WO1992016554A1

WO1992016554A1 - Protein allergens of the species cynodon dactylon

Info

Publication number: WO1992016554A1
Application number: PCT/AU1992/000108
Authority: WO
Inventors: Robert Bruce Knox; Mohan Bir Singh; Penelope Mary Smith
Original assignee: The University Of Melbourne
Priority date: 1991-03-14
Filing date: 1992-03-13
Publication date: 1992-10-01

Abstract

The present invention provides nucleic acid sequences coding for protein allergens of the species Cynodon dactylon, or at least one fragment thereof or the functional equivalent of such nucleic acid sequences. The present invention also provides expression vectors comprising such nucleic acid sequences and host cells transformed therewith. The present invention further provides isolated protein allergens of Bermuda grass pollen or fragments thereof. Isolated protein allergens of Bermuda grass pollen or antigenic or allergenic fragments thereof are useful for diagnosing and treating sensitivity in an individual to Bermuda grass pollen allergens.

Description

ProteJn Allergens of the Species Cynodon Dac ylon

Backgrtmnd of the Tπvenrion: Bermuda grass (Cynodon dactylon) is an important source of pollen allergens in many areas of the world, especially in tropical and sub-tropical climates. These allergens have been studied by a number of means including IgE immunoblotting (Ford D., and Baldo, Λ. J. Allergy Gin. Immunol.79: 711-720 (1987); Shen H D., et al., din. AUergylS: 401-409 (1988), column chromatography (Orren, A^ and Dowdle, S. Afr. Med. J.51: 586 (1977); Matthiesen et al., . Allergy din. Immunol.81: 266 (Ab) (1988), and immunoelectrophoresis (Matthiesen et al., supra, 1988).

The presence of Bermuda grass pollen allergens in the environment causes hayfever and seasonal asthma in many individuals and continues to have significant morbidity and socio-economic impact on Western communities. While the available spectrum of drugs, including anti-histamines and steroids, have resulted in improvement in the treatment of allergic disease, they do have unfortunate side-effects associated with long term usage. Because of these problems, renewed interest has been shown in the immunotherapy of allergic disease. Immunotherapy involves the injection of potent allergen extracts to desensitize patients against allergic reactions (Bousquet, J. and Michel, F.B., Allergy and dm Immol. News 1: 7-10 (1989). Unfortunately, the pollen preparations used as allergens are polyvalent and of poor quality. Consequently, concentrations of crude extracts used are frequently high and may trigger potentially lethal systemic reactions, including anaphyiaxis. The product expressed from the cloned gene, fragments thereof, or synthetic peptides based on the sequence of the allergens provide a safer medium for therapy since they can be quality controlled, characterized and standardized, and they optionally do not bind IgE. Thus, identification and isolation of the protein allergens of Bermuda grass pollen would be useful in developing therapeutic and diagnostic agents to treat and diagnose sensitivity in individuals to Bermuda grass pollen allergens. Siimmarv of the Invention

Brief Description of the Figures

Fig. 1 shows a Western blot of IgE binding to Bermuda grass pollen allergens separated by SDS-PAGE. Fig. 2 shows IgE binding to fusion proteins on plaque lifts of cDNA clones

Bl, B2 and B4 of Cynodon dactylon.

Fig.3 is the nucleic acid sequence and deduced amino acid sequence of clone Bl of Cynodon dactylon,

Fig. 4 shows a Western blot of Bermuda grass pollen proteins separated by SDS-PAGE and probed with sera from allergic individuals or with affinity purified IgE specifically reactive with a clone Bl fusion protein.

Fig. 5 is the nucleic acid sequence and deduced amino acid sequence of clone B4 of Cynodon dactylon.

Fig. 6 shows the nucleotide sequence homology between clones Bl (Cyn dSBl) and B4 of ( Cyn <5B4) of Cynodon dactylon. The first and last 6 nudeotides of each sequence represents the EcoRl restriction sites used for cloning.

Fig.7 shows the deduced amino add sequence homology between clones Bl (Cyn dSBl) and B4 (Cyn d$B4) of Cynodon dactylon.

Fig.8 is tiie nudeic add sequence and deduced amino add sequence of done B2 of Cynodon dactylon.

Fig. 9 shows the deduced amino add sequence homology between clone B2 and polygalacturonase from Lycopersicon escidentum (tomato). Fig. 10 shows a Western blot of Bermuda grass pollen proteins separated by SDS-PAGE and probed with polydonal antibodies raised against a done B2 fusion protein.

