Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P37/00—Drugs for immunological or allergic disorders
  • A61P37/08—Antiallergic agents
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
  • C07K16/16—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from plants
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides

Definitions

• Lol p I peptides of the invention can be used as "purified" allergens to standardize allergen extracts.
• an animal such as a mouse or rabbit can be immunized with an immunogenic form of an isolated Lolp I peptide of the invention capable of eliciting an antibody response.
• Techniques for conferring immunogenicity on a peptide include conjugation to carriers or other techniques well-known in the art.
• the Lol p I peptide can be administered in the presence of adjuvant. The progress of immunization can be monitored by detection of antibody liters in plasma or serum standard ELISA or other immunoassay can be used with the immunogen as antigen to assess the levels of antibodies.
• the tablets, troches, pills, capsules and the like may also contain the following: a binder such as gum gragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, lactose or saccharin or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring.
• a binder such as gum gragacanth, acacia, corn starch or gelatin
• excipients such as dicalcium phosphate
• a disintegrating agent such as corn starch, potato starch, alginic acid and the like
• a lubricant such as magnesium stearate
• a sweetening agent such as sucrose, lactose or saccharin or a flavoring agent such as peppermint, oil of wintergreen, or
• peptides of the invention having a mean T cell stimulation index of at least 5, as shown in Fig. 3, include LPI-2 (SEQ ED NO: 5), LPI-3 (SEQ ED NO: 6), LPI-15 (SEQ ED NO: 21), LPI-16 (SEQ ID NO: 22) , LPI-16.1 (SEQ ID NO: 23) , LPI-17 (SEQ ID NO: 24), LPI-19 (SEQ ID NO: 26), LPI-20 (SEQ ID NO: 27), LPI-22 (SEQ ID NO: 29) and LPI-23 (SEQ ID NO: 30).
• preferred therapeutic compositions of the invention preferably comprise at least two T cell epitopes of Lolp I, and accordingly, the peptide comprises at least approximately eight amino acid residues and preferably at least fifteen amino acid residues. Additionally, therapeutic compositions comprising preferred isolated peptides of the invention most preferably comprise a sufficient percentage of the T cell epitopes of the entire protein allergen so that a therapeutic regimen of administration of the composition to an individual sensitive to ryegrass pollen results in T cells of the individual being tolerized to the protein allergen.
• Synthetically produced peptides of the invention comprising up to approximately forty-five amino acid residues in length, and most preferably up to approximately thirty amino acid residues in length are particularly desirable, as increases in length may result in difficulty in peptide synthesis.
• Peptides of the invention may also be produced recombinantly as described above, and peptides exceeding 45 amino acids will be more easily produced recombinantly.
• Such linker can be any non-epitope amino acid sequence or other appropriate linking or joining agent
• the regions are arranged in the same or a different configuration from a naturally-occurring configuration of the regions in the allergen.
• the regions containing T cell epitope(s) can be arranged in a noncontiguous configuration and can preferably be derived from the same protein allergen.
• Noncontiguous is defined as an arrangement of regions containing T cell epitope(s) which is different than that of the native amino acid sequence of the protein allergen from which the regions are derived.
• Examples of preferred peptide regions which do not bind to IgE include: LPI-1 (SEQ ID NO: 3), LPI-1.1 (SEQ ID NO: 4), LPI-2 (SEQ ID NO: 5), LPI-3 (SEQ ED NO: 6), LPI-4 (SEQ ID NO: 7), LPI-4.1 (SEQ ID NO: 8), LPI-5 (SEQ ID NO: 9), LPI-6 (SEQ ID NO: 10), LPI-7 (SEQ ID NO: 11), LPI-8 (SEQ ID NO: 12), LPI-9 (SEQ ID NO: 13), LPI-10 (SEQ ED NO: 14), LPI-11 (SEQ ID NO: 15), LPI-12 (SEQ ID NO: 17), LPI-13 (SEQ ID NO: 19), LPI-14 (SEQ ID NO: 20), LPI-15 (SEQ ID NO: 21), LPI-16 (SEQ ID NO: 22), LPI-16.1 (SEQ ID NO: 23), LPI-17 (SEQ ID NO: 24), LPI-18 (SEQ ID NO: 3
• LPI-3 (SEQ ID NO: 6), LPI-4.1 (SEQ ID NO: 8), LPI-10 (SEQ ID NO: 14), and LPI- 11 (SEQ ID NO: 15);
• LPI-20 SEQ ID NO: 27
• LPI-22 SEQ ID NO: 29
• compositions comprising at least two peptides (e.g., a physical mixture of at least two peptides), each comprising at least one T cell epitope of Lol p I.
• compositions can be in the form of a composition additionally with a pharmaceutically acceptable carrier of diluent for therapeutic uses, or with conventional non-pharmaceutical excipients for reagent use.
• an effective amount of one or more of such compositions can be administered simultaneously or sequentially to an individual sensitive to ryegrass pollen.
• peptides LPI- 16.1 (SEQ ID NO: 23), LPI- 18 (SEQ ro NO: 23), LPI-20 (SEQ ID NO: 27), and LPI-23 (SEQ ID NO: 30) may be substituted as follows: peptide LPI- 16.1 (SEQ ID NO: 23) (Fig.
• the samples were amplified with a programmable thermal controller (MJ Research, Inc., Cambridge, MA).
• the first 5 rounds of amplification consisted of denaturation at 94°C for 1 minute, annealing of primer to the template at 45°C for 1.5 minutes, and chain elongation at 70°C for 2 minutes.
• the final 20 rounds of amplification consisted of denaturation as above, annealing at 55°C for 1.5 minutes, and elongation as above.
• RNA was isolated from the pollen of Poa pratensis, double stranded cDNA was prepared and self-annealed oligonucleotides AT and AL were added as described in section A, above.
• PCR product was amplified using oligonucleotide primers Phl-7 (5'-CCGAATTCGTGGAGAAGGGGTCCAA-3') (SEQ ID NO: 90) and Poa-1 (5'- TTAGGATCCTCACTTATCATAIGACGTATC-3' (SEQ JD NO: 91 ), wherein C at position 13 can also be T, A at position 16 can also be G, A at position 19 can also be G, G at position 23 can also be C, A at position 24 can also be T, C at position 25 can also be T or A or G and A at position 28 can be G).
• Clones containing partial nucleotide sequences of the gene encoding Poap 1 were derived from PCRs that used oligonucleotide primers AP and Poa-3 (5'-
• Clones containing partial nucleotide sequence of the gene encoding Phi p 1 were derived from a PCR using oligonucleotide primers Phl-7 (5'- CCGAATTCGTGGAGAAGGGGTCCAA-3') (SEQ ID NO: 90) and PhAl.l. Clones 47-52 were derived from this PCR. These clones encoded amino -acids 151 through 240 of Fig. 7.
• Inserts from clones 22 and 51 were isolated and ligated into appropriately digested expression vector pET-1 Id (Novagen, Madison, Wl: Jameel et al. (1990) J. Virol. £4 * 3963-3966). Recombinant proteins were expressed as descibed in section A, above.
• GAG GAG CCC ATC GCC CCC TAC CAC TTC GAC CTC TCC GGC CAC GCG TTC 336

