WO1994021675A2 - T cell epitopes of ryegrass pollen allergen - Google Patents
T cell epitopes of ryegrass pollen allergen Download PDFInfo
- Publication number
- WO1994021675A2 WO1994021675A2 PCT/US1994/002537 US9402537W WO9421675A2 WO 1994021675 A2 WO1994021675 A2 WO 1994021675A2 US 9402537 W US9402537 W US 9402537W WO 9421675 A2 WO9421675 A2 WO 9421675A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- lpi
- peptide
- lys
- gly
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/08—Antiallergic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/16—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from plants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- Lolp I also known as Lol p V or Lol p lb, which has been found to be closely related to the Group V protein allergens in grasses.
- Lol p l is defined as an allergen because of its ability to bind to specific IgE in sera of ryegrass-sensitive patients, to act as an antigen in IgG responses and to trigger T-cell responses.
- the allergenic properties have been assessed by direct skin testing of grass pollen-sensitive patients. The results showed that 84% had a skin sensitivity to Lolp I (Freidhoff, et al., (1986) J. Allergy Clin. Immunol, 78:1190-1201) demonstrating the primary importance of this protein as the major allergen.
- Pooid (festucoid) grasses of the Poaceae (Gramineae) family include the following.
- GROUP 1 Triticanea: Bromus inermis, smooth brome; Agropyron repens, English couch; A. cristatum; Secale cereale rye Triticum aestivum, wheat.
- GROUP 2 Poanae: Dactylis glomerata, orchard grass of cocksfoot; Festuca elarior, meadow fescue; Lolium perenne, perennial ryegrass; L.multiflorum, Italian ryegrass; Poapratensis, Kentucky bluegrass; P.compressa, flattened meadow grass; Avena sativa, oat; Holcus lanatus, velvet grass or England fog; Anthoxanthum odoratum; sweet vernal grass; Arrhenatherum elattus, oat grass; Agrostis alba, red top; Phleumpratense, timothy; Phalaris arundinacea, reed canary grass. Panicoid grass, Paspalum notatum, Bahia grass, Andropogonoid grasses: Sorghum halepensis, Johnson grass.
- compositions and methods that could be used in detecting sensitivities to Lolp I or other immunologically related grass allergens, or in treating sensitivities to such allergens, or in assisting in the manufacture of medicaments to treat such sensitivities.
- the present invention provides materials and methods having one or more of those utilities.
- the present invention provides isolated peptides of Lol p i.
- Peptides within the scope of the invention comprise at least one T cell epitope, preferably at least two T cell epitopes of Lol p I.
- the invention further provides peptides comprising at least two regions, each region comprising at least one T cell epitope of Lol p i.
- the invention also provides modified peptides having similar or enhanced therapeutic or diagnostic properties as the corresponding, naturally- occurring allergen or portion thereof, but also having advantageous physical or biological properties, such as reduced side effects, reduced IgE binding, improved solubility, increased in vitro or in vivo T cell stimulating ability, increased stability or the like.
- Preferred peptides of the invention are capable of modifying, in a Lolp I-sensitive individual to whom they are administered, the allergic response of the individual to Lolp I or an allergen immunologically cross-reactive with Lolp I, e.g., allergens derived from pollen belonging to the Poaceae (Gramineae) family, such as Dactylis glomerata ⁇ Dae g I), Poa pretensis (Poa p i) and Phleum pratense ⁇ Phlp I), as discussed above.
- allergens derived from pollen belonging to the Poaceae (Gramineae) family such as Dactylis glomerata ⁇ Dae g I), Poa pretensis (Poa p i) and Phleum pratense ⁇ Phlp I), as discussed above.
- the present invention also provides non-native (i.e., recombinant or chemically synthesized) Lolp I peptides or their derivatives or homologues and provides non-native allergenic protein or peptides immunologically cross-reactive with antibodies or with T cells of Lol p I or derivatives or homologues thereof.
- the present invention also provides Dae g I and Poa p I protein allergens which are immunologically cross-reactive with Lolp I, and fragments of Dae g I and Poa p I produced in a host cell transformed with a nucleic acid sequence coding for Dae g I and Poa p I, respectively, and fragments of Dae g I and Poa p I prepared synthetically.
- the present invention further provides nucleic acid sequences coding for Dae g I, Poa p I and fragments thereof. Also provided are isolated peptides of Dae g I and Poa p i comprising at least one T cell epitope which are immunologically cross-reactive with peptides comprising at least one T cell epitope derived from Lolp I. Methods of treatment and of diagnosis of sensitivity to ryegrass pollen protein, Lolp I, or to pollen proteins that are immunologically related to Lolp I (such as Dae g I, Phlp I and Poap I), as well as compositions comprising one or more peptides of the invention, are also provided.
- Fig. 1 shows the nucleotide sequence of cDNA clone 26./ (SEQ ID NO 1) and its predicted amino acid sequence (SEQ ID NO: 2).
- Clone 26*j is a PCR-generated, full-length clone of Lolp I.
- Fig. 2 shows various peptides of desired lengths derived from Lolp I (SEQ ID NO: 3-30); such peptides include polymorphisms inherent in the Lol p I sequence (i.e., LPI-4.1 (SEQ ID NO: 8) and LPI-16.1 (SEQ ID NO: 23)) or homologues of peptides derived from Lolp I (i.e., LPI-11 (SEQ ID NO: 15), and LPI-12 (SEQ ID NO: 17)).
- LPI-4.1 SEQ ID NO: 8
- LPI-16.1 SEQ ID NO: 23
- homologues of peptides derived from Lolp I i.e., LPI-11 (SEQ ID NO: 15), and LPI-12 (SEQ ID NO: 17)
- Fig. 3 is a graphic representation depicting responses of T cell lines from thirty-five grass-sensitive patients primed in vitro with purified native Lol p I and analyzed for response to various Lolp I peptides by percent of positive responses (with an S.I. of at least two, shown over each bar), the mean stimulation index of positive response for the peptide (shown over each bar in parentheses) and the positivity index (% positive x mean S.I. index, Y axis).
- Fig. 4 shows various peptides of desired lengths derived from Lol p I (SEQ ID NO: 23, 25, 27, 30-50).
- Fig. 5 shows the nucleotide sequence of cDNA clone 106.5 (SEQ ID NO: 51) and its predicted amino acid sequence (SEQ ID NO: 52).
- Clone 106.5 is a PCR- generated, full-length clone of Dae g I.
- Fig. 6 shows the nucleotide sequence of cDNA clone 114 (SEQ ID NO: 53) and its predicted amino acid sequence (SEQ LD NO: 54).
- Clone 114 is a PCR- generated, full-length clone of Poa p I.
- Fig. 7 shows the nucleotide sequence of cDNA clone 20 (SEQ ID NO: 55) and its predicted amino acid sequence (SEQ ID NO: 56).
- Clone 20 is a PCR generated, full length clone of Phlp I.
- Fig. 8 shows a comparison of the amino acid sequences of the mature protein of Lolp I (SEQ ID NO: 57), Dae g I (SEQ ID NO: 58), Phlp I (SEQ ID NO: 59) , and Poa p I (SEQ ID NO: 60), including polymorphisms thereof.
- Fig. 9 shows a comparison of various peptides comprising at least one T cell epitope derived from Lol p I, with homologous peptides derived from the same regions of Dae g I, Phlp I, and Poa p i (SEQ ID NO: 23, 25, 27, 30, 61-70).
- the present invention provides isolated peptides derived from Lol p I (SEQ JD NO: 3-50).
- the present invention also provides Dae g l and Poa p I protein allergens which are immunologically cross-reactive with Lolp I.
- peptide refers to any protein fragment of Lolp I that induces an immune response.
- fragment and “antigenic fragment” of a protein as used interchangeably herein refer to an amino acid sequence having fewer amino acid residues than the entire native amino acid sequence of the protein from which the fragment is derived, and that induces an immune response.
- isolated and purified refer to peptides of the invention which are substantially free of cellular material or culture medium when produced by recombinant DNA techniques, or substantially free of chemical precursors or other chemicals when synthesized chemically.
- Preferred peptides of the invention include peptides derived from Lol p I which comprise at least one T cell epitope of the allergen, or a portion of such a peptide which includes at least one T cell epitope.
- Peptides comprising at least two regions, each region comprising at least one T cell epitope Lolp I are also within the scope of the invention. Isolated peptides or regions of isolated peptides, each comprising at least two T cell epitopes of the Lolp I protein allergen are particularly desirable for increased therapeutic effectiveness. Peptides that are immunologically related (e.g., by antibody or T cell cross-reactivity) to peptides of the present invention, such as peptides derived from Dae g I and Poa p I, are also within the scope of the invention. Peptides immunologically related by antibody cross-reactivity are recognized by antibodies specific for a peptide of Lolp I. Peptides immunologically related to a given peptide by T cell cross-reactivity are capable of also reacting with the same T cells that react with that given peptide.
- immunologically related e.g., by antibody or T cell cross-reactivity
- Isolated protein and peptides of the invention can be produced by recombinant DNA techniques in a host cell transformed with a nucleic acid having a sequence encoding such peptide.
- the isolated peptides of the invention can also be produced by chemical synthesis.
- host cells transformed with a nucleic acid having a sequence encoding a peptide of the invention or the functional equivalent of the nucleic acid sequence are cultured in a medium suitable for the cells.
- Peptides caii be purified from cell culture medium, host cells, or both, using techniques known in the art for purifying peptides and proteins including ion-exchange chromatography, gel filtration chromatography, ultrafiltration, electrophoresis or immunopurification with antibodies specific for the peptide, the protein allergen from which the peptide is derived, or a portion thereof.
- the present invention provides expression vectors and host cells transformed to express the nucleic acid sequences of the invention. Nucleic acids coding for Lol p I peptides of the invention, or at least a portion thereof, may be expressed in bacterial cells such as E. coli, insect cells, yeast, or mammalian cells such as Chinese hamster ovary cells (CHO).
- Suitable expression vectors, promoters, enhancers, and other expression control elements may be found in Sambrook et al. Molecular Cloning: A Laboratory Manual, second edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989. Other suitable expression vectors, promoters, enhancers, and other expression elements are known to those skilled in the art. Expression in mammalian, yeast or insect cells leads to partial or complete glycosylation of the recombinant material and formation of any inter- or intra-chain disulfide bonds. Suitable vectors for expression in yeast include YepSecl (Baldari et al.
- suitable expression vectors include, among others, pTRC (Amann et al. (1988) Gene, 69: 301-315); pGEX (Amrad Corp., Melbourne, Australia); pMAL (N.E. Biolabs, Beverly, MA); pRIT5 (Pharmacia, Piscataway, NJ); pET-1 Id (Novagen, Madison, Wl) Jameel et al., (1990) J. Virol, 64:3963-3966; and pSEM (Knapp et al. (1990) BioTechniques, 8: 280-281).
- pTRC Amann et al. (1988) Gene, 69: 301-315
- pGEX Amrad Corp., Melbourne, Australia
- pMAL N.E. Biolabs, Beverly, MA
- pRIT5 Pharmacia, Piscataway, NJ
- pET-1 Id Novagen, Madison, Wl
- Jameel et al. (1990)
- pMAL maltose E binding protein
- pRIT5 protein A
- PSEM protein A
- glutathione S-transf erase pGEX
- the Lolp I peptide may then be recovered from the fusion protein through enzymatic cleavage at the enzymatic site and biochemical purification using conventional techniques for purification of proteins and peptides.
- Suitable enzymatic cleavage sites include those for blood clotting Factor Xa or thrombin for which the appropriate enzymes and protocols for cleavage are commercially available from, for example, Sigma Chemical Company, St. Louis, MO and N.E. Biolabs, Beverly, MA.
- the different vectors also have different promoter regions allowing constitutive or inducible expression with, for example, IPTG induction (PRTC, Amann et al., (1988) supra; pET-lld, Novagen, Madison, Wl) or temperature induction (pRTT5, Pharmacia, Piscataway, NJ) . It may also be appropriate to express recombinant Lolp I peptides in different E. coli hosts that have an altered capacity to degrade recombinantly expressed proteins (e.g., U.S. Patent 4,758,512). Alternatively, it may be advantageous to alter the nucleic acid sequence to use codons preferentially utilized by E. coli, where such nucleic acid alteration would not affect the amino acid sequence of the expressed protein.
- Host cells can be transformed to express the nucleic acid sequences of the invention using conventional techniques such as calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, or electroporation. Suitable methods for transforming the host cells may be found in Sambrook et al. supra, and other laboratory textbooks.
- the nucleic acid sequences of the invention may also be chemically synthesized using standard techniques (i.e., solid phase synthesis). Details of the cloning of Lol p I are given in the Examples.
- Inducible non-fusion expression vectors include pTrc (Amann et al, (1988)
- target gene expression relies on host RNA polymerase transcription from the hybrid trp-lac fusion promoter in pTrc
- expression of target genes inserted into pETl Id relies on transcription from the T7 gnlO-lac 0 fusion promoter mediated by coexpressed viral RNA polymerase (T7 gnl).