Detailed Description of the Invention

The present invention provides nudeic add sequences coding for protein allergens of the spedes Cynodon dactylon. The nudeic add sequences coding for Cynodon dactylon allergens preferably comprise the nudeic add sequence of Clone Bl, Qone B4, and Qone B2. Nudeic adds coding for Bermuda grass pollen allergens may be obtained from any part of Cynodon dactylon plants. Nudeic adds encoding Bermuda grass pollen allergens may also be obtained from genomic DNA The nudeic adds coding for protein allergens of the present invention may be obtained using the method disdosed herein or any other suitable technique for isolation and doning of genes. The nudeic adds of the invention may be DNA or RNA

Preferred nudeic add sequences of the present invention comprise the nudeic add sequences of Qone Bl, as shown in Fig. 3, Qone B4, as shown in Fig. 5, and Qone B2, as shown in Fig. 8. The nudeic add sequence and deduced amino add sequence of Qone Bl is shown in Fig. 3. Nudeotides 1 through 213 comprise the open reading frame for Qone Bl and encode 71 amino adds. This done encodes a partial sequence of a Bermuda grass pollen allergen. The reading frame was determined by direct nudeotide sequencing of the junction between the original pGEX-1 done and the Bl insert Nudeotides 214 through 468 comprise the 3' untranslated region of this done. The nudeic add sequence and predicted amino add sequence for the done B4 is shown in Fig. 5. Nudeotides 1 through 219 comprise the open reading frame for this done and encode 73 amino adds. Qone B4 encodes a partial sequence of a Bermuda grass pollen allergen. The reading frame was determined by direct nudeotide sequencing of the junction between the original pGEX-1 done and the B4 insert. Nudeotides 220 through 429 comprise the 3' untranslated region of this done. It was determined that the cDNA insert of clones Bl and B4 encode partial sequences of related protein allergens of Cynodon dactylon. The nudeotide homology between dones Bl and B4 is shown in Fig. 6. Qone B4 has a six nudeotide insert relative to clone Bl in the coding sequence. This nudeotide homology was demonstrated using software contained in PCGENE (Intelligenetics, Mountain View, CA). The deduced amino add homology between dones Bl and B4 has also been determined (See Fig. 7). The deduced amino asid sequence of done B4 has two more amino adds than the deduced amino add sequence of done Bl. Otherwise, the amino add sequences are identical. The amino add homology was demonstrated using software contained in PCGENE (Intelligenetics, Mountain View, CA).

The nudeic add sequence and deduced amino add sequence for done B2 is shown in Fig. 8. Nudeotides 1 through 741 form a long open reading frame that encodes 247 amino adds. There are 4 potential N-glycosylation sites with the consensus N-X-S/T sequence: amino adds 5-7 (N-A-T), amino adds 55-57 (N-V-T), amino adds 185-187 (N-I-T) and amino adds 223-225 (N-K-T). Qone B2 encodes a partial sequence of a Bermuda grass pollen allergen. The partial protein encoded by done B2 was found to be related to polygalacturonase 2A precursor from Lycopersicon esadentum (tomato). Fig. 9 shows the homology between the deduced amino add sequence of done B2 and polygalacturonase 2A precursor from L. esadentum The partial B2 protein sequence has 42.9% homology with polygalacturonase 2A precursor (33.2% identity, 9.7% similarity). This homology was demonstrated by scanning the Swiss-Prot protein data base with the FSTPSCAN program and using the PALIGN program. Both programs are contained in the PCGENE software package (Intelligenetics, Mountain View, CA).

