibody used will be a molar equivalent of the amount of analogue administered.
  • the compositions may be administered to a subject parenterally. Intravenous administration is preferred especially in an emergency situation.
  • the antibodies will be formulated in a unit dosage injectable form in association with a pharmaceutically acceptable vehicle such as saline or Ringer's solution.
  • the human C5a gene was synthesized by oligonucleotide coupling.
  • the codon usage of this synthetic gene was designed for optimal expression in E. coli.
  • the synthetic strategy is illustrated in Fig. 1. It entailed the condensation of five fragments with the N-terminal residue changed from Thr to Met since the AUG codon gives a much higher frequency of translation initiation than any other codon.
  • Fragment 1 encodes a Shine-Delgarno sequence and the ATG start codon of the synthetic gene.
  • Fragments 2-5 encode the C5a gene.
  • Oligonucleotide Synthesis Oligonucleotides were synthesized on a Gene Assembler (Pharmacia) by the solid phase phosphoramidite method.
  • the fully synthesized oligonucleotides were cleaved from the solid support and deprotected by incubation with concentrated NH4OH for 16 h at 55°C.
  • the oligonucleotides were then purified by preparative gel electrophoresis.
  • the acrylamide concentration used varied from 10% for oligonucleotides greater than 70 bases to 20% for those less than 40 bases in length.
  • the oligonucleotides were visualized by UV shadowing and the major high molecular weight fragment was excised from the gel.
  • the gel slice was pulverized in a test tube with a glass rod and the DNA extracted by incubation in 3.0 ml of 0.1 M triethylammoniun bicarbonate (TEAB) buffer at pH 7.5 for 16 h at 37°C.
  • TEAB triethylammoniun bicarbonate
  • the gel remnants were removed by centrifugation and the oligonucleotides isolated by chromatography on SepPak C-18 columns (Waters Associates). The columns were pre-equilibrated by washing sequentially with 10 ml acetonitrile, 5 ml 30% acetonitrile in 50 mM TEAB and 10 ml 25 mM TEAB. The oligonucleotides were applied, washed with 10 ml 25 mM TEAB, and eluted from the columns with 5 ml 50% acetonitrile in 35.5 mM TEAB. Fractions were collected and those containing the oligonucleotides, as determined by absorbance at 260 nm, were dried in a SpeedVac (Savant).
  • Savant SpeedVac
  • each oligonucleotide was phosphorylated at the 5' end.
  • the kinase reaction mixture contained 1 ug of oligonucleotide in a total volume of 40 ul, 77 mM TRIS at pH 7.5, containing 12 mM MgCl2, 1 mM DTT (dithiothreitol) and 2 mM ATP.
  • the reaction was initiated by the addition of 10 units of T4 polynucleotide kinase and was allowed to proceed for 40 min at 37°C.
  • E. coli JM101 was transformed with the ligated M13 DNA. Isolation of the M13 phage from the recombinant clones was followed by sequence analysis of the construction. The final C5a gene was cloned into M13mpl8 to give M13mpl8/C5a(l-74). The C5a(l-74) gene was subsequently subcloned into a pB-6 vector, derived from plasmids pTZ19R and pKK223-3 both derived from Pharmacia) to yield pB-6/C5a(l-74). See Fig. 2.
  • a 230 bp fragment containing the mutation was subcloned into the pB-6 vector.
  • the resulting plasmid, pB-6/C5a(l-74,C27S), was sequenced again via the dideoxy method to confirm the mutation.
  • the plasmid pB-6/C5a(l-74,C27S) or pB-6/C5a(l-74) was restricted with EcoRI and
  • 10 ul TE containing about 60 ug of pWCBl 12, were mixed with 6 ul containing 60 U of PVUII and 3 ul containing 60 U of Hindi ⁇ (New England Biolabs) and 10 ul of 10 x High Salt buffer (IM NaCl, 0.5 M Tris/HCl at pH 7.5, 0.1 M MgC_2, 10 mM DTT) and 71 ul ddH2 ⁇ for a total volume of 100 ul. This solution was incubated at 37°C for 16 hours.