- This viral polymerase is supplied by host strains BL21(DE3) or HMS174(DE3) from a resident ⁇ prophage harboring a T7 gnl under the transcriptional control of the lacUV 5 promoter.
- the nucleic acids of the invention can also be chemically synthesized using standard techniques.
- Various methods of chemically synthesizing polydeoxynucleotides are known, including solid-phase synthesis which, like peptide synthesis, has been fully automated in commercially available DNA synthesizers (See e.g., Itakura et al. U.S. Patent 4,598,049; Caruthers et al. U.S. Patent 4,458,066; and Itakura U.S. Patents 4,401,796 and 4,373,071, incorporated by reference herein).
- the present invention also provides fragments of nucleic acid sequences encoding peptides of the invention.
- fragment of a nucleic acid sequence refers to a nucleotide sequence having fewer bases than the nucleotide sequence coding for the entire amino acid sequence of the protein.
- Nucleic acid sequences used in any embodiment of this invention can be cDNA obtained as described herein, or alternatively, can be any oligodeoxynucleotide sequence having all or a portion of a sequence represented herein, or their functional equivalents. Such oligodeoxynucleotide sequences can be produced chemically or mechanically, using known techniques.
- a functional equivalent of an oligonucleotide sequence of Lolp I is one which is 1) a sequence capable of hybridizing to a complementary oligonucleotide to which the sequence (or corresponding sequence portions) of Lol p I as shown in Fig. 1 (SEQ ID NO: 1) or fragments thereof hybridizes, or 2) the sequence (or corresponding sequence portion) complementary to the sequence of Lol p i as shown in Fig. 1 (SEQ ID NO: 1), and/or 3) a sequence which encodes a product (e.g., a polypeptide or peptide) having the same functional characteristics of the product encoded by the sequence (or corresponding sequence portion) of Lolp I as shown in Fig. 1 (SEQ ID NO: 1).
- a product e.g., a polypeptide or peptide
- Preferred nucleic acids encode a peptide having at least about 50% homology to a Lolp I peptide of the invention, more preferably at least about 60% homology and most preferably at least about 70% homology with a Lolp I peptide of the invention.
- Nucleic acids that encode peptides having at least about 90%, more preferably at least about 95%, and most preferably at least about 98-99% homology with Lolp I peptides of the invention are also within the scope of the invention.
- Homology refers to sequence similarity between two peptides of Lol p I, or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same nucleotide or amino acid, then molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences.
- nucleic acid fragments encode peptides of at least 7 amino acid residues in length, and preferably 13-40 amino acid residues in length, and more preferably at least 16-30 amino acids residues in length
- Nucleic acid fragments encoding peptides of at least 30 amino acid residues in length, at least 40 amino acid residues in length, at least about 80 amino acid residues in length, at least about 100 amino acid residues in length or more are also contemplated.
- nucleic acid sequences encoding allergens immunologically cross-reactive with Lolp I such as full length Dae g I and Poap I proteins or peptides (Figs 5 (SEQ ID NO: 52) , 6 (SEQ ID NO: 54) , and 9 (SEQ ID NO: 23, 25, 27, 30, 61-70)).
- Proteins and peptides of Dae g l zn ⁇ Poap l may be produced recombinantly as discussed above, or synthetically.
- Expression vectors and host cells transformed to express Dae g I and Poap I proteins or peptides thereof are also within the scope of the invention. Details of the cloning of Dae g I and Poa p I are given in the examples.
- the present invention also provides a method of producing isolated Lolp I peptides of the invention or a portion thereof, comprising the steps of culturing a host cell transformed with a nucleic acid sequence encoding a Lolp I peptide of the invention in an appropriate medium to produce a mixture of cells and medium containing said Lolp I peptide; and purifying the mixture to produce substantially pure Lolp I peptide.
- Host cells transformed with an expression vector containing DNA coding for a Lolp I peptide of the invention are cultured in a suitable medium for the host cell.
- Lolp I peptides of the invention can be purified from cell culture medium, host cells, or both using techniques known in the art for purifying peptides and proteins including ion-exchange chromatography, gel filtration chromatography, ultrafiltration, electrophoresis and immunopurification with antibodies specific for the Lol p I peptides or portions thereof.
- Lol p I peptides of the invention can be used as "purified" allergens to standardize allergen extracts.
- an animal such as a mouse or rabbit can be immunized with an immunogenic form of an isolated Lolp I peptide of the invention capable of eliciting an antibody response.
- Techniques for conferring immunogenicity on a peptide include conjugation to carriers or other techniques well-known in the art.
- the Lol p I peptide can be administered in the presence of adjuvant. The progress of immunization can be monitored by detection of antibody liters in plasma or serum standard ELISA or other immunoassay can be used with the immunogen as antigen to assess the levels of antibodies.
- anti-Lo/ p I peptide antisera can be obtained and, if desired, polyclonal anti-Lo/ p I peptide antibodies from the serum.
- antibody producing cells lymphocytes
- immortalizing cells such as myeloma cells to yield hybridoma cells.
- Hybridoma cells can be screened immunochemically for production of antibodies reactive with the Lolp I peptides of the invention.
- compositions having therapeutic activity may be administered for therapeutic purposes (e.g., to modify the allergic response of a ryegrass sensitive individual to pollen of such grasses or pollen of an immunologically related grass such as Dae g I, Poa p I and Phi p I). Administration of such peptides may, for example, modify B-cell response to Lol p I allergen, T-cell response to Lol p I allergen or both responses. Isolated peptides can also be used to study the mechanism of immunotherapy of ryegrass pollen allergy and to design modified derivatives or analogues useful in immunotherapy. Compositions according to the invention will have utility in diagnosis of ryegrass sensitivity or sensitivity to grass allergens cross- reactive to ryegrass allergens, because the components include T cell epitopes recognizing the allergens.
- the present invention also pertains to T cell clones which specifically recognize Lolp I peptides of the invention. These T cell clones may be suitable for isolation and molecular cloning of the gene for the T cell receptor which is specifically reactive with a peptide of the present invention.
- the T cell clones may be produced as described in Example 4, or as described in Cellular Molecular Immunology, Abdul K. Abbas et al., W.B. Saunders Co. (1991) pg. 139.
- the present invention also pertains to soluble T cell receptors. These receptors may inhibit antigen-dependent activation of the relevant T cell subpopulation within an individual sensitive to Lolp I. Antibodies specifically reactive with such a T cell receptor can also be produced according to the techniques described herein.
- Such antibodies may also be useful to block T-cell-MHC interaction in an individual.
- Methods for producing soluble T cell receptors are described in Immunology: A Synthesis, 2nd Ed., Edward S. Golub et al., Sinaur Assoc., Sunderland, Massachusetts, (1991) pp. 366-369. It is also possible to modify the structure of a peptide of the invention to achieve additional advantageous physical or biological properties such as increasing solubility, enhancing therapeutic or preventive efficacy, increasing stability (e.g., shelf life ex vivo or resistance to proteolytic degradation in vivo), decreasing adverse side effects, and the like.
- a modified peptide can be produced in which the amino acid sequence has been altered, such as by amino acid substitution, deletion, or addition, in order to modify immunogenicity and/or to reduce allergenicity.
- Peptides may also be advantageously modified by addition or conjugation with another peptide or other component.
- a peptide can be modified so that it maintains the ability to induce T cell anergy and to bind MHC proteins but reduces the ability to induce a strong proliferative response, or possibly any proliferative response, when administered in immunogenic form.
- critical binding residues for the T cell receptor can be determined using known techniques (e.g., substitution of each residue and determination of the presence or absence of T cell reactivity).
- Those residues shown to be essential to interact with the T cell receptor can be modified by replacing the essential amino acid with another preferably similar amino acid residue (a "conservative substitution") whose presence is shown to enhance, diminish but not eliminate, or not affect T cell reactivity.
- those amino acid residues that are not essential for T cell receptor interaction can be modified by replacement with another amino acid whose incorporation may enhance, diminish or not affect T cell reactivity but does not eliminate binding to relevant MHC.
- peptides of the invention can be modified by replacing an amino acid shown to be essential to interact with the MHC protein complex with another, preferably similar amino acid residue (conservative substitution) whose presence is shown to enhance, diminish but not eliminate or not affect T cell reactivity.
- amino acid residues that are not essential for interaction with the MHC protein complex but that still bind the MHC protein complex can be modified by replacement with another amino acid whose incorporation may enhance, not affect, or diminish but not eliminate T cell reactivity.
- Preferred amino acid substitutions for non- essential amino acids include, but are not limited to substitutions with alanine, glutamic acid, or a methyl amino acid.
- peptides of the invention can also be modified to incorporate one or more polymorphisms in the amino acid sequence of the protein allergen resulting from natural allelic variation.
- D-amino acids, non-natural amino acids or non-amino acid analogues can be substituted or added to produce a modified peptide within the scope of this invention.
- peptides of the present invention can be modified using the polyethylene glycol (PEG) method of A. Sehon and co-workers (Wie et al., supra) to produce a protein or peptide conjugated with PEG.
- PEG polyethylene glycol
- Modifications of peptides or portions thereof can also include reduction/ alyklation (Tarr in: Methods of Protein Microcharacterization, J.E. Silver ed. Humana Press, Clifton, NJ, pp 155-194 (1986)); acylation (Tarr, supra); chemical coupling to an appropriate carrier (Mishell and Shiigi, eds, Selected Methods in Cellular Immunology, WH Freeman, San Francisco, CA (1980); U.S. Patent 4,939,239; or mild formalin treatment (Marsh International Archives of Allergy and Applied Immunology, 41:199-215 (1971)).
- reporter group(s) to the peptide backbone.
- poly-histidine can be added to a peptide to purify the peptide by immobilized metal ion affinity chromatography (Hochuli, E. et al., Bio/Technology, 6:1321-1325 (1988)).
- specific endoprotease cleavage sites can be introduced, if desired, between a reporter group and amino acid sequences of a peptide to facilitate isolation of peptides free of irrelevant sequences.
- modified peptides include: LPI-16.2 (SEQ ID NO: 31), LP1-16.3 (SEQ ID NO: 32), LPI-16.4 (SEQ ID NO 33) , LPI-16.5 (SEQ ID NO: 34), LPI-16.6 (SEQ ID NO: 35), LPI-16.7 (SEQ ID NO: 36) , LPI-16.9 (SEQ ID NO: 37), LPI-16.10 (SEQ ID NO: 38), all as shown in Fig. 4.
- canonical protease sensitive sites can be recombinantly or synthetically engineered between regions, each comprising at least one T cell epitope.
- charged amino acid pairs such as KK or RR
- KK or RR can be introduced between regions within a peptide during recombinant construction of the peptide or added to the amino or carboxy terminus of a synthetically produced peptide.
- the resulting peptide can be rendered sensitive to cathepsin and/or other trypsin-like enzymes cleavage to generate portions of the peptide containing one or more T cell epitopes.
- such charged amino acid residues can result in an increase in solubility of a peptide.
- Site-directed mutagenesis of DNA encoding a peptide of the invention can be used to modify the structure of the peptide by methods known in the art. Such methods may, among others, include PCR with degenerate oligonucleotides (Ho et al., Gene, 77:51-59 (1989)) or total synthesis of mutated genes (Hostomsky, Z. et al., Biochem. Biophys, Res. Comn , 161:1056-1063 (1989)). To enhance bacterial expression, the aforementioned methods can be used in conjunction with other procedures to change the eucaryotic codons in DNA constructs encoding protein or peptides of the invention to ones preferentially processed in E.
- Peptides of the present invention can also be used for detecting and diagnosing ryegrass pollinosis. For example, this could be done in vitro by combining blood or blood products obtained from an individual to be assessed for sensitivity to ryegrass pollen or another cross-reactive pollen such as Dae g I, Poa p I and Phi p I, with an isolated peptide(s) of Lolp I, under conditions appropriate for binding of components in the blood (e.g., antibodies, T-cells, B cells) with the peptide(s) and determining the extent to which such binding occurs.
- components in the blood e.g., antibodies, T-cells, B cells
- RAST radio-allergergosorbent test
- PRIST paper radioimmunosorbent test
- ⁇ LISA enzyme linked immunosorbent assay
- RIA radioimmunoassays
- IRMA immuno-radiometric assays
- LIA luminescence immunoassays
- the presence in individuals of Ig ⁇ specific for at least one protein allergen and the ability of T cells of the individuals to respond to T cell epitope(s) of the protein allergen can be determined by administering to the individuals an Immediate Type Hypersensitivity test and a Delayed Type Hypersensituty test.
- the individuals are administered an Immediate Type Hypersensitivity test (see e.g., Immunology (1985) Roitt, I.M., Brostoff, J., Male, D.K. (eds), C.V. Mosby Co., Gower Medical Publishing, London, NY, pp. 19.2-19.18; pp.