Landscapes

• Health & Medical Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Organic Chemistry (AREA)
• Medicinal Chemistry (AREA)
• General Health & Medical Sciences (AREA)
• Biochemistry (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Molecular Biology (AREA)
• Genetics & Genomics (AREA)
• Immunology (AREA)
• Biophysics (AREA)
• Botany (AREA)
• Pharmacology & Pharmacy (AREA)
• Animal Behavior & Ethology (AREA)
• Public Health (AREA)
• Veterinary Medicine (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Pulmonology (AREA)
• Engineering & Computer Science (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Gastroenterology & Hepatology (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Peptides Or Proteins (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Applications Claiming Priority (3)

Publications (1)

Family

ID=21857138

Family Applications (1)

Country Status (10)

Families Citing this family (20)

Family Cites Families (3)

• 1994
  • 1994-03-09 NZ NZ263913A patent/NZ263913A/en unknown
  • 1994-03-09 AU AU65175/94A patent/AU684501B2/en not_active Expired - Fee Related
  • 1994-03-09 WO PCT/US1994/002537 patent/WO1994021675A2/en not_active Application Discontinuation
  • 1994-03-09 EP EP94912761A patent/EP0688338A1/en not_active Withdrawn
  • 1994-03-09 CA CA002157596A patent/CA2157596A1/en not_active Abandoned
  • 1994-03-09 JP JP6521096A patent/JPH08509966A/ja active Pending
  • 1994-03-11 ZA ZA941708A patent/ZA941708B/xx unknown
  • 1994-03-11 IL IL10894094A patent/IL108940A0/xx unknown
• 1995
  • 1995-09-11 NO NO953571A patent/NO953571L/no unknown
  • 1995-09-12 FI FI954269A patent/FI954269A/fi not_active Application Discontinuation

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events