  • the thus-linearized vector of about 4.5 Kb was purified by preparative electrophoresis using a 1% agorose gel, followed by electroelution of the DNA fragment from the excised agarose gel slice.
  • the recovered DNA fragment was transferred to an Eppendorf tube, 1 ml of absolute ethanol was added and the tube centrifuged for 10 min at 14,000 rpm in an Eppendorf centrifuge.
  • the DNA pellet was dried under vacuum and subsequently dissolved in 45 ul TE buffer (10 mM Tris.HCl at pH 7.4 containing 1 mM EDTA) yielding pWCB112/A.
  • 5'CTGCGTGCTAACATCTCTCACAAAGACATGTGCTA3' (SEQ. ID. NO. 7)
  • 5 ⁇ GCTTAGCACATGTCTTTGTGAGAGATGTTAGCACGCAG3' (SEQ. ID. NO. 8)
  • the gel slice was pulverized in a test tube with a glass rod and the DNA extracted by incubation in 3.0 ml of 0.1 M TEAB buffer at pH 7.5 for 16 h at 37°C.
  • the gel remnants were removed by centrifugation and the oligonucleotides isolated by chromatography on SepPak C-18 columns (Waters Associates). The columns were pre-equilibrated by washing sequentially with 10 ml acetonitrile, 5 ml 30% acetonitrile in 50 mM TEAB and 10 ml 25 mM TEAB. The oligonucleotides were applied, washed with 10 ml 25 mM TEAB, and eluted from the columns with 5 ml 50% acetonitrile in 35.5 mM TEAB.
  • the double-stranded DNA was hgated into the restricted vector pWCBl 12 using a 3-fold excess of insert over vector with 1 ul, 2 U, of T4 DNA ligase (BRL). The reaction was run for 17 hours at 4°C.
  • CTGCGTGCTAACATCTCTCACAAAGACATGTGCCTGTA (SEQ. ID. NO. 33) AGCTTACAGGCACATGTCTTTGTGAGAGATGTTAGCACGCAG (SEQ. ID. NO. 34)
  • CTGCGTGCTAACATCTCTCACAAAGACATGCAACTGGGTTGCTA SEQ. ID. NO. 35
  • Analogue Nos. 10-20 are agonists, and are outside the scope of the present invention. They were included for purposes of comparison. The preparation of the dimeric form of analogue No. 8 is described in Example 5c, below. It is designated Analogue No. 22.
  • E. coli strain LCIQ is a derivative of strain LCI 37 (Ion, htpR) disclosed in Goff et al., Proc. Natl. Acad.
  • the precipitate was removed by centrifugation and the supernatant was purified on a DeltaPak C18,100 A, 15 micron, reverse phase HPLC column (Waters) using a linear gradient from 25% to 35% acetonitrile in water in the presence of 0.1% TFA over 30 min. The major peak eluting from the column at about 28% acetonitrile was collected and lyophilyzed.
  • This fraction contained the gluthafhione adduct of recombinant C5a analogue (adducts of analogues 5, 7, 8, 9, and 21 in Table 1), or the cysteine-adduct of the C5a analogue (the adduct of analogue No. 8, Table 1).
  • Recombinant protein was isolated from the frozen cell E. coli paste aliquots from Example 4 after thawing in a buffer containing 6 M guanidinium hydrochloride (5:1 v:w, buffe ⁇ cell paste). The cells were then disrupted by sonication and the product was diluted twenty-fold with 100 mM Tris/HCl buffer at pH 7.4 containing 1 mM reduced/0.01 mM oxidized glutathione. After 4 h, the solution was acidified to pH 3 by the addition of 6 N HCl.
  • the resulting precipitate was removed by centrifugation and the supernatant was purified on a DeltaPak C18, 100 A, 15 micron, reverse phase HPLC column (Waters) using a linear gradient from 25 to 35% acetonitrile in the presence of 0.1% TFA over 30 min. The major peak eluting from the column at about 30% acetonitrile was collected and lyophilized.
  • the thus-isolated C5a analogue had a C-terminal cysteine having a reduced thiol group.
  • the recombinant protein was isolated from the frozen R coli paste aliquots from Example 4 after refolding according to Example 5b using a 1 mM reduced/0.01 mM oxidized glutathione mixture in 100 mM Tris HCl at pH 7.4. After 4 h, the solution was acidified to pH 3 by the addition of 6 N HCl. The resulting precipitate was removed by centrifugation and the supernatant absorbed on a SP-Spherodex ion exchange column, equilibrated with 25 mM buffer at pH 7.0.