- Delayed Type Hypersensitivity test utilizes a modified form of the protein allergen or a portion thereof, the protein allergen produced recombinantly, or a peptide derived from the protein allergen, each of which has human T cell stimulating activity and each of which does not bind IgE specific for the allergen in a substantial percentage of the population of individuals sensitive to the allergen (e.g., at least about 75%).
- Those individuals found to have both a specific Immediate Type Hypersensitivity reaction and a specific Delayed Type Hypersensitivity reaction may be treated with a therapeutic composition comprising the same modified form of the protein or portion thereof, the recombinantly produced protein allergen, or the peptide, each as used in the Delayed Type Hypersensitivity test.
- Isolated peptides of the invention when administered in a therapeutic regimen to a Lol p I-sensitive individual (or an individual allergic to an allergen cross-reactive with ryegrass pollen allergen such as Dae g I, Poa p I and Phlp I) are capable of modifying the allergic response of the individual to Lol p I ryegrass pollen allergen (or such cross-reactive allergen).
- peptides of this invention are capable of modifying the B-cell response, T-cell response or both the B-cell and the T-cell response of the individual to the allergen.
- modification of the allergic response of an individual sensitive to a ryegrass pollen allergen or cross-reactive allergen can be defined as non-responsiveness or diminution in symptoms to the allergen, as determined by standard clinical procedures (See, e.g., Varney et al, British Medical Journal, 302:265-269 (1990)) including diminution in ryegrass pollen- induced asthmatic symptoms.
- a diminution in symptoms includes any reduction in allergic response of an individual to the allergen after the individual has completed a treatment regimen with a peptide or protein of the invention. This diminution may be subjective (i.e., the patient feels more comfortable in the presence of the allergen), or diminution in symptoms may be determined clinically, using standard skin tests known in the art and discussed above.
- Lolp I peptides of the present invention having T cell stimulating activity, and thus comprising at least one T cell epitope, are particularly preferred.
- the epitope will be the basic element or smallest unit of recognition by a receptor, particularly immunoglobulins, histocompatibility antigens and T cell receptors where the epitope comprises amino acids essential to receptor recognition. Amino acid sequences which mimic those of the epitopes and which are capable of down-regulating or reducing allergic response to Lolp I can also be used.
- T cell epitopes are believed to be involved in initiation and perpetuation of the immune response to a protein allergen that is responsible for the clinical symptoms of allergy.
- T cell epitopes are thought to trigger early events at the level of the T helper cell by binding to an appropriate HLA molecule on the surface of an antigen presenting cell and stimulating the relevant T cell subpopulation. These events lead to T cell proliferation, lymphokine secretion, local inflammatory reactions, recruitment of additional immune cells to the site, and activation of the B cell cascade leading to production of antibodies.
- IgE is fundamentally important to the development of allergic symptoms, and its production is influenced early in the cascade of events, at the level of the T helper cell, by the nature of the lymphokines secreted.
- Exposure of ryegrass pollen-sensitive patients or patients sensitive to an immunogically cross-reactive protein allergen such as Dae g I, Poa p I and Phlp I, to isolated Lolp I peptides of the present invention which comprise at least one T cell epitope and are derived from Lolp I protein allergen, may tolerize or anergize appropriate T cell subpopulations such that they become unresponsive to the protein allergen and do not participate in stimulating an immune response upon such exposure.
- a peptide of the invention or portion thereof which comprises at least one T cell epitope may modify the lymphokine secretion profile as compared with exposure to the naturally-occurring Lolp I protein allergen or portion thereof (e.g., may result in a decrease of IL-4 and or an increase in IL-2).
- exposure to such peptide of the invention may influence T cell subpopulations which normally participate in the response to the naturally occurring allergen such that these T cells are drawn away from the site(s) of normal exposure to the allergen (e.g., nasal mucosa, skin, and lung) towards the site(s) of therapeutic administration of the fragment or protein allergen.
- the isolated Lol p I peptides of the invention can be used in methods of diagnosing, treating or preventing allergic reactions to Lolp I allergen or an immunogically related protein allergen such as Dae g I, Poa p I and Phlp I.
- the present invention provides compositions useful in allergery diagnosis and/or useful in allergy therapy comprising isolated Lolp I peptides or portions thereof. Such compositions will typically also comprise a pharmaceutically acceptable carrier or diluent when intended for in vivo administration.
- Therapeutic compositions of the invention may include synthetically prepared Lolp I peptides.
- Lolp I peptides or portions thereof may be administered to an individual in combination with, for example, an appropriate diluent, a carrier and/or an adjuvant.
- Pharmaceutically acceptable diluents include saline and aqueous buffer solutions.
- Pharmaceutically acceptable carriers include polyethylene glycol (Wie et al. (1981) Int. Arch. Allergy Appl. Immunol, 64:84-99) and liposomes (Strejan et al. (1984) J. Neuroimmunol, 7:27).
- the therapeutic composition is preferably administered in nonimmunogenic form, i.e., it does not contain adjuvant.
- the therapeutic compositions of the invention are administered to ryegrass pollen- sensitive individuals or individuals sensitive to an allergen which is immunologically cross-reactive with ryegrass pollen allergen (i.e., Dactylis glomerata, or Sorghum halepensis, etc.).
- Therapeutic compositions of the invention may also be used in the manufacture of medicaments for treating sensitivity to ryegrass pollen allergen or an immunologically related pollen allergen.
- Administration of the therapeutic compositions of the present invention to an individual to be desensitized can be carried out using known procedures at dosages and for periods of time effective to reduce sensitivity (i.e., to reduce the allergic response) of the individual to the allergen.
- Effective amounts of the therapeutic compositions will vary according to factors such as the degree of sensitivity of the individual to ryegrass pollen, the age, sex, and weight of the individual, and the ability of the protein or fragment thereof to elicit an antigenic response in the individual.
- the active compound i.e., protein or fragment thereof
- the active compound may be administered in any convenient manner such as by injection (subcutaneous, intravenous, etc.), oral administration, inhalation, transdermal application, or rectal administration.
- the active compound may be coated within a material to protect the compound from the action of enzymes, acids and other natural conditions which may inactivate the compound. For example, preferably about 1 ⁇ g- 3 mg and more preferably from about 20-
- 750 ⁇ g of active compound (i.e., protein or fragment thereof) per dosage unit may be administered by injection. Dosage regimen may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.
- peptide or portion thereof may be co- administered with enzyme inhibitors or in liposomes.
- Enzyme inhibitors include pancreatic trypsin inhibitor, diisopropylfluorophosphate (DEP) and trasylol.
- Liposomes include water-in-oil-in-water CGF emulsions as well as conventional liposomes (Strejan et al., (1984), J. Neuroimmunol, 7:27).
- the active compound may also be administered parenterally or intraperitoneally.
- Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms.
- compositions suitable for injection include sterile aqueous solutions (where the peptides are water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
- the composition intended for in vivo use must be sterile and must be fluid to the extent necessary to provide easy syringability. It should preferably be stable under the conditions of manufacture and storage and be preserved against the contaminating action of microorganisms such as bacteria and fungi.
- the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
- the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion, and by the use of surfactants.
- Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thirmerosal, and the like.
- isotonic agents for example, sugars, polyalcohols such as manitol and sorbitol or sodium chloride in the composition.
- Prolonged absorption of the injectable compositions can be brought about, including in the composition, an agent which delays absorption, for example, aluminum monostearate and gelatin.
- Sterile injectable solutions can be prepared by incorporating the active compound (i.e., protein or peptide) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered steriUzation.
- dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above.
- the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient (i.e., protein or peptide) plus any additional desired ingredient from a previously sterile-filtered solution thereof.
- the peptide may be orally administered, for example, with an inert diluent or an assimilable edible carrier.
- the peptide and other ingredients may also be enclosed in a hard or soft gelatin capsule, compressed into tablets, or incorporated directly into the individual's food.
- the active compound may be formulated with conventional excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like.
- Such compositions and preparations should contain at least 1% by weight of active compound.
- compositions and preparations may, of course, be varied and may conveniently be between about 5 to 80% by weight of the dosage unit.
- the amount of active compound in such therapeutically useful compositions is such that a suitable dosage will be obtained.
- Preferred compositions or preparations according to the present invention are prepared so that an oral dosage unit contains from about 10 ⁇ g to about 200 mg of active compound.
- the tablets, troches, pills, capsules and the like may also contain the following: a binder such as gum gragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, lactose or saccharin or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring.
- a binder such as gum gragacanth, acacia, corn starch or gelatin
- excipients such as dicalcium phosphate
- a disintegrating agent such as corn starch, potato starch, alginic acid and the like
- a lubricant such as magnesium stearate
- a sweetening agent such as sucrose, lactose or saccharin or a flavoring agent such as peppermint, oil of wintergreen, or
- tablets, pills, or capsules may be coated with shellac, sugar or both.
- a syrup or elixir may contain the active compound, sucrose as a sweetening agent, methyl and propylparabens as preservative, a dye and flavoring such as cherry or orange flavor.
- any material used in preparing any dosage unit form should be pharmaceutically pure and substantially non-toxic in the amounts employed.
- the active compound may be incorporated into sustained-release preparations and formulations.
- pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like.
- the use of such media and agents for pharmaceutically active substances is well known in the art Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the therapeutic compositions is contemplated.
- Supplementary active compounds can also be incorporated into the compositions.
- Various isolated peptides of the invention derived from ryegrass pollen protein Lolp I are shown in Figs. 2 and 4 (SEQ ID NO: 3-50) .
- Peptides comprising at least two regions, each region comprising at least one T cell epitope of Lol p I are also within the scope of the invention.
- a region may include the amino acid sequence of a peptide of the invention as shown in Figs. 2 and 4 (SEQ ID NO: 3-50) or the amino acid sequence of a portion of such peptide.
- Lolp I is divided into non- overlapping peptides of desired length or overlapping peptides of desired lengths as discussed in Example 4 which can be produced recombinantly, or synthetically.
- Peptides comprising at least one T cell epitope are capable of eliciting a T cell response, such as T cell proliferation or lymphokine secretion, and/or are capable of inducing T cell anergy (i.e., tolerization).
- isolated peptides are tested by, for example, T cell biology techniques, to determine whether the peptides elicit a T cell response or induce T cell anergy. Those peptides found to elicit a T cell response or to induce T cell anergy are defined as having T cell stimulating activity.
- human T cell stimulating activity can be tested by culturing T cells obtained from an individual sensitive to Lolp I allergen, (i.e., an individual who has an IgE-mediated immune response to Lol p I allergen) with a peptide derived from the allergen, then determining whether proliferation of T cells occurs in response to the peptide.
- T cell proliferation may be measured in several ways, e.g., by cellular uptake of tritiated thymidine.
- Stimulation indices for responses by T cells to peptides can be calculated as the maximum counts-per-minute (CPM) in response to a peptide divided by the control CPM.
- a stimulation index (S.I.) equal to or greater than two times the background level is considered "positive".
- Preferred peptides of this invention comprise at least one T cell epitope and have a mean T cell stimulation index of greater than or equal to 2.0.
- a peptide having a mean T cell stimulation index of greater than or equal to 2.0 in a significant number of ryegrass pollen sensitive patients tested (i.e., at least 10% of patients tested) is considered useful as a therapeutic agent
- Preferred peptides have a mean T cell stimulation index of at least 2.5, more preferably at least 3.0, more preferably at least 3.5, more preferably at least 4.0, more preferably at least 5, and most preferably at least about 6.
- peptides of the invention having a mean T cell stimulation index of at least 5, as shown in Fig. 3, include LPI-2 (SEQ ED NO: 5), LPI-3 (SEQ ED NO: 6), LPI-15 (SEQ ED NO: 21), LPI-16 (SEQ ID NO: 22) , LPI-16.1 (SEQ ID NO: 23) , LPI-17 (SEQ ID NO: 24), LPI-19 (SEQ ID NO: 26), LPI-20 (SEQ ID NO: 27), LPI-22 (SEQ ID NO: 29) and LPI-23 (SEQ ID NO: 30).
- preferred peptides have a positivity index (P.I.) of at least about
- the positivity index for a peptide is determined by multiplying the mean T cell stimulation index by the percent of individuals, in a population of individuals sensitive to ryegrass pollen (e.g., preferably at least 15 individuals, more preferably at least 30 individuals or more), who have a T cell stimulation index to such peptide of at least 2.0.
- the positivity index represents both the strength of a T cell response to a peptide (S.I.) and the frequency of a T cell response to a peptide in a population of individuals sensitive to ryegrass pollen. For example, as shown in Fig.
- Lolp I peptide LPI-15 (SEQ ID NO: 21) has a mean S.I. of 12.2 and 11% of positive responses in the group of individuals tested resulting in a positivity index of 134.2.