Fragments of nucleic add sequences coding for allergens of the spedes

Cynodon dactylon are also within the scope of the invention. Fragments within the scope of the invention include those coding for portions of Cynodon dactylon which induce immune response in mammals, preferably humans, such as stimulation of minimal amounts of IgE binding of IgE; elidting the production of IgG and IgM antibodies; elidting a T cell response such as T cell proliferation and/or lymphokine secretion and/or the induction of T cell anergy. The foregoing fragments of a protein allergen of the spedes Cynodon dactylon are referred to herein as antigenic fragments. Fragments within the scope of the invention also include those capable of hybridizing with a nudeic add sequence from other plant spedes for use in screening protocols to detect allergens which are cross-reactive with a protein allergen of the spedes Cynodon dactylon. As used herein, a fragment of a nudeic add sequence coding for a protein allergen of the spedes Cynodon dactylon refers to a nudeotide sequence having fewer bases than the nudeotide sequence coding for the entire amino add sequence of a protein allergen of the spedes Cynodon dactylon and/or mature Cynodon dactylonprotεm allergen. Generally, a nudeic acid sequence encoding a fragment or fragments of protein allergens of the spedes Cynodon dactylonvnϋ be selected from the bases coding for the mature protein. However, in some instances, it may be desirable to select all or a part of a fragment or fragments from the leader sequence portion of the nudeic add sequence of the invention. Nudeic add sequences of the invention may also contain linker sequences, restriction endonudease sites and other sequences useful for cloning, expression or purification of Cynodon dactylon allergens or fragments thereof. The present invention provides expression vectors and host cells transformed to express nudeic add sequences of the invention. A nudeic add sequence encoding a Bermuda grass pollen allergen, or at least one fragment thereof can be expressed in a bacterial cell such as E. coli, insect cells, yeast, or mammalian cells such as Chinese hamster ovary cells (CHO). Suitable expression vectors, promoters, enhancers, and other expression control elements can be found in Sambrook et al, Molecular doning: A Laboratory Manual, second edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989. Expression in yeast, insect or mammalian cells would lead to partial or complete glycosylation of the recombinant material and formation of any inter- or intra- chain disuffide bonds, if such exist Suitable vectors for expression in yeast include YepSecl (Baldari et al., (1987) Embo J.6: 229-234); pMFa (Kurjan and Herskowitz (1982) CeU20: 933-943); and JRY88 (Schultz et al., (1987) Gene 54: 113-123).

For expression in E. coli, suitable expression vectors include pTRC (Amann et al., (1988) Gene 69: 301-315); pGEX (Amrad Corp., Melbourne, Australia); pMAL (RE. Biolabs, Beverly, MA); pRIT5 (Pharmacia, Piscataway, NJ); and pSEM (Knapp et al. (1990) BioTechniques 8: 280-281). The use of pTRC and pETlld (Novagen, Madison, WI; Jameel et al., J.Virol.64: 3963-3966 (1991)) will lead to the expression of an unfused protein . The use of pMAL, pRIT5, pSEM, and pGEX will lead to the expression of an allergen fused to maltose E binding protein (pMAL), protein A (pRIT5), truncated β-galactosidase (pSEM) or glutathione S-transferase (pGEX). When a Bermuda grass pollen allergen or fragment thereof is expressed as a fusion protein, it is particularly advantageous to introduce an enzymatic deavage site at the fusion junction between the carrier protein and the allergen or fragment thereof. The protein allergen or fragment thereof may then be recovered from the fusion protein through enzymatic cleavage at the enzymatic site and biochemical purification using conventional techniques for purification of proteins and peptides. Suitable enzymatic deavage sites indude those for blood dotting Factor Xa or thrombin for which the appropriate enzymes and protocols for deavage are commercially available from, for example, Sigma Chemical Company, St Louis, MO and N E. Biolabs, Beverly, MA Host cells can be transformed to express nudeic add sequences 'of the invention using conventional techniques such as caldum phosphate or caldum chloride co-precipitation, DEAE-dextran-mediated transfection, or electroporation. Suitable methods for transforming the host cells may be found in Sambrook et al., supra, and other laboratory textbooks. The present invention also provides methods for producing a Bermuda grass pollen allergen or at least one fragment thereof. According to one method, a host cell transformed with a DNA sequence encoding all or a portion of a Bermuda grass pollen allergen is cultured in an appropriate medium to produce a mixture of cells and medium containing the protein allergen or fragment thereof. The mixture is then purified to produce substantially pure protein allergen or a fragment thereof. A Bermuda grass pollen allergen and fragments thereof can be purified from cell culture medium, host cells, or both using techniques known in the art for purifying peptides and proteins including ion-exchange chromatography, gel filtration chromatography, ultrafiltration, electrophoresis and immunopurification with antibodies specific for a Bermuda grass pollen allergen or fragments thereof. According to another method, isolated Bermuda grass pollen allergen or at least one fragment thereof can be synthesized chemically using techniques known in the art The terms isolated and purified are used interchangeably herein and refer to peptides, protein, protein fragments, and nucleic add sequences substantially free of cellular material or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when synthesized chemically or when purified from pollen.