  • the C5a analogue was eluted from the column with 25 mM Tris at pH 7.0, containing 0.75 M NaCl.
  • the partially purified C5a analogue was brought to pH 3.0 with formic acid, and diluted with distilled water to achieve a protein solution having a conductivity of about 45 mS/cm, and absorbed to a SP-High Performance ion exchange column equilibrated in 50 mM formic acid at pH 3.5, containing 0.6 M NaCl.
  • C5a analogue was eluted from the column using a linear gradient from 0.6-1.0 M NaCl in 50 mM formic acid buffer at pH 3.5.
  • the major peak eluting from the column at about 0.725 M NaCl was collected.
  • the thus-isolated C5a analogue had a C-terminal cysteine having a reduced thiol group.
  • Adjustment of the pH to 7.0 with a 25% aqueous ammonia solution and storage of the solution resulted in a conversion of the molecule to its dimeric form.
  • pH 7.0 and a protein concentration of about 0.3-0.6 mg/ml and storage at 4-8°C the conversion was at least 80% completed in 2 days.
  • the dimeric form of the C5a analogue was finally purified on a DeltaPak C18, lOOA, 15 micron, reverse phase HPLC column (Waters) using a linear gradient from 25% to 40% acetonitrile in the presence of 0.1% TFA over 30 min. The major peak eluting from the column at about 33% acetonitrile was collected and lyophilized.
  • the thus-isolated molecule was a dimer of the C5a analogue produced by the R, coli expression system.
  • C5a and C5a receptor antagonists were tested for their affinity for the C5a receptor. Binding of [1251] BH-labelled C5a, prepared as described in Harris et al., J. Receptor Res. 11:115-128 (1991), to PMNL membranes was measured as described in Rollins et al., J. Biol. Chem. 263:520-526 (1988), with modifications as described in Braunwalder et al., Mol. Immunol. 29(11):1319-1324 (1992).
  • PMNLs were resuspended in Hanks balanced salt solution, without Ca ++ and Mg ++ and which contained 10 mM HEPES at pH 7.3, 2.5 mM MgCl2, 100 units/ml DNAse I, 0.1 mM PMSF, 10 ug/ml aprotonin and 10 ug/ml leupeptin. They were then equilibrated at 400 psi for 20 min at 4°C in a nitrogen cavitation bomb. After evacuation into 3 volumes 0.5 M KHCO3 containing 25 mM EDTA and the protease inhibitors listed above, the gelatinous material was removed with forceps and the mixture was centrifuged at 400 x g for 10 min at 4°C.
  • the resulting supernatant was centrifuged at 50,000 x g for 60 min at 4°C.
  • the pellets from the aliquots representing 200 x 10" cells were stored at -70°C.
  • these membranes were resuspended at an equivalent of 20 x 10 ⁇ cells/ml in 50 mM HEPES at pH 7.3, containing 1 mM CaCl2, 5 mM MgC-2, 0.1 mM PMSF, 0.1% bacitracin and 0.5% BSA.
  • Nonspecific binding was determined in the presence of 10 nM unlabelled C5a.
  • the binding reaction was initiated by the addition of the PMNL membranes and was continued for 120 min at 4°C. Bound and free radioactivity were separated by vacuum filtration through GF/C glass fiber filters (Whatman), pretreated for 90 min with 0.05% PEI (polyethyleneimine) using a Cell Harvester (Brandel, Gaithersburg, MD). Filters were washed with 3 x 5 ml of ice-cold 5 mM Tris buffer at pH 7.4 and counted in a multiwell Gamma counter (Genesys).
  • the C5a analogues of the present invention competitively displace wild- type C5a with nanomolar Kjs.
  • the C5a analogues of the present invention have an affinity for the C5a receptor measured as a K j in the competitive displacement assay disclosed in Braunwalder et al., supra, (using the radioligand, [1251] Bol ton-Hunter labelled C5a), of less than about 1.0 x 10 " ° M, preferably less than about 2.0 x 10 " ⁇ M, and more preferably less than about 1.0 x 10 " 10 M.