- Lol p I peptides having a positivity index of at least about 100 and a mean T cell stimulation index of at least about 4 include: LPI-2 (SEQ ID NO: 5), LPI-11 (SEQ ID NO: 15), LPI-13 (SEQ ID NO: 19), LPI-15 (SEQ ID NO: 21), LPI-16 (SEQ ID NO: 22), LPI-16.1 (SEQ ID NO: 23), LPI-18 (SEQ ID NO: 25), LPI-20 (SEQ ID NO: 27), LPI-22 (SEQ ID NO: 29), and LPI-23 (SEQ ID NO: 30).
- a peptide having T cell stimulating activity and thus comprising at least one T cell epitope as determined by T cell biology techniques is modified by addition or deletion of amino acid residues at either the amino or carboxy terminus of the peptide and tested to determine a change in T cell reactivity to the modified peptide. If two or more peptides which share an area of overlap in the native protein sequence are found to have human T cell stimulating activity, as determined by T cell biology techniques, additional peptides can be produced comprising all or a portion of such peptides and these additional peptides can be tested by a similar procedure. Following this technique, peptides are selected and produced recombinantly or synthetically.
- modified versions of peptide LPI-18 include peptides: LPI-18.5 (SEQ ID NO: 39), LPI-18.6 (SEQ ID NO: 40), LPI-18.7 (SEQ ID NO: 41), LPI-18.8 (SEQ ID NO: 42) all as shown in Fig. 4; modified versions of peptide LPI-20 (SEQ ID NO: 27) (Fig.
- FIG. 2 modified versions of peptide LPI-23 (SEQ ID NO: 30) (Fig. 2) include peptides: LPI-23.1 (SEQ ED NO: 48), LPI-23.2 (SEQ ID NO: 49) and LPI- 23.4 (SEQ ID NO: 50) all as shown in Fig. 4.
- Peptides are selected for diagnostic or therapeutic uses based on various factors, including the strength of the T cell response to the peptide (e.g., stimulation index), the frequency of the T cell response to the peptide in a population of individuals sensitive to ryegrass pollen, and the potential cross-reactivity of the peptide with other allergens from other species of grasses as discussed earlier.
- the physical and chemical properties of these selected peptides e.g., solubility, stability
- the ability of the selected peptides or selected modified peptides to stimulate human T cells e.g., induce proliferation, lymphokine secretion is determined.
- the most preferred T cell epitope-containing peptides of the invention do not bind immunoglobulin E (IgE) of an allergic individual or bind IgE to a substantially lesser extent (e.g., at least 100 fold less and more preferably, at least 1000 fold less) than the protein allergen from which the peptide is derived.
- IgE immunoglobulin E
- the major complications of standard immunotherapy are IgE-mediated responses such as anaphylaxis.
- Immunoglobulin E is a mediator of anaphylactic reactions which result from the binding and cross-linking of antigen to IgE on mast cells or basophils and the consequent release of mediators (e.g., histamine, serotonin, eosinophil chemotacic factors).
- Anaphylaxis in a substantial percentage of a population of individuals sensitive to Lol p I could be avoided by the use in immunotherapy of a peptide which do not bind IgE in a substantial percentage (e.g., at least about 75%) of a population of individuals sensitive to Lol p I allergen, or, if the peptides do bind IgE, such binding does not result in the release of mediators from mast cells or basophils.
- the risk of anaphylaxis could be reduced by the use in immunotherapy of a peptide or peptides which have reduced IgE binding.
- peptides having minimal IgE stimulating activity are desirable for therapeutic effectiveness.
- Minimal IgE stimulating activity refers to IgE production that is less than the amount of IgE production stimulated by the native Lol p I protein allergen. Similarly, IL-4 production can be compared, with reduces EL-4 production indicating lessened IgE stimulating activity.
- Preferred T cell epitope-containing peptides of the invention when administered to a ryegrass pollen-sensitive individual or an individual sensitive to an allergen which is immunologically related to ryegrass pollen allergen (such as Dae g I, Poa p I, and Phlp I) in a therapeutic treatment regimen, are capable of modifying the allergic response of the individual to the allergen.
- Such preferred Lolp I peptides of the invention comprising at least one T cell epitope of Lol p I or at least two regions derived from Lol p I, each comprising at least one T cell epitope, when administered to an individual sensitive to ryegrass pollen are capable of modifying T cell response of the individual to the allergen, and they will thus be useful as therapeutics in addressing sensitivity to grasses.
- a preferred isolated Lol p I peptide of the invention or portion thereof comprises at least one T cell epitope of Lolp I and accordingly, the peptide comprises at least approximately seven amino acid residues.
- preferred therapeutic compositions of the invention preferably comprise at least two T cell epitopes of Lolp I, and accordingly, the peptide comprises at least approximately eight amino acid residues and preferably at least fifteen amino acid residues. Additionally, therapeutic compositions comprising preferred isolated peptides of the invention most preferably comprise a sufficient percentage of the T cell epitopes of the entire protein allergen so that a therapeutic regimen of administration of the composition to an individual sensitive to ryegrass pollen results in T cells of the individual being tolerized to the protein allergen.
- Synthetically produced peptides of the invention comprising up to approximately forty-five amino acid residues in length, and most preferably up to approximately thirty amino acid residues in length are particularly desirable, as increases in length may result in difficulty in peptide synthesis.
- Peptides of the invention may also be produced recombinantly as described above, and peptides exceeding 45 amino acids will be more easily produced recombinantly.
- Peptides derived from the Lolp I protein allergen which exhibit T cell stimulatory properties and thus are believed to be useful therapeutics and/or intermediatea in developing tolerizing peptides comprise all or a portion of the following peptides: LPI-1 (SEQ ID NO: 3), LPI-1.1 (SEQ ID NO: 4), LPI-2 (SEQ ID NO: 5), LPI-3 (SEQ ID NO: 6), LPI-4 (SEQ ID NO: 7), LPI-4.1 (SEQ ID NO: 8), LPI-5 (SEQ ID NO: 9), LPI-6 (SEQ ID NO: 10), LPI-7 (SEQ ID NO: 11), LPI-8 (SEQ ID NO: 12), LPI-9 (SEQ ID NO: 13), LPI-10 (SEQ ID NO: 14), LPI-11 (SEQ ID NO: 15), LPI-12 (SEQ ID NO: 17), LPI-13 (SEQ ID NO: 19), LPI-14 (SEQ ID NO: 20), LPI-15 (SEQ ID NO: 21), LPI-16 (SEQ ID
- peptides derived from the Lolp I protein allergen comprise all or a portion of the following peptides: LPI-1.1 (SEQ ID NO: 4), LPI-2 (SEQ ED NO: 5), LPI-3 (SEQ ID NO: 6), LPI-4 (SEQ ID NO: 7), LPI-4.1 (SEQ ID NO: 8), LPI-8 (SEQ ID NO: 12), LPI-10 (SEQ ID NO: 14), LPI-11 (SEQ ID NO: 15), LPI-13 (SEQ ID NO: 19), LPI-15 (SEQ ID NO: 21), LPI-16 (SEQ ID NO: 22), LPI-16.1 (SEQ ID NO: 23), LPI-18 (SEQ ID NO: 25), LPI-19 (SEQ ID NO: 26), LPI-20 (SEQ ID NO: 27),
- peptides derived from the Lolp I protein comprise the following peptides: LPI-3 (SEQ ED NO: 6), LPI-4.1 (SEQ JD NO: 8), LPI-10 (SEQ ID NO: 14), LPI-11 (SEQ ID NO: 15), LPI-15 (SEQ ID NO: 21), LPI-16.1 (SEQ ID NO: 23), LPI-18 (SEQ ID NO: 25), LPI-20 (SEQ ID NO: 27), LPI-22 (SEQ ID NO: 29), and LPI-23 (SEQ ID NO: 30), all as shown in Fig. 2.
- Additional preferred peptides believed to T cell stimulating activity comprise the following peptides: LPI-16.2 (SEQ ID NO: 31), LPI-16.3 (SEQ ID NO: 32), LPI- 16.4 (SEQ ID NO: 33), LPI-16.5 (SEQ ID NO: 34), LPI-16.6 (SEQ ID NO: 35), LPI- 16.7 (SEQ ID NO: 36), LPI-16.9 (SEQ ID NO: 37), LPI-16.10 (SEQ ID NO: 38), LPI-18.5 (SEQ ID NO: 39), LPI-18.6 (SEQ ID NO: 40), LPI-18.7 (SEQ ID NO: 41), LPI-18.8 (SEQ ID NO: 42), LPI-20.2 (SEQ ID NO: 43), LPI-20.3 (SEQ ID NO: 44), LPI-20.4 (SEQ ID NO: 45), LPI-20.5 (SEQ ID NO: 46), LPI-20.6 (SEQ ID NO: 47), LPI-23.1 (SEQ ID NO: 48), LPI-23.2 (SEQ ID NO: 49
- Y is an amino acid sequence selected from the group consisting of LPI-1 (SEQ ID NO: 3), LPI-1.1 (SEQ ID NO: 4), LPI-2 (SEQ ID NO: 5), LPI-3 (SEQ ID NO: 6), LPI-4 (SEQ ID NO: 7), LPI-4.1 (SEQ ID NO: 8), LPI-5 (SEQ ID NO: 9), LPI-6 (SEQ ID NO: 10), LPI-7 (SEQ ID NO: 11), LPI-8 (SEQ ID NO: 12), LPI-9 (SEQ ID NO: 13), LPI-10 (SEQ ID NO: 14), LPI-11 (SEQ ED NO: 15), LPI-12 (SEQ ID NO: 17), LPI-13 (SEQ ID NO: 19), LPI-14 (SEQ ED NO: 20), LPI-15 (SEQ ID NO: 3), LPI-1.1 (SEQ ID NO: 4), LPI-2 (SEQ ID NO: 5), LPI-3 (SEQ ID NO: 6), LPI-4 (SEQ ID NO: 7), LPI-4.1
- X n are amino acid residues contiguous to the amino terminus of Y in the amino acid sequence of the protein allergen and Z m are amino acid residues contiguous to the carboxy terminus of Y in the amino acid sequence of the protein allergen.
- n is 0-30 and m is 0-30.
- the peptide or portion thereof has a mean T cell stimulation index equivalent to greater than the mean T cell stimulation index of Y as shown in Fig. 3.
- amino acids comprising the amino terminus of X and the carboxy terminus of Z are selected from charged amino acids, i.e., arginine (R), lysine (K), histidine (H), glutamic acid (E) or aspartic acid (D); amino acids with reactive side chains, e.g., cysteine (C), asparagine (N) or glutamine (Q); or amino acids with sterically small side chains, e.g., alanine (A) or glycine (G).
- n and m are 0-5; most preferably n + m is less than 10.
- Another embodiment of the present invention provides peptides comprising at least two regions, each region comprising at least one T cell epitope of Lol p i and accordingly each region comprises at least approximately seven amino acid residues.
- These peptides comprising at least two regions can comprise up to 100 or more amino acid residues but preferably comprise at least about 14, even more preferably at least about 20, and most preferably at least about 30 amino acid residues of the Lolp I allergen.
- the amino acid sequences of the regions can be produced and joined by a linker to increase sensitivity to processing by antigen-presenting cells.
- Such linker can be any non-epitope amino acid sequence or other appropriate linking or joining agent
- the regions are arranged in the same or a different configuration from a naturally-occurring configuration of the regions in the allergen.
- the regions containing T cell epitope(s) can be arranged in a noncontiguous configuration and can preferably be derived from the same protein allergen.
- Noncontiguous is defined as an arrangement of regions containing T cell epitope(s) which is different than that of the native amino acid sequence of the protein allergen from which the regions are derived.
- noncontiguous regions containing T cell epitopes can be arranged in a nonsequential order (e.g., in an order different from the order of the amino acids of the native protein allergen from which the region containing T cell epitope(s) are derived in which amino acids are arranged from an amino terminus to a carboxy terminus).
- a peptide of the invention can comprise at least 15%, at least 30%, at least 50% or up to 100% of the T cell epitopes of Lol p i.
- the individual peptide regions can be produced and tested to determine which regions bind immunoglobulin E specific for Lolp I and which of such regions would cause the release of mediators (e.g., histamine) from mast cells or basophils.
- mediators e.g., histamine
- Those peptide regions found to bind immunoglobulin E and to cause the release of mediators from mast cells or basophils in greater than approximately 10-15% of the allergic sera tested are preferably not included in the peptide regions arranged to form preferred peptides of the invention.