  • Recombinant human C5a was dissolved in Hanks buffer containing 0.01% Tween-20, and all stock dilutions of C5a were made in this buffer.
  • the acetoxymethyl ester of fura-2 (fura 2AM, Molecular Probes) was dissolved in DMSO.
  • Neutrophils were purified from human peripheral blood by sedimentation in 6% hetastarch (HESPAN, DuPont, Waukegan, IL), followed by counter flow elutriation as described in Chapman-Kirkland et al., J. Immunol. Meth. 142:95-104 (1991).
  • Purified cells (2 x 10 6 /ml) were mixed with 0.2 uM fura- 2AM and incubated for 30 min at 37°C in HEPES buffered Hanks solution without calcium or magnesium. Fifteen minutes before the assay, the cell suspension was transferred to a curvette containing a stir bar and calcium was added to 1 mM. The cell suspension was incubated with stirring at 37°C. Assays were terminated within 5 h of cell purification and a standard control response was obtained periodically to insure that the cell responses were not changing over the time of the experiment. The amount of fluorescence was determined using an SLM 8000 spectrofluorometer (SLM-Aminco Instruments, Urbana, IL).
  • Curvettes were placed in the fluorometer and after obtaining a baseline for 10 sec, the C5a receptor antagonists to be tested for antagonistic properties were added and any change in fluoresence excitation ratio of 340 nm/380 nm (emission of 510 nm) was measured. Forty seconds after analogue addition, a challenge dose of C5a was added to a final concentration of 100 pM and the resulting change in excitation ratio was measured.
  • IC50 values were used as a measure of antagonist potency. These values are defined as the concentration of C5a analogue needed to reduce the calcium rise response of the 100 pM C5a challenge dose by 50%. EC50 values were used as a measure of agonist potency. EC50 is defined as that concentration of C5a analogue that elicited 50% of the maximum calcium rise response produced by the analogue. The results are set forth below in Table 5. TABLE 5
  • Ca5 analogue No. 7 was tested up to a concentration of 1.0 x 10 ⁇ M.
  • C5a analogue No. 8 was tested up to a concentration of 3.0 x 10 " " M
  • analogue No. 9 was tested up to a concentration of 1.5 x 10" M
  • analogue No. 21 was tested up to a concentration of 8.0 x 10 " ' M.
  • Agonist activity was not detected in all cases.
  • C5a alone was injected at a dose of 50 ng/site, and the C5a receptor antagonists were co-injected at various concentrations with the same dose of C5a.
  • 18-36 uCi of [125I]-labeled bovine serum albumin in 1.0 ml physiological saline were introduced into the systemic circulation via the marginal auricular vein.
  • the rabbit was euthanized with an IN. overdose of sodium pentobarbital.
  • a 5.0 ml sample of peripheral blood was secured via cardiac puncture, centrifuged at 2000 rpm for 10 minutes, and 1.0 ml of plasma was collected and used as a reference to determine the amount of 1251 in the plasma.
  • the dorsal skin was excised and pinned to a wooden dissecting board. Blood in the major vasculature of the skin was manually expressed toward the periphery. This procedure reduced variation among skin sites and decreased background radioactivity. Inflammatory lesions were then punched out of the skin with the aid of a 15 mm cork borer and mallet and deposited in 12 x 75 mm polystyrene tubes. Injection sites were then analyzed for their radioactive content using a Gamma Counter (Genesys). The amount of [125_]-bovine serum albumin (BSA) that exuded from the blood vessels and which was localized at the inflammatory sites was found to be directly proportional to the degree of enhancement in vascular permeability.
  • the ED50 value of the C5a analogue is the dose of that C5a analogue causing a 50% reduction in the radioactivity produced by 50 ng C5a co-injected at the same site.
  • C5a analogue No. 8 (in Table 1) was found to possess an ID50 of 70 ng/site, and did not cause a pro-inflammatory reaction at the dose of 175 ng/site. This result demonstrates that the analogue is an antagonist in vivo and does not exhibit agonist properties in vivo.
  • a second blood sample (#2) was obtained and twenty seconds thereafter 100 ng of C5a in 0.2 ml were infused intravenously (bolus injection). Twenty seconds later, a third blood (#3) sample was taken. Thirty minutes later, a second round of blood sample (#4) ⁇ 20 seconds ⁇ C5a infusion—20 seconds—blood sample (#5) was performed. Blood samples were evaluated by automated hematologic analysis (Technicon H*l) using software specific for rabbit blood. Reductions in neutrophil counts (number per milliliter) induced by C5a(C5a-induced neutropenia, determined by comparing blood sample #3 to #2 and #5 to #4) were compared between vehicle-treated and C5a analogue-treated animals.
  • the C5a analogue did not alter baseline neutrophil counts from normal; i.edeem the C5a analogue did not exhibit agonistic (C5a-like) properties.
  • C5a-induced neutropenia in the C5a analogue-treated rabbits was significantly (P>0.05) inhibited as compared to vehicle-treated rabbits by 67% and 41% at the 40-second and 30-minute C5a challenge intervals, respectively.
  • C5a(l-71,C27S,Q71C) conjugate (0.5 ml) was homogenized with 0.5 ml of Freund's Complete Adjuvant (Sigma Chemical Co., St. Louis, MO).
  • Female New Zealand White rabbits purchased from Millbrook Farms (Amherst, MA), were injected subcutaneously in two sites (0.2 ml homogenate per site) in the scapular areas. After 21 days the procedure was repeated. Further injections were carried out using Freund's Incomplete Adjuvant (Sigma); the third injection was given after a total of 55 days, and a fourth at 126 days.
  • Blood (ca. 30 ml) was taken from the rabbits between 3 and 5 weeks after each injection, allowed to clot and the serum removed.
  • C5a(l-71,C27S,Q71C) or C5a (1 mg) was conjugated to 2 mg Bovine serum albumin (BS A), using the Imject Immunogen EDC conjugation kit from Pierce Chemical Co. and l 2 ⁇ I-C5a to follow efficiency, as described above.
  • the final volume of C5a(l-71,C27S,Q71C)/BSA was 2.25 ml at 0.25 mg ml C5a(l-71,C27S,Q71C); for C5a/BSA the final volume was 2.25 ml at 0.32 mg/ml C5a. Both conjugates contained an estimated 0.9 mg/ml BSA.
  • the two peptide conjugates were dialysed against 0.2M sodium hydrogen carbonate buffered to pH 8.6 with sodium carbonate.
  • 2 ml of AH(aminohexyl)-Agarose gel (Sigma Chemical Co., St. Louis, MO) prewashed in the same buffer was activated by adding gluteraldehyde to a final concentration of 1% v/v and incubating for 15 min at 20°C. The gel was washed thoroughly in buffer to remove gluteraldehyde, then the conjugate solutions were added and incubated at 20°C for 1 hr.
  • the uncoupled protein was rinsed away from the gel and remaining binding sites were blocked by overnight incubation at 4°C with 20 ml 0.2M glycylglycine.
  • the gel was packed into a 0.5 cm x 10 cm glass column and washed thoroughly with Dulbecco's phosphate-buffered saline pH 7.2 containing 0.1% sodium azide (PBS-A).
  • Serum from rabbits immunized with C5a(l-71,C27S,Q71C) was passed through the C5a/BSA column at 2ml/hr.
  • the absorbed antiserum emerging from the column was collected.
  • the column was washed thoroughly with 0.5M NaCl buffered with 0.05M sodium phosphate to pH 7.2 and containing 0.1% sodium azide.
  • Bound antibody was removed with 3M ammonium thiocyanate.
  • the eluting antibody was detected using an in-line UV monitor reading at 280nm and set at 0.2 OD maximum deflection.