- Examples of preferred peptide regions which do not bind to IgE include: LPI-1 (SEQ ID NO: 3), LPI-1.1 (SEQ ID NO: 4), LPI-2 (SEQ ID NO: 5), LPI-3 (SEQ ED NO: 6), LPI-4 (SEQ ID NO: 7), LPI-4.1 (SEQ ID NO: 8), LPI-5 (SEQ ID NO: 9), LPI-6 (SEQ ID NO: 10), LPI-7 (SEQ ID NO: 11), LPI-8 (SEQ ID NO: 12), LPI-9 (SEQ ID NO: 13), LPI-10 (SEQ ED NO: 14), LPI-11 (SEQ ID NO: 15), LPI-12 (SEQ ID NO: 17), LPI-13 (SEQ ID NO: 19), LPI-14 (SEQ ID NO: 20), LPI-15 (SEQ ID NO: 21), LPI-16 (SEQ ID NO: 22), LPI-16.1 (SEQ ID NO: 23), LPI-17 (SEQ ID NO: 24), LPI-18 (SEQ ID NO: 3
- Preferred peptides comprise various combinations of two or more of the above-discussed preferred regions, or a portion thereof.
- Preferred peptides comprising a combination of two or more regions include the following: LPI-3 (SEQ ro NO: 6), LPI-4.1 (SEQ ro NO: 8), LPI-10 (SEQ ro NO: 14),
- LPI-11 SEQ ID NO: 15
- LPI-15 SEQ ID NO: 21
- LPI-16 SEQ ID NO: 16
- LPI-18 SEQ ID NO: 25
- LPI-20 SEQ ro NO: 27
- LPI-22 SEQ ID NO: 22
- LPI-3 (SEQ ID NO: 6), LPI-4.1 (SEQ ID NO: 8), LPI-10 (SEQ ID NO: 14), and LPI- 11 (SEQ ID NO: 15);
- LPI-3 (SEQ ID NO: 6), LPI-4.1 (SEQ ID NO: 8), PLI-10 (SEQ ID NO: 14),
- LPI-11 SEQ ID NO: 15
- LPI-15 SEQ ID NO: 21
- LPI-16 SEQ ID NO: 16
- LPI-3 (SEQ ID NO: 6), LPI-4.1 (SEQ ID NO: 8), LPI- 10 (SEQ ID NO: 14), LPI-11 (SEQ ID NO: 15), LPI-15 (SEQ ID NO: 21), and LPI-16.1 (SEQ ID NO:
- LPI-16.1 SEQ ID NO: 23
- LPI- 18 SEQ ID NO: 25
- LPI-15 (SEQ ID NO: 21), LPI- 16.1 (SEQ ID NO: 23), LPI- 18 (SEQ ID NO: 21),
- LPI-15 (SEQ ID NO: 21), LPI- 16.1 (SEQ ID NO: 23), LPI- 18 (SEQ ID NO: 21),
- LPI-20 SEQ ID NO: 27
- LPI-22 SEQ ID NO: 29
- LPI- 18 (SEQ ID NO: 25), LPI-20 (SEQ ID NO: 27), LPI-22 (SEQ ro
- LPI- 18 (SEQ ro NO: 25) and LPI-20 (SEQ D NO: 27);
- LPI- 18 (SEQ ID NO: 25), LPI-20 (SEQ ID NO: 27) and LPI-23 (SEQ ID NO: 25)
- LPI- 18 (SEQ ID NO: 25), LPI-20 (SEQ ID NO: 27) and LPI-16.1 (SEQ ro
- LPI- 18 (SEQ ID NO: 25), LPI-20 (SEQ ro NO: 27), LPI-23 (SEQ ID NO: 26).
- LPI- 18 (SEQ ro NO: 25), LPI-20 (SEQ ID NO: 27), LPI-23 (SEQ ID NO: 25)
- LPI-16.1 SEQ ID NO: 23
- LPI- 11 SEQ ID NO: 15
- LPI- 16.1 SEQ ID NO: 23
- LPI-4.1 SEQ ID NO: 8
- LPI- 18 (SEQ ID NO: .25), LPI-20 (SEQ ID NO: 27), LPI-23 (SEQ ID NO: 2).
- LPI-16.1 SEQ ID NO: 23
- LPI- 11 SEQ ID NO: 15
- LPI-4.1 LPI-16.1
- LPI-23 SEQ ID NO: 30
- LPI-18 SEQ ID NO: 25
- LPI-20 SEQ ID NO: 27
- LPI-16.1 SEQ ID NO: 30
- LPI-23 SEQ ID NO: 30
- LPI-16.3 SEQ ID NO: 32
- LPI-18 SEQ ID NO: 25
- LPI-20 SEQ ID NO: 30
- LPI- 16.4 (SEQ ID NO: 33), LPI- 18 (SEQ ID NO: 25), LPI-20 (SEQ ro
- LPI- 16.5 (SEQ ID NO: 34), LPI- 18 (SEQ ro NO: 25), LPI-20 (SEQ ID NO: 27), and LPI-23 (SEQ ID NO: 30);
- LPI-23 SEQ ID NO: 30
- LPI-16.9 SEQ ID NO: 37
- LPI-18 SEQ ID NO: 25
- LPI-20 SEQ ID NO: 30
- compositions comprising at least two peptides (e.g., a physical mixture of at least two peptides), each comprising at least one T cell epitope of Lol p I.
- compositions can be in the form of a composition additionally with a pharmaceutically acceptable carrier of diluent for therapeutic uses, or with conventional non-pharmaceutical excipients for reagent use.
- an effective amount of one or more of such compositions can be administered simultaneously or sequentially to an individual sensitive to ryegrass pollen.
- combinations of Lolp I peptides are provided which can be administered simultaneously or sequentially.
- Such combinations may comprise therapeutic compositions comprising only one peptide, or more peptides if desired.
- Such compositions may be used simultaneously or sequentially in preferred combinations.
- Lolp I peptides which can be administered or otherwise used simultaneously or sequentially (comprising peptides having amino acid sequences shown in Fig. 2) include the following combinations:
- LPI-3 (SEQ ID NO: 6), LPI-4.1 (SEQ ID NO: 8), LPI- 10 (SEQ ID NO: 14),
- LPI-11 SEQ ID NO: 15
- LPI- 15 SEQ ID NO: 21
- LPI-16 SEQ ID NO: 16
- LPI- 18 SEQ ID NO: 25
- LPI-20 SEQ ID NO: 27
- LPI-22 SEQ ID NO: 29
- LPI-23 SEQ ID NO: 30
- LPI-3 (SEQ ID NO: 6), LPI-4.1 (SEQ ID NO: 8), LPI- 10 (SEQ ID NO: 14), and LPI- 11 (SEQ ID NO: 15);
- LPI-3 (SEQ ID NO: 6), LPI-4.1 (SEQ ID NO: 8), PLI-10 (SEQ ID NO: 14),
- LPI-11 SEQ ID NO: 15
- LPI-15 SEQ ID NO: 21
- LPI-16 SEQ ID NO: 22
- LPI-3 (SEQ ID NO: 6), LPI-4.1 (SEQ ID NO: 8), LPI- 10 (SEQ ID NO: 14),
- LPI-11 SEQ ID NO: 15
- LPI-15 SEQ ID NO: 21
- LPI-16.1 SEQ ID NO: 1
- LPI-10 (SEQ ID NO: 14), LPI-11 (SEQ ID NO: 15), LPI-15 (SEQ ro NO: 21), and LPI-16.1 (SEQ ID NO: 23);
- LPI-10 (SEQ ro NO:14), LPI-11 (SEQ ID NO: 15), LPI-15 (SEQ ro
- LPI-16.1 SEQ ID NO: 23
- LPI- 18 SEQ ID NO: 25
- LPI-10 (SEQ ID NO: 14), LPI- 11 (SEQ ID NO: 15), LPI-15 (SEQ ID NO: 21), LPI-16.1 (SEQ ID NO: 23), LPI-18 (SEQ ID NO: 25), LPI-20 (SEQ ID NO: 14), LPI- 11 (SEQ ID NO: 15), LPI-15 (SEQ ID NO: 21), LPI-16.1 (SEQ ID NO: 23), LPI-18 (SEQ ID NO: 25), LPI-20 (SEQ ID NO: 14), LPI- 11 (SEQ ID NO: 15), LPI-15 (SEQ ID NO: 21), LPI-16.1 (SEQ ID NO: 23), LPI-18 (SEQ ID NO: 25), LPI-20 (SEQ ID NO: 14), LPI- 11 (SEQ ID NO: 15), LPI-15 (SEQ ID NO: 21), LPI-16.1 (SEQ ID NO: 23), LPI-18 (SEQ ID NO: 25), LPI-20 (SEQ ID NO: 14), LPI- 11 (SEQ ID NO: 15), LPI-15
- LPI-15 (SEQ ID NO: 21), LPI-16.1 (SEQ ID NO: 23), LPI-18 (SEQ ID NO: 21), LPI-15 (SEQ ID NO: 21), LPI-16.1 (SEQ ID NO: 23), LPI-18 (SEQ ID NO:
- LPI-15 (SEQ ID NO: 21), LPI-16.1 (SEQ ID NO: 23), LPI-18 (SEQ ID NO: 25), LPI-20 (SEQ ID NO: 27), LPI-22 (SEQ ID NO: 29), and LPI-23
- LPI- 18 (SEQ ID NO: 25), LPI-20 (SEQ ID NO: 27), LPI-22 (SEQ ID NO: 26),
- LPI-18 (SEQ ID NO: 25) and LPI-20 (SEQ ID NO: 27); LPI-18 (SEQ ID NO: 25), LPI-20 (SEQ ID NO: 27) and LPI-23 (SEQ ID NO:
- LPI- 18 (SEQ ID NO: 25), LPI-20 (SEQ ID NO: 27) and LPI- 16.1 (SEQ ID NO: 25)
- LPI-16.1 SEQ ID NO: 23
- LPI-11 SEQ ID NO: 15
- LPI- 18 (SEQ ID NO: 25), LPI-20 (SEQ ID NO: 27), LPI-23 (SEQ ID NO: 30), LPI-16.1 (SEQ ID NO: 23) and LPI-4.1 (SEQ ID NO: 8);
- LPI- 16.1 SEQ ID NO: 23
- LPI-4.1 SEQ ro NO: 8
- LPI- 18 (SEQ ID NO: 25), LPI-20 (SEQ ID NO: 27), LPI-23 (SEQ D NO: 30), LPI-16.1 (SEQ ID NO: 23), LPI- 11 (SEQ ID NO: 15) and LPI-4.1
- LPI-16.1 SEQ ro NO: 23
- LPI-11 SEQ ID NO: 15
- LPI- 18 SEQ ID NO: 25
- LPI-20 SEQ ID NO: 27
- LPI-22 SEQ ID NO: 29
- LPI-22 SEQ ro NO: 29
- LPI-23 SEQ ID NO: 30
- LPI- 18 (SEQ ID NO: 25), LPI-20 (SEQ ID NO: 27), LPI- 16.1 (SEQ ID NO: 23) and LPI-22 (SEQ ID NO: 29).
- Lol p I peptides which can be administered or used simultaneously or sequentially (comprising peptides having amino acid sequences shown in Figs. 2 or 4) include the following combinations:
- LPI-16.4 SEQ ID NO: 33
- LPI-18 SEQ ID NO: 25
- LPI-20 SEQ ID NO: 27
- LPI-23 SEQ ID NO: 30
- LPI-16.5 (SEQ ID NO: 34), LPI-18 (SEQ ID NO: 25), LPI-20 (SEQ ID NO: 27), and LPI-23 (SEQ ID NO: 30); LPI-16.6 (SEQ ID NO: 35), LPI- 18 (SEQ ID NO: 25), LPI-20 (SEQ ID NO: 30); LPI-16.6 (SEQ ID NO: 35), LPI- 18 (SEQ ID NO: 25), LPI-20 (SEQ ID NO: 34), LPI-18 (SEQ ID NO: 25), LPI-20 (SEQ ID NO: 27), and LPI-23 (SEQ ID NO: 30); LPI-16.6 (SEQ ID NO: 35), LPI- 18 (SEQ ID NO: 25), LPI-20 (SEQ ID NO: 34), LPI-18 (SEQ ID NO: 25), LPI-20 (SEQ ID NO: 27), and LPI-23 (SEQ ID NO: 30); LPI-16.6 (SEQ ID NO: 35), LPI- 18 (SEQ ID NO: 25), LPI-20 (SEQ ID NO
- LPI-16.7 (SEQ ID NO: 36), LPI-18 (SEQ ID NO: 25), LPI-20 (SEQ ID NO: 27), and LPI-23 (SEQ ED NO: 30);
- LPI-16.9 (SEQ ID NO: 37), LPI-18 (SEQ ID NO: 25), LPI-20 (SEQ ID NO: 27), and LPI-23 (SEQ ID NO: 30);
- LPI- 16.10 SEQ ID NO: 38
- LPI- 18 SEQ ID NO: 25
- LPI-20 SEQ ID NO: 27
- LPI-23 SEQ ED NO: 30
- peptides LPI- 16.1 (SEQ ID NO: 23), LPI- 18 (SEQ ro NO: 23), LPI-20 (SEQ ID NO: 27), and LPI-23 (SEQ ID NO: 30) may be substituted as follows: peptide LPI- 16.1 (SEQ ID NO: 23) (Fig.
- LPI-16.2 (SEQ ED NO: 31), LPI-16.3 (SEQ ro NO: 32), LPI- 16.4 (SEQ ED NO: 33), LPI-16.5 (SEQ ID NO: 34), LPI-16.6 (SEQ ID NO: 35), LPI- 16.7 (SEQ ID NO: 36), LPI-16.9 (SEQ ID NO: 37), and LPI-16.10 (SEQ ID NO: 38), all as shown in Fig. 4; peptide LPI- 18 (SEQ ID NO: 25) (Fig.
- peptide LPI-18.5 SEQ ID NO: 39
- LPI-18.6 SEQ ro NO: 40
- LPI-18.7 SEQ ID NO: 41
- LPI-18.8 SEQ ID NO: 42
- peptide LPI-20 SEQ ID NO: 27
- peptides LPI-20.2 SEQ ID NO: 43
- LPI-20.3 SEQ ID NO: 44
- LPI-20.4 SEQ ID NO: 45
- LPI-20.5 SEQ ID NO: 46
- LPI-20.6 SEQ ED NO: 47
- peptide LPI-23 (SEQ ID NO: 30) may be substituted with peptides LPI-23.1 (SEQ ID NO: 48), LPI-23.2 (SEQ ID NO: 49) and LPI-23.4 (SEQ ID NO: 50), all as shown in Fig. 4.
- Total mRNA was extracted from mature ryegrass pollen by the phenol method of Herrin and Michaels, supra.
- Double- stranded cDNA was synthesized from l ⁇ g of total mRNA using a commercially available kit (cDNA SYNTHESES SYSTEM PLUS KIT, BRL, Gaithersburg, MD). After a phenol extraction and ethanol precipitation, the cDNA was blunted with T4 DNA polymerase (Promega, Madison, Wl) and ligated to ethanol-precipitated, self-annealed AT and AL oligonucleotides for use in a modified Anchored PCR reaction, according to the method in Rafnar et al. (1991), J.
- Oligonucleotide AT has the sequence 5'-GGGTCTAGAGGTACCGTCCGATCGATCATT-3' (SEQ ro NO: 71) (Rafnar et al. supra).
- Oligonucleotide AL has the sequence AATGATCGATGCT (SEQ ED NO: 72) (Rafnar et al. supra.).
- PCR Polymerase chain reactions
- CCCTGCAGATTATTTGAGATCTTGAG-3' SEQ ro NO: 74
- cDNA 3-5 ⁇ l of a 20 ⁇ l linkered cDNA reaction mix
- 0.5 ⁇ l Amplitaq DNA polymerase 0.5 ⁇ l Amplitaq DNA polymerase, and distilled water to 100 ⁇ l.
- Nucleotides 1 through 8 (5'-CCCTGCAG) of LpA-5 correspond to a Pst I site added for cloning purposes; the remaining nucleotides correspond to the non-coding strand sequence complementary to nucleotides 483 through 500 as shown in Fig. 6.
- the samples were amplified with a programmable thermal controller (MJ Research, Inc., Cambridge, MA).
- the first 5 rounds of amplification consisted of denaturation at 94°C for 1 minute, annealing of primer to the template at 45°C for 1.5 minutes, and chain elongation at 70°C for 2 minutes.
- the final 20 rounds of amplification consisted of denaturation as above, annealing at 55°C for 1.5 minutes, and elongation as above.
- Amplified DNA was recovered by sequential chloroform, phenol, and chloroform extractions, followed by precipitation at -20°C with 0.5 volumes of 7.5 ammonium acetate and 1.5 volumes of isopropanol. After precipitation and washing with 70% ethanol, the DNA was simultaneously digested with Xba I and Pst I in a 15 ⁇ l reaction and electrophoresed through a preparative 3% GTG NuSieve low melt gel (FMC, Rockport, ME). The appropriate sized DNA band was visualized by EtBr staining, excised, and ligated into appropriately digested M13mpl8 for sequencing by the dideoxy chain termination method (Sanger et al. (1977), Proc. Natl Acad Sci USA, 74: 5463-5476) using a commercially available sequencing kit (Sequenase kit U.S. Biochemicals, Cleveland, OH).
- LpA- 13 has the sequence 5'- GAGTACGGCGACAAGTGGC-3' (SEQ ID NO: 76), which corresponds to nucleotides 121 through 139 as shown in Fig. 1.
- LpA-12 has the sequence 5'- TTCGAGATCAAGTGCACC-3' (SEQ ID NO: 77), which corresponds to nucleotides 310 through 318 as shown in Fig. 1.
- LpA-9 has the sequence 5'-
- LpA-2 has the sequence 5'-GGGAATTCCATGGCGAAGAAGGGC-3' (SEQ ED NO: 79). Nucleotides 1 through 7 (5-GGGATT-3') of LpA 2 correspond to part of an Eco-RI restriction site added for cloning purposes; the remaining sequence of LpA-2 corresponds to nucleotides 425 through 441 of Fig. 1.
- LpA-7 has the sequence 5'-GTGCCGTCCGGGTACT-3' (SEQ ID NO: 80), and corresponds to non-coding strand sequence complementary to nucleotides 503 through 518 of Fig. 1.
- LpA- 10 has the sequence 5'-CCGTCGACGTACTTCA-3' (SEQ ID NO: 81), which corresponds to non-coding strand sequence complementary to nucleotides 575 through 590 of Fig. 1.
- LpA-IA has the sequence 5'-GGAGTCGTGGGGAGCAGTC-3' (SEQ ID NO: 82), which corresponds to nucleotides 654 through 672 of Fig. 1.
- Fig. 1 The nucleotide (SEQ ID NO: 1) and deduced amino acid sequences (SEQ EO NO: 2) of a representative clone of Lol p I, clone 26.j are shown in Fig. 1.
- the nucleic acid sequence coding for Lolp I has an open reading frame beginning with an ATG initiation codon at nucleotides 16-18 ending with a TGA stop codon at nucleotides 805-807.
- the translated protein has a deduced amino acid sequence of 263 amino acids with a predicted molecular weight of 28.4 kD and a pi of 5.55.
- the initiating methionine is numbered amino acid -23, with amino acid numbered +1 corresponding to the NH2-terminus of the mature protein, as defined by amino acid sequencing (Cottam et al. (1986), Biochem J., 234: 305-310).
- Amino acids -23 through -1 correspond to a leader sequence that is cleaved to yield the mature protein; the mature protein is therefore composed of 240 amino acids and has a predicted molecular weight of 26.1 kD and a pi of 5.38.
- Amino acids 1 through 30 of clone 26./ ' correspond exactly to the published sequence of the NH2 terminus of Lolp I (Cottam et al, supra).
- Amino acids 213 through 240 of clone 26*j correspond exactly to the published internal amino acid sequence of Lolp I (Esch and Klapper (1989), Mol. Immunol, 26: 557- 561).
- nucleotide polymo ⁇ hisms are shown relative to the sequence of clone 26.; * (Fig.1) (SEQ ID NO: 1). The polymo ⁇ hic residues in their respective codon triplets are numbered. Productive amino acid changes are also shown; most nucleotide polymo ⁇ hisms are silent and do not result in an amino acid change. Twenty-eight potential polymo ⁇ hisms have only been observed in clones from single PCR reactions.
- Lolp I and Lolp IX Cloned DNA encoding Lolp I and Lolp IX was expressed in E. coli and purified on a Ni-chelating affinity column. Monoclonal antibodies were also used to affinity purify and distinguish isoforms of these and native grass proteins. The recombinant Lolp I was compared to biochemically purified native Lolp I and Lolp DC in mAb and human IgE reactivity studies (data not shown). The reactivity of human IgE to the recombinant and native forms was equivalent when measured by direct binding ELISA.
- Lol p I and Lolp JX native and recombinant allergens showed ihibition of grass allergic patient IgE binding to soluble pollen extracts of other grass species ⁇ Dae g, Phlp and Poap).
- the degree to which Lolp I and Lolp IX proteins successfully compete for IgE binding to these other grasses implies a hierarchy of homology between the species.
- Defatted Lolp I pollen was extracted twice, overnight at 4°C in 50mM phosphate buffer, 15mM NaCl, pH 7.2 and protease inhibitors (PMSF, Luepeptin, SPTI and pepstatin). The extract was then depigmented by batch abso ⁇ tion with DE- 52 (Whatman) in 50mM phosphate buffer, 0.3M NaCl, pH 7.2.
- Depigmented Lolp I extract was dialyzed into H2O, pH 8.0 by addition of NH4OH. This mateial was loaded onto a DE-52 column and eluted stepwise with ImM, 4.5mM and 7.5mM NaH2PO ⁇ The majority of the Group I allergens was eluted with 4.5mM Na ⁇ PO A further separation of Group I was accomplished by running this DE-52 enriched fraction over A (26/60) superdex 75 column (Pharmacia).
- Lolp I cDNA's encoding from the first amino acid of the mature protein to the stop codon were ligated into pETl ld ⁇ HR containing a leader which encoded 6 histidines.
- the HIS6 was used for purification over a nickel-NTA agarose column (Qiagen).
- xLol p I was expressed in E. coli.
- Electroblotting and Immunoblotting Electrophoresis was performed using 12.5% polyacrylamide gels. The samples were run under reducing conditions (4 hours at 40mA constant current). After electrophoresis the protein was transferred to nitrocellulose membrane (1.5 hours at 1.5 A). The blots were stained with 1% India ink, and then blocked with 1% defatted milk, 1% FCS in Tween solution (2mM Tris-HCl pH 7.5, 0.71M NaCl, and 0.05% Tween 20) for 1 hour. The human plasma samples were pre-absorbed with blank nitrocellulose for 1.5 hours prior to incubation. Blot sections were incubated with 1st antibodies diluted in 1% milk/Tween solution overnight at room temperature (RT).
- RT room temperature
- the blot sections were washed three times and inucbated in the appropriate biotinylated 2nd AB (1:2500) for 2 hours at RT.
- the blot sections were washed three times and finally incubated with 125j_ su . e pta V idin 1 hour at RT.
- the sections were washed extensively to remove unbound label and exposed to film. Autoradiography was carried out at -80°C.
- the human plasma samples were mixed with an equal volume of serially diluted antigen or with PBS-T (as a control). These samples were incubated overnight at 4°C before addition to the microtiter plate and performing the remaining steps of the ELISA as stated above.
- PBMC Peripheral blood mononuclear cells
- LSM lymphocyte separation medium
- T cell lines were established by stimulation of 2xl0 6 PBL ml in bulk cultores of complete medium E PMI-1640, 2 mM L-glutamine, 100 U/ml peiticillin/streptomycin, 5xlO" 5 M 2-mercaptoethanol, and 10 mM HEPES, supplemented with 5% heat-inactivated human AB serum) with 25 mg/ml of purified native Lolp I (95% pure with a single band on protein gel) for 6 days at 37°C in a humidified 5% CO2 incubator to select for Lolp I reactive T Cells. This amount of priming antigen was determined to be optimal for the activation of T cells from most grass-allergic patients.
- Viable cells were purified by LSM centrifugation and cultured in complete medium, supplemented with 5 units recombinant human IL-2/ml and 5 units recombinant human IL-4/ml for up to 3 weeks until the cells no longer responded to lymphokines and were considered "rested.”
- the ability of the T cells to proliferate to selected peptides, recombinant Lol p I ⁇ Lol p I), purified native Lolp I, recombinant Lolp IX ⁇ xLolp EX), or Derp I ⁇ xDerp I) was then assessed.
- 2x10* rested cells were restimulated in the presence of 2x10* autologous Epstein-Barr virus (EBV)-transformed B cells (prepared as described below) with 2-50 mg/ml of xLolp I, purified native Lolp I, xDerp I, or xLol p EX, in a volume of 200 ml complete medium in duplicate wells in 96- well round- bottom plates for three days. Each well then received 1 mCi tritiated thymidine for 16- 20 hours. The counts inco ⁇ orated were collected onto glass fiber filter mats and processed for liquid scintillation counting.
- EBV Epstein-Barr virus
- the varying antigen dose in assays with xLolp I, purified native Lolp I, and recombinant Lol p IX and several antigenic peptides (i.e., peptides that induce an immune response, or, specifically, a positive T cell response in these assays) synthesized as described above were determined.
- the titrations were used to optimize the dose of peptides in T cell assays.
- the maximum response in a titration of each peptide is expressed as the stimulation index (S.I.).
- the S.I. is the counts per minute (CPM) inco ⁇ orated by cells in response to peptide, divided by the CPM inco ⁇ orated by cells in medium only.
- the bar represents the positivity index for each peptide (% of patients responding multiplied by mean S.I.).