  • the eluting antibody was collected and immediately dialysed against PBS-A, then concentrated by ultrafiltration to around 1 mg/ml. This process was repeated several times for each serum batch. Sera were considered to be absorbed when no more protein was detected eluting from the C5a column.
  • the absorbed antiserum was then passed through the C5a(l-71,C27S,Q71C) immunoabsorbent column. Bound antibody was eluted with 3M ammonium thiocyanate and immediately dialysed against PBS-A, then concentrated to ca. 1 mg/ml.
  • the anti-C5a(l-71,C27S,Q71C) antibody eluted from the C5a column i.e., antibody which cross-reacts with C5a
  • alkaline phosphatase 1.4 mg of antibody in 1 ml of PBS was added to 5 mg (5,000 units) of alkaline phosphatase (Type V ⁇ -T,
  • Gluteraldehyde was added to a final concentration of 0.2% v/v. The mix was incubated at 20°C for 90 mins, then dialysed overnight against PBS-A at 4°C.
  • the buffer was changed to 0.05M Tris buffer, pH 8.0 containing ImM magnesium chloride, and dialysed overnight at 4°C.
  • Labelled antibody was added at 1:3000 in 100 ul PBS/BSA and incubated overnight at 4°C. The plates were washed and then enzyme substrate (for alkaline phosphatase, p-nitrophenyl phosphate (Sigma Chemical Co.) at 1 mg/ml in 10% v/v diethylamine pH 9.8) was added. Color development was allowed to proceed at 20°C in the dark for about 5hrs. The plates were read at 405nm using a Biomek 1000 (Beckman Instruments, CA, USA).
  • C5a(l-71,C27S,Q71C) or C5a was used to coat microtiter plates at 1 ug/well in 100 ul coating buffer for 4hr at 20°C.
  • the plates were washed and serial dilutions of the antibody eluted from C5a(l-71,C27S,Q71C) after absorption on C5a were made into the plate wells in 100 ul PBS/BSA. After 4hr incubation at 20°C, the plates were washed again. Binding of rabbit antibody was detected with goat anti-rabbit/Horseradish peroxidase (Pierce Chemical Co.) at 1:1000 in PBS/BSA, 100 ul/well.
  • the samples were diluted in PBS/BSA and quantified in the ELISA against the standard curve generated in Example 11.
  • the increase in circulating C5a(l-71,C27S,Q71C) with time was then determined. No activity could be detected in samples taken from the two rabbits before injection of C5a(l-71,C27S,Q71C), demonstrating the specificity of the antibody.
  • the results also demonstrate that the antibody exhibits no cross-reactivity with rabbit C5a, and that C5a(l-71,C27S,Q71C) is not a naturally occurring substance in rabbits.
  • C5aQ-71.C27S.O71C use of the specific anti-C5a(l-71.C27S.O71C) antibody as an antidote for C5a(l-71,C27S,O71C)
  • the plasma sample obtained from the last time point of rabbit #2 (from Example 13) was subjected to serial doubling dilutions and the slope of the curve obtained was compared with the slope of the standard curve. The two slopes were parallel, indicating that
  • CTGCGTGCTA ACATCTCTCA CAAAGACATG TGCTA 35
  • CTGCGTGCTA ACATCTCTCA CAAATGCTA 29
  • CTGCGTGCTA ACATCTCTCA CAAAGACTGC TA 32
  • CTGCGTGCTA ACATCTCTCA CAAAGACATG TGCTA 35
  • CTGCGTGCTA ACATCTCTCA CAAAGACATG CAATGCTA 38
  • CTGCGTGCTA ACATCTCTCA CAAAGACATG TGCCTGGGTC GTTA 44
  • CTGCGTGCTA ACATCTCTCA CAAAGACATG TGCCTGGGTT A 41
  • CTGCGTGCTA ACATCTCTCA CAAAGACATG TGCCTGTA 38
  • CTGCGTGCTA ACATCTCTCA CAAAGACATG CAACTGGGTT GCTA 44
  • CTGCGTGCTA ACATCTCTCA CAAAGACATG CAATA 35
  • CTGCGTCCTA ACATCTCTCA CAAAGACATG GACTA 35
  • CTGCGTGCTA ACATCTCTCA CAAAGACATG TCTTA 35
  • CTGCGTGCTA ACATCTCTCA CAAAGACATG CGTTA 35
  • CTGCGTGCTA ACATCTCTCA CAAAGACATG CTGTA 35
  • CTGCGTGCTA ACATCTCTTT CAAAGACATG TGCTA 35
  • GAATTCCCAC TCAAAATAAG GAGGAAAAAA AAATGCTGCA GAAGAAAATC GAAGAAATCG 60
  • CTGCTAAGTA CAAACACTCT GTTGTTAAAA AATGCTGCTA CGACGGTGCT TCTGTTAACA 120

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Immunology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Biomedical Technology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Urology & Nephrology (AREA)
  • Rheumatology (AREA)
  • Cardiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pain & Pain Management (AREA)
  • Zoology (AREA)
  • Dermatology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Psychiatry (AREA)
  • Endocrinology (AREA)
  • Reproductive Health (AREA)
  • Toxicology (AREA)
EP94931155A 1993-12-06 1994-11-16 Csa rezeptor antagonisten, die wesentlich keine agonist aktivität besessen Withdrawn EP0733107A1 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US16259193A 1993-12-06 1993-12-06
PCT/IB1994/000359 WO1995016033A1 (en) 1993-12-06 1994-11-16 C5a RECEPTOR ANTAGONISTS HAVING SUBSTANTIALLY NO AGONIST ACTIVITY
US162591 1998-09-29

Publications (1)

Publication Number Publication Date
EP0733107A1 true EP0733107A1 (de) 1996-09-25

Family

ID=22586301

Family Applications (1)

Application Number Title Priority Date Filing Date
EP94931155A Withdrawn EP0733107A1 (de) 1993-12-06 1994-11-16 Csa rezeptor antagonisten, die wesentlich keine agonist aktivität besessen

Country Status (15)

Country Link
EP (1) EP0733107A1 (de)
JP (1) JPH09506258A (de)
CN (1) CN1142854A (de)
AU (1) AU698919B2 (de)
BR (1) BR9408265A (de)
CA (1) CA2176825A1 (de)
FI (1) FI962319A0 (de)
HU (1) HUT75990A (de)
IL (1) IL111792A0 (de)
MX (1) MXPA99008669A (de)
NO (1) NO962348L (de)
NZ (1) NZ274917A (de)
TW (1) TW429262B (de)
WO (1) WO1995016033A1 (de)
ZA (1) ZA949647B (de)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5837499A (en) * 1993-12-06 1998-11-17 Ciba-Geigy Corporation DNA encoding C5A receptor antagonists having substantially no agonist activity and methods of expressing same
EP0832223A1 (de) * 1995-06-05 1998-04-01 Novartis AG Antagonisten von c 5a-rezeptoren ohne agonistische wirkung und verfahren zu deren herstellung
BR9607139A (pt) * 1995-12-13 1997-11-25 Northern Telecom Ltd Sistemas de telecomunicações de dados com pacote digital e voz celular integrado e processos para sua operação
AUPO755097A0 (en) 1997-06-25 1997-07-17 University Of Queensland, The Receptor agonist and antagonist
TWI767415B (zh) * 2020-11-18 2022-06-11 中國醫藥大學 自動化血液分析系統及自動化血液分析方法
CN113150106B (zh) * 2021-04-26 2022-08-16 华中农业大学 来源于补体成分C5a的抗菌肽及其应用