- EBV-transformed cell lines were derived by incubating 5xl0 6 PBL with 1 ml of B-59/8 Marmoset cell line (ATCC CRL1612, American Type Culture Collection, Rockville, MD) conditioned medium in the presence of 1 mg/ml phorbol 12-myristate 13-acetate (PMA) at 37°C for 60 minutes in 12x75 mm polypropylene round-bottom Falcon snap cap tubes (Becton Dickinson Labware, Lincoln Park, NJ).
- B-59/8 Marmoset cell line ATCC CRL1612, American Type Culture Collection, Rockville, MD
- PMA phorbol 12-myristate 13-acetate
- RNA was obtained from the pollen of Dactylis glomerata using a standard acid phenol extraction procedure (Sambrook et al. (1989), Molecular Cloning: A laboratory manual. 2nd Edition., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY). This and other pollens described below were purchased from Greer Laboratories (Lenoir, NC). Single and double stranded cDNA was prepared from total D. glomerata RNA using the BRL cDNA Synthesis System (Gaithersberg, MD), blunted using standard procedures (Sambrook et al.
- Oligonucleotide primers AP-2 and LpA-9 (5'- GTGACAGCCTCGCCGG-3') (SEQ JD NO: 78) were used in a secondary amplification using 10% of the primary amplification as template cDNA.
- PCRs were carried out using the GeneAmp DNA Amplification kit (Perkin Elmer, Norwalk, CT) using a programmable thermal controller from MJ Research, Inc. (Cambridge, MA). Samples were amplified for 24 cycles by heating to 94°C for 1 min, 54°C for 1.5 min and 70°C for 1 min.
- PCR product was blunted with T4 DNA polymerase (Sambrook et al. (1989) supra) and digested with the restriction endonuclease Xbal. Unless otherwise stated, all endonucleases and polymerases were obtained from New England BioLabs (Beverly, MA). A band of approximately 400 base pairs was isolated from a low melting temperature agarose gel (FMC, Rockland, ME) and ligated into appropriately digested pUC19. The clones 22.2 and 22.5 were subsequently identified by dideoxysequencing (Sanger et al. (1977), Proc. Natl. Acad. Sci. USA, 74:5460- 5463) to contain nucleotide sequence of the gene encoding Dae g 1.
- a 600 base pair cDNA containing internal nucleotide sequence of the gene encoding Dae g 1 was amplified using the primers DGI-3 (5'- TTGGATCCTACGGCAAGCCGACCGGC-3') (SEQ ID NO: 84) and LpA- 10 (5- CCGTCGACGTACTTCA-3') (SEQ ID NO: 81).
- a 300 base pair cDNA containing internal Dae g 1 sequence was amplified using the primers DGI-4 (5'- TTGGATCCATCCCGAAGGTGCCCCCGGG-3' (SEQ ID NO: 85), wherein G at position 14 can also be A) and LpA-9 (5'-GTGACAGCCTCGCCGG-3') (SEQ ro NO: 78).
- the cDNAs were amplified for 34 cycles by heating to 94°C for 45 sec, 60°C for 45 sec and 72°C for 1 min. These PCR products were blunted with T4 DNA polymerase as above, digested with BamHl and ligated into appropriately digested pUC19. Clones 86.1 (600 base pairs) and 88.6 (300 base pairs) were sequenced and found to contain sequence of the gene encoding D ⁇ c g 1.
- the 700 base pair PCR product was digested with B ⁇ mHl and AspllS (Boehringer Mannheim, Indianapolis, IN), isolated and digested into appropriately digested pUC19 as described above.
- the clones 119.2, 119.4, 119.6, 119.9 and 119.12 were isolated, sequenced and found to contain sequence of the gene encoding D ⁇ c g 1.
- cDNA clones encoding the mature Dae g 1 protein were obtained by PCR with the oligonucleotide primers DGI-7Eco (5'-
- TTGAATTCATCCCGAAGGTGCCCCCG-3' (SEQ ID NO: 88), wherein G at position 14 can also be A) and PhA-1.2 (5'- TTGGTACCTCACTTGGACTCGTAGCT-3') (SEQ ID NO: 89).
- the cDNAs were amplified for 24 cycles of heating to 94°C for 1 min, 54°C for 1.5 min and 70°C for 1 min.
- the amplified cDNA was digested with EcoRl and A.sp718, isolated, and ligated into the appropriately digested pUC19.
- the cDNA clones 106.5, 106.6, 106.9 and 106.12 were identified as containing Dae g 1 sequence by dideoxysequencing.
- nucleotide (SEQ ID NO: 51) and deduced amino acid (SEQ ID NO: 52) sequences of clone 106.5 are shown in Fig. 5.
- Nucleotides 509-515 (encoding amino acids 171 and 172) are from the sequence of clone 106.12. The sequence of clone 106.5 was not resolved in this region.
- the insert from clone 106.5 was isolated and ligated into appropriately digested expression vector pET-1 Id (Novagen, Madison, Wl: Jameel et al. (1990), J. Virol, 64:3963-3966).
- the pET-1 Id vector had been modified to contain a sequence encoding 6 histidines (His 6) immediately 3' of the ATG initiation codon followed by a unique EcoRl endonuclease restriction site.
- a recombinant clone was used to transform Escherichea coli strain BL21- D ⁇ 3.
- a culture was grown to A600 of 1-0, IPTG was added to 1 mM final concentration and grown for an additional 2 hours.
- Bacteria was recovered by centrifugation (7,930 G, 10 min) and lysed in 90 ml of 6 M Guanidine- ⁇ Cl, 0.1 M Na2 ⁇ P ⁇ 4, pH 8.0 for 1 hour with vigorous shaking.
- the recombinant Dae g 1 was purified from the extract on a Ni + -*- chelating column (Hochuli et al. (1987) J. Chromatog., 411:177-184; Hochuli et al. (1988), Bio/Tech., 6:1321-1325).
- RNA was isolated from the pollen of Poa pratensis, double stranded cDNA was prepared and self-annealed oligonucleotides AT and AL were added as described in section A, above.
- PCR product was amplified using oligonucleotide primers Phl-7 (5'-CCGAATTCGTGGAGAAGGGGTCCAA-3') (SEQ ID NO: 90) and Poa-1 (5'- TTAGGATCCTCACTTATCATAIGACGTATC-3' (SEQ JD NO: 91 ), wherein C at position 13 can also be T, A at position 16 can also be G, A at position 19 can also be G, G at position 23 can also be C, A at position 24 can also be T, C at position 25 can also be T or A or G and A at position 28 can be G).
- Clones containing partial nucleotide sequences of the gene encoding Poap 1 were derived from PCRs that used oligonucleotide primers AP and Poa-3 (5'-
- TTGAATTCCTTGTCATTGCCCTTCTG-3' (SEQ ID NO: 92) in the primary PCR and AP and Poa-4 (5'-AAGAATTCCTTCTGCTTGATGTCCAC-3') (SEQ ID NO: 93) in the secondary PCR.
- Other clones were derived from PCRs that used oligonucleotide primers AP and Poa-6 (5'- ATGAATTCGAGTCGTGGGGAGCCGTC-3') (SEQ ID NO: 94) in the primary PCR and AP and Poa-7 (5'-ATGAATTCGTCTGGAGGATCGACACC-3') (SEQ ro NO: 95) in the secondary PCR.
- Clones 58, 59 and 63 were derived from the PCR using primers AP and Poa-4.
- Clones 91 and 97 were derived from the PCR using primers AP and Poa-7. Additional clones were derived from a PCR that used oligonucleotide primers
- Poa-1 and Poa-5 (5 " -ATGAATTCATCGCAAAGGTTCCCCCC-3' (SEQ ED NO: 96), wherein A at position 14 can also be G or C or T).
- These clones, 113, 114 and 115 corresponded to the portion of the gene that encoded amino acids 1 - 240 of Poa p 1 (see Fig. 6).
- the nucleotide (SEQ ID NO: 53) and deduced amino acid (SEQ ID NO: 54) sequences of clone 114 are shown in Fig. 6.
- Nucleotide 93 in Fig. 6 was not resolved and could be a G or a C or a T or an A and is represented by the letter "N”.
- the codon containing nucleotide 93 (GGN) encodes a Glycine at residue 31.
- the codon containing nucleotide 94 (BCC) encodes an Alanine (GCC), a Proline (CCC), or a Serine (TCC) at amino acid 32.
- the amino acid at residue 32 in Fig. 6 is represented by an "X”.
- Clones were derived from a PCR that used oligonucleotide primers PhAl.l (5'-TTTGGATCCTCACTTGGACTCGTAGCT-3') (SEQ ID NO: 97) and Phl-2 (5'-TTGAATTCTCGCGAAGGTGCCCCCG-3' (SEQ ID NO: 98), wherein G at position 13 can also be A).
- PhAl.l 5'-TTTGGATCCTCACTTGGACTCGTAGCT-3'
- Phl-2 5'-TTGAATTCTCGCGAAGGTGCCCCCG-3' (SEQ ID NO: 98), wherein G at position 13 can also be A).
- These clones, 20 and 22, corresponded to the portion of the gene that encoded amino acids 1 - 240 of Phlp 1
- Clones containing partial nucleotide sequence of the gene encoding Phi p 1 were derived from a PCR using oligonucleotide primers Phl-7 (5'- CCGAATTCGTGGAGAAGGGGTCCAA-3') (SEQ ID NO: 90) and PhAl.l. Clones 47-52 were derived from this PCR. These clones encoded amino -acids 151 through 240 of Fig. 7.
- Inserts from clones 22 and 51 were isolated and ligated into appropriately digested expression vector pET-1 Id (Novagen, Madison, Wl: Jameel et al. (1990) J. Virol. £4 * 3963-3966). Recombinant proteins were expressed as descibed in section A, above.
- Example 6 Comparison of Dae g 1, Phlp 1 and Poap 1 With Lolp 1.
- the sequences of the other Group 1 allergens are very conserved in these regions. Since the Group 1 allergens are homologous, the major T cell epitope containing peptides of Lolp 1 are likely to be the major T cell epitope containing regions in the related grasses.
- Comparison of the sequences of the Lolp 1 peptides with the homologous peptides containing Dae g 1, Phlp 1 and Poap 1 polymo ⁇ hisms are shown in Fig. 9 (SEQ ED NO: 23, 25, 27, 30, 61-70).