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0305615A1 (de) * 1987-09-03 1989-03-08 Immunetech Pharmaceuticals, Inc. Peptidantagonisten für C5a-Anaphylotoxin
JP2703764B2 (ja) * 1986-04-28 1998-01-26 シータス オンコロジー コーポレイション 補体成分C5aに対するモノクローナル抗体

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9516033A1 *

Also Published As

Publication number Publication date
ZA949647B (en) 1995-06-06
MXPA99008669A (es) 2004-09-01
CN1142854A (zh) 1997-02-12
HU9601538D0 (en) 1996-07-29
FI962319A (fi) 1996-06-03
CA2176825A1 (en) 1995-06-15
AU8002594A (en) 1995-06-27
IL111792A0 (en) 1995-01-24
HUT75990A (en) 1997-05-28
JPH09506258A (ja) 1997-06-24
NO962348L (no) 1996-08-05
NZ274917A (en) 1998-03-25
FI962319A0 (fi) 1996-06-03
AU698919B2 (en) 1998-11-12
TW429262B (en) 2001-04-11
BR9408265A (pt) 1996-12-10
NO962348D0 (no) 1996-06-05
WO1995016033A1 (en) 1995-06-15

Similar Documents

Publication Publication Date Title
CA1339210C (en) Recombinant techniques for production of novel natriuretic and vasodilator peptides
EP0308378B2 (de) Tumor-Nekrosisfaktor-Inhibitor-Protein und dessen Reinigung
US5807824A (en) C5A receptor antagonists having substantially no agonist activity
EP0579739A1 (de) Interleukin-8-rezeptoren, damit in zusammenhang stehende moleküle und verfahrensweisen
US5783421A (en) DNA encoding novel polypeptide having Factor Xa inhibitory activity
AU698919B2 (en) C5a receptor antagonists having substantially no agonist activity
EP0832223A1 (de) Antagonisten von c 5a-rezeptoren ohne agonistische wirkung und verfahren zu deren herstellung
US5837499A (en) DNA encoding C5A receptor antagonists having substantially no agonist activity and methods of expressing same
EP0210233A1 (de) Vom gehirn abgeleitete polypeptidfaktoren und antikörper
US5476839A (en) Basophil granule proteins
CA2046925A1 (en) Pregnancy specific proteins applications
JP3509860B2 (ja) 新規好中球インヒビター
AU741330B2 (en) Rat ST38.2 chemokine
EP0696198B1 (de) Neuartiges polypeptid mit einer inhibierenden aktivität gegen faktor xa
WO1996021006A1 (en) Novel phosphoprotein secreted in the extracellular matrices of mammalian organs and methods for use thereof
EP1492811A1 (de) Muteine des c5a anaphylatoxins, für solche muteine kodierende nukleinsäuremoleküle, sowie pharmazeutische verwendungen von muteinen des c5a anaphylatoxins
EP0693925B1 (de) Herstellung eines rekombinanten inhibitors des faktors xa des blutegels hirudo medicinalis
US20020165354A1 (en) Tumor necrosis factor inhibitory protein and its purification
NZ516533A (en) Use of neutrophil inhibitors in the manufacture of medicaments to inhibit inflammatory responses and neutrophil activity
JPH06279496A (ja) ハムスター脳ナトリウム利尿ペプチド

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19960506

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: NOVARTIS AG

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: NOVARTIS-ERFINDUNGEN VERWALTUNGSGESELLSCHAFT M.B.H

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: NOVARTIS-ERFINDUNGEN VERWALTUNGSGESELLSCHAFT M.B.

Owner name: NOVARTIS AG

17Q First examination report despatched

Effective date: 19991207

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: NOVARTIS-ERFINDUNGEN VERWALTUNGSGESELLSCHAFT M.B.

Owner name: NOVARTIS AG

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20020601