- GGC AAG GAT AAG TGG ATC GAG CTC AAG GAG TCG TGG GGA GCA GTC TGG 675
- Trp He Glu Leu Lys Glu Ser Trp Gly Ala Val Trp Arg He Asp Thr 190 195 200
- MOLECULE TY.PE peptide
- FRAGMENT TYPE internal
- GAG GAG CCC ATC GCG CCC TAC CAC TTC GAC CTT TCC GGC CAC GCG TTC 336 Glu Glu Pro He Ala Pro Tyr His Phe Asp Leu Ser Gly His Ala Phe 100 105 110
- GGT TCC ATG GCG AAG AAG GGC GAG GAG CAG AAG CTG CGC AGC GCG GGC 384 Gly Ser Met Ala Lys Lys Gly Glu Glu Gin Lys Leu Arg Ser Ala Gly 115 120 125
- GAG GAG CCC ATC GCC GCC TAC CAC TTC GAC CTC TCC GGC AAG GCG TTC 336
- GAG GAG CCC ATC GCC CCC TAC CAC TTC GAC CTC TCC GGC CAC GCG TTC 336
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Botany (AREA)
- General Chemical & Material Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pulmonology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Engineering & Computer Science (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Gastroenterology & Hepatology (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
Description
Claims
Priority Applications (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
NZ263913A NZ263913A (en) | 1993-03-12 | 1994-03-09 | Lol pi protein allergen from ryegrass and related peptides coding sequences, vectors, protein production and use |
EP94912761A EP0688338A1 (en) | 1993-03-12 | 1994-03-09 | T cell epitopes of ryegrass pollen allergen |
AU65175/94A AU684501B2 (en) | 1993-03-12 | 1994-03-09 | T cell epitopes of ryegrass pollen allergen |
JP6521096A JPH08509966A (en) | 1993-03-12 | 1994-03-09 | T cell epitopes of ryegrass pollen allergen |
NO953571A NO953571L (en) | 1993-03-12 | 1995-09-11 | T-cell epitopes of common raigress pollen allergen |
FI954269A FI954269A0 (en) | 1993-03-12 | 1995-09-12 | T-cell epitopes of ryegrass pollen antigen |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US3100193A | 1993-03-12 | 1993-03-12 | |
US08/031,001 | 1993-03-12 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO1994021675A2 true WO1994021675A2 (en) | 1994-09-29 |
WO1994021675A3 WO1994021675A3 (en) | 1994-11-10 |
Family
ID=21857138
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1994/002537 WO1994021675A2 (en) | 1993-03-12 | 1994-03-09 | T cell epitopes of ryegrass pollen allergen |
Country Status (10)
Country | Link |
---|---|
EP (1) | EP0688338A1 (en) |
JP (1) | JPH08509966A (en) |
AU (1) | AU684501B2 (en) |
CA (1) | CA2157596A1 (en) |
FI (1) | FI954269A0 (en) |
IL (1) | IL108940A0 (en) |
NO (1) | NO953571L (en) |
NZ (1) | NZ263913A (en) |
WO (1) | WO1994021675A2 (en) |
ZA (1) | ZA941708B (en) |
Cited By (15)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1995034578A1 (en) * | 1994-06-14 | 1995-12-21 | Pharmacia Ab | Recombinant allergen, fragments thereof, corresponding recombinant dna molecules, vectors and hosts containing the dna molecules, diagnostic and therapeutic uses of said allergens and fragments |
WO1996007428A1 (en) * | 1994-09-02 | 1996-03-14 | Immulogic Pharmaceutical Corporation | Peptide compositions capable of down regulating an antigen specific immune response |
EP0804467A1 (en) * | 1995-01-10 | 1997-11-05 | Ludwig Institute For Cancer Research | Isolated, truncated nucleic acid molecules which code for gage tumor rejection antigen |
WO1998000565A2 (en) * | 1996-06-28 | 1998-01-08 | Abbott Laboratories | NUCLEIC ACID PRIMERS AND PROBES FOR DETECTING $i(MYCOPLASMA PNEUMONIAE) |
FR2809415A1 (en) * | 2000-05-29 | 2001-11-30 | Tabacs & Allumettes Ind | CLONING AND SEQUENCING OF THE DAC G1 ALLERGEN FROM DACTILYS GLOMERATA POLLEN, ITS PREPARATION AND USE |
US6737406B1 (en) | 1996-03-21 | 2004-05-18 | Circassia, Ltd. | Cryptic peptides and method for their identification |
US6759234B1 (en) | 1994-09-02 | 2004-07-06 | Immulogic Pharmaceutical Corporation | Compositions and methods for administering to humans, peptides capable of down regulating an antigen specific immune response |
EP1499337A1 (en) * | 2002-04-02 | 2005-01-26 | Monash University | Immunotherapeutic and immunoprophylactic reagents |
AU2003213861B2 (en) * | 2002-04-02 | 2010-04-29 | Circassia Limited | Immunotherapeutic and immunoprophylactic reagents |
US20120171710A1 (en) * | 2009-04-30 | 2012-07-05 | Stallergenes S.A. | Method for Grass Species Identification |
US8551493B2 (en) | 2007-08-15 | 2013-10-08 | Circassia Limited | Peptide with reduced dimer formation |
US8551492B2 (en) | 2007-06-01 | 2013-10-08 | Circassia Limited | Vaccine peptide combinations against cat allergy |
US8753644B2 (en) | 2009-02-05 | 2014-06-17 | Circassia Limited | Grass peptides for vaccine |
WO2017004561A1 (en) | 2015-07-01 | 2017-01-05 | Alk-Abelló A/S | Peptide combinations and uses thereof for treating grass allergy |
US11524019B2 (en) | 2017-08-21 | 2022-12-13 | Glycom A/S | Synthetic composition for reducing allergy symptoms |
Families Citing this family (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7879977B2 (en) | 1998-01-31 | 2011-02-01 | University Of Arkansas | Methods and reagents for decreasing clinical reaction to allergy |
WO1999038978A1 (en) | 1998-01-31 | 1999-08-05 | University Of Arkansas | Methods and reagents for decreasing allergic reactions |
US8246945B2 (en) | 2000-04-06 | 2012-08-21 | University Of Arkansas | Methods and reagents for decreasing clinical reaction to allergy |
DK1272213T3 (en) | 2000-04-06 | 2006-07-10 | Seer Pharmaceuticals Llc | Microbial delivery system |
AUPR779201A0 (en) * | 2001-09-20 | 2001-10-11 | University Of Melbourne, The | Immunotherapeutic and immunoprophylactic reagents |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1989009260A1 (en) * | 1988-03-23 | 1989-10-05 | The University Of Melbourne | Ryegrass pollen allergen |
WO1992003550A1 (en) * | 1990-08-17 | 1992-03-05 | The University Of Melbourne | Ryegrass pollen allergen |
WO1993004174A1 (en) * | 1991-08-16 | 1993-03-04 | The University Of Melbourne | Ryegrass pollen allergen |
-
1994
- 1994-03-09 AU AU65175/94A patent/AU684501B2/en not_active Expired - Fee Related
- 1994-03-09 NZ NZ263913A patent/NZ263913A/en unknown
- 1994-03-09 CA CA002157596A patent/CA2157596A1/en not_active Abandoned
- 1994-03-09 EP EP94912761A patent/EP0688338A1/en not_active Withdrawn
- 1994-03-09 JP JP6521096A patent/JPH08509966A/en active Pending
- 1994-03-09 WO PCT/US1994/002537 patent/WO1994021675A2/en not_active Application Discontinuation
- 1994-03-11 ZA ZA941708A patent/ZA941708B/en unknown
- 1994-03-11 IL IL10894094A patent/IL108940A0/en unknown
-
1995
- 1995-09-11 NO NO953571A patent/NO953571L/en unknown
- 1995-09-12 FI FI954269A patent/FI954269A0/en not_active Application Discontinuation
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1989009260A1 (en) * | 1988-03-23 | 1989-10-05 | The University Of Melbourne | Ryegrass pollen allergen |
WO1992003550A1 (en) * | 1990-08-17 | 1992-03-05 | The University Of Melbourne | Ryegrass pollen allergen |
WO1993004174A1 (en) * | 1991-08-16 | 1993-03-04 | The University Of Melbourne | Ryegrass pollen allergen |
Cited By (29)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5858689A (en) * | 1993-07-22 | 1999-01-12 | Ludwig Institute For Cancer Research | Isolated peptides derived from the gage tumor rejection antigen precursor and uses thereof |
US6008340A (en) * | 1994-06-14 | 1999-12-28 | Pharmacia & Upjohn Ab | Recombinant allergen, fragments thereof, corresponding recombinant DNA molecules, vectors and hosts containing the DNA molecules |
US7148019B2 (en) | 1994-06-14 | 2006-12-12 | Phadia Ab | Recombinant polypeptides having Ph1 p I epitope antigenicity and methods of diagnosing allergy in vitro |
WO1995034578A1 (en) * | 1994-06-14 | 1995-12-21 | Pharmacia Ab | Recombinant allergen, fragments thereof, corresponding recombinant dna molecules, vectors and hosts containing the dna molecules, diagnostic and therapeutic uses of said allergens and fragments |
US6559120B2 (en) | 1994-06-14 | 2003-05-06 | Pharmacia Ab | Recombinant allergen, fragments thereof, corresponding recombinant DNA molecules, vectors and hosts containing the DNA molecules, diagnostic and therapeutic uses of said allergens and fragments |
WO1996007428A1 (en) * | 1994-09-02 | 1996-03-14 | Immulogic Pharmaceutical Corporation | Peptide compositions capable of down regulating an antigen specific immune response |
US6759234B1 (en) | 1994-09-02 | 2004-07-06 | Immulogic Pharmaceutical Corporation | Compositions and methods for administering to humans, peptides capable of down regulating an antigen specific immune response |
EP0804467A4 (en) * | 1995-01-10 | 1997-12-03 | ||
EP0804467A1 (en) * | 1995-01-10 | 1997-11-05 | Ludwig Institute For Cancer Research | Isolated, truncated nucleic acid molecules which code for gage tumor rejection antigen |
US6737406B1 (en) | 1996-03-21 | 2004-05-18 | Circassia, Ltd. | Cryptic peptides and method for their identification |
WO1998000565A3 (en) * | 1996-06-28 | 1998-09-11 | Abbott Lab | NUCLEIC ACID PRIMERS AND PROBES FOR DETECTING $i(MYCOPLASMA PNEUMONIAE) |
WO1998000565A2 (en) * | 1996-06-28 | 1998-01-08 | Abbott Laboratories | NUCLEIC ACID PRIMERS AND PROBES FOR DETECTING $i(MYCOPLASMA PNEUMONIAE) |
FR2809415A1 (en) * | 2000-05-29 | 2001-11-30 | Tabacs & Allumettes Ind | CLONING AND SEQUENCING OF THE DAC G1 ALLERGEN FROM DACTILYS GLOMERATA POLLEN, ITS PREPARATION AND USE |
WO2001092531A1 (en) * | 2000-05-29 | 2001-12-06 | Seita Groupe Altadis | Cloning and sequencing the dac g1 allergen of dactylis glomerata pollen, preparation and use thereof |
EP1499337A4 (en) * | 2002-04-02 | 2005-11-23 | Univ Monash | Immunotherapeutic and immunoprophylactic reagents |
AU2003213861B2 (en) * | 2002-04-02 | 2010-04-29 | Circassia Limited | Immunotherapeutic and immunoprophylactic reagents |
EP1499337A1 (en) * | 2002-04-02 | 2005-01-26 | Monash University | Immunotherapeutic and immunoprophylactic reagents |
US8551492B2 (en) | 2007-06-01 | 2013-10-08 | Circassia Limited | Vaccine peptide combinations against cat allergy |
US9168295B2 (en) | 2007-06-01 | 2015-10-27 | Circassia Limited | Vaccine peptide combinations |
US8652485B2 (en) | 2007-08-15 | 2014-02-18 | Circassia Limited | Peptide for vaccine |
US8551493B2 (en) | 2007-08-15 | 2013-10-08 | Circassia Limited | Peptide with reduced dimer formation |
US9340580B2 (en) | 2007-08-15 | 2016-05-17 | Circassia Limited | Peptide with multiple epitopes |
US9744222B2 (en) | 2007-08-15 | 2017-08-29 | Circassia Limited | Peptide for vaccine |
US8753644B2 (en) | 2009-02-05 | 2014-06-17 | Circassia Limited | Grass peptides for vaccine |
US8632993B2 (en) * | 2009-04-30 | 2014-01-21 | Stallergenes S.A. | Method for grass species identification |
US20120171710A1 (en) * | 2009-04-30 | 2012-07-05 | Stallergenes S.A. | Method for Grass Species Identification |
WO2017004561A1 (en) | 2015-07-01 | 2017-01-05 | Alk-Abelló A/S | Peptide combinations and uses thereof for treating grass allergy |
US11013781B2 (en) | 2015-07-01 | 2021-05-25 | Alk-Abelló As | Peptide combinations and uses thereof for treating grass allergy |
US11524019B2 (en) | 2017-08-21 | 2022-12-13 | Glycom A/S | Synthetic composition for reducing allergy symptoms |
Also Published As
Publication number | Publication date |
---|---|
ZA941708B (en) | 1994-10-05 |
NO953571L (en) | 1995-11-10 |
NO953571D0 (en) | 1995-09-11 |
EP0688338A1 (en) | 1995-12-27 |
NZ263913A (en) | 1997-10-24 |
FI954269A (en) | 1995-09-12 |
AU684501B2 (en) | 1997-12-18 |
JPH08509966A (en) | 1996-10-22 |
CA2157596A1 (en) | 1994-09-29 |
IL108940A0 (en) | 1994-06-24 |
AU6517594A (en) | 1994-10-11 |
WO1994021675A3 (en) | 1994-11-10 |
FI954269A0 (en) | 1995-09-12 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU684501B2 (en) | T cell epitopes of ryegrass pollen allergen | |
US5710126A (en) | T cell epitopes of ryegrass pollen allergen | |
JPH06508994A (en) | Allergenic proteins and peptides from Japanese cedar pollen | |
CA2115579C (en) | Ryegrass pollen allergen | |
US5965455A (en) | Ryegrass pollen allergen | |
EP0495052A1 (en) | Allergens of alder pollen and applications thereof | |
NZ271818A (en) | T cell epitopes of ryegrass pollen antigen | |
NZ252013A (en) | T cell receptor epitopes for short ragweed pollen | |
AU679455B2 (en) | T cell epitopes of ryegrass pollen allergen | |
US6335019B1 (en) | Methods for treating sensitivity to protein allergen using peptides which include a T cell epitope recognized by a T cell receptor specific for the protein allergen | |
US7112333B1 (en) | T cell epitopes of ryegrass pollen allergen | |
US6214358B1 (en) | Protein allergens of the species Cynodon dactylon | |
US20030180225A1 (en) | Walnut and ryegrass allergens | |
WO1992016554A1 (en) | Protein allergens of the species cynodon dactylon | |
JPH07502648A (en) | Cynodon dactylon species protein allergen |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AU BB BG BR BY CA CN CZ FI HU JP KP KR KZ LK LV MG MN MW NO NZ PL RO RU SD SK UA UZ VN |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
WWE | Wipo information: entry into national phase |
Ref document number: 263913 Country of ref document: NZ |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2157596 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 954269 Country of ref document: FI |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1994912761 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 1994912761 Country of ref document: EP |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1994912761 Country of ref document: EP |