Fragments of a protein allergen from Bermuda grass pollen can be obtained, for example, by screening peptides synthesized from the corresponding fragment of a nudeic add sequence of the invention coding for such peptides or synthesized chemically using techniques known in the art Peptide fragments of the allergen may be obtained by any method known in the art such as chemical cleavage of the allergen, arbitrary division of the allergen into fragments of a desired length with no overlap of the peptides, or preferably division of the allergen into overlapping fragments of a desired length. The fragments can be tested to determine antigenidty (e.g., the ability of the fragment to induce an immune response). Such fragments are referred to herein as antigenic fragments. Fragments of Bermuda grass protein allergens which are capable of elidting a T cell response such as stimulation (i.e., proliferation or lymphokine secretion) and/or are capable of indudng T cell anergy are particularly desirable. Fragments of protein allergens which do not bind immunoglobulin E (IgE) or bind IgE to a substantially lesser extent than the protein allergen from which the fragments are derived binds IgE are also particularly desirable. The major complications of standard immunotherapy are systemic responses such as anaphylaxis. Immunoglobulin E is a mediator of anaphylactic reactions which result from the binding and cross-linking of antigen to IgE on mast cells or basophils and the release of mediators (e.g., histamine, serotonin, eosinophil, chemotactic factors). Thus, anaphylaxis could be avoided by the use of a fragment which does not bind IgE, or if the fragment binds IgE, such binding does not result in the release of mediators (e.g., histamine etc.) from mast cells or basophils. In addition, fragments which have minimal IgE stimulating activity are particularly desirable for therapeutic effectiveness. Minimal IgE stimulating activity refers to IgE stimulating activity which is less than the amount of IgE production stimulated by the whole Bermuda grass protein allergen.

Protein allergens from Bermuda grass pollen and preferred antigenic fragments thereof, when administered to a Bermuda grass pollen-sensitive individual, are capable of modifying the allergic response of the individual to the allergen, and preferably are capable of modifying the B cell, the T cell response or both the B cell and the T cell response of the individual to the allergen. As used herein, modification of the allergic response of an individual sensitive to a Bermuda grass pollen allergen can be defined as non-responsiveness or diminution in symptoms to the allergen, as determined by standard clinical procedures (See e.g., Varney et al., British Medical Journal 302: 265-269 (1990)). Initial screening for IgE binding to a protein allergen or fragments thereof may be performed by scratch tests or intradeπnal skin tests on laboratory animals or human volunteers, or in in vitro systems such as RAST (radioallergosorbent test), RAST inhibition, ELISA assay or radioimmunoassay (RIA). -

Antigenic fragments of the present invention which have T cell stimulating activity, and comprise at least one T cell epitope are particularly desirable. T cell epitopes are believed to be involved in initiation and perpetuation of the immune response to a protein allergen which is responsible for the clinical symptoms of allergy. These T cell epitopes are thought to trigger early events at the level of the T helper cell by binding to an appropriate HLA molecule on the surface of an antigen presenting cell and stimulating the relevant T cell subpopulation.

These events lead to T cell proliferation, lymphokine secretion, local inflammatory reactions, recruitment of additional immune cells to the site, and activation of the B cell cascade leading to production of antibodies. One isotype of these antibodies, IgE, is fundamentally important to the development of allergic symptoms and its production is influenced early in the cascade of events, at the level of the T helper cell, by the nature of the lymphokines secreted. A T cell epitope is the basic element or smallest unit of recognition by a T cell receptor, where the epitope comprises amino adds essential to receptor recognition and may be contiguous and/or non-contiguous in the amino add sequence of the protein. Amino add sequences which mimic those of the T cell epitopes and which modify the allergic response to protein allergens are within the scope of this invention.

Exposure of patients to antigenic fragments of the present invention derived from protein allergens may tolerize or anergize appropriate T cell subpopulations such that they become unresponsive to the protein allergen and do not participate in stimulating an immune response upon such exposure. In addition, administration of an antigenic fragment of the present invention may modify the lymphokine secretion profile as compared with exposure to the nattirally-occurring protein allergen or portion thereof (e.g., result in a decrease of IL-4 and/or an increase in IL-2). Furthermore, exposure to the antigenic fragment may influence T cell subpopulations which normally partidpate in the response to the allergen such that these T cells are drawn away from the site(s) of normal exposure to the allergen (e.g., nasal mucosa, skin, and lung) towards the site(s) of therapeutic administration of the fragment. This redistribution of T cell subpopulations may ameliorate or reduce the ability of an individual's immune system to stimulate the usual immune response at the site of normal exposure to the allergen, resulting in a diminution in allergic symptoms.

Bermuda grass protein allergens and fragments or portions derived therefrom (peptides) can be used in methods of diagnosing, treating and preventing allergic reactions to Bermuda grass pollen. Thus, the present invention provides therapeutic compositions comprising an isolated Bermuda grass pollen allergen or at least one fragment thereof and a pharmaceutically acceptable carrier or diluent The Bermuda grass pollen allergen or at least one fragment thereof is preferably produced in a mast cell transformed to express the protein allergen or the fragment thereof or is synthetically prepared. Administration of the therapeutic compositions of the present invention to an individual to be desensitized can be carried out using known techniques. Bermuda grass pollen allergen or a fragment thereof can be administered to an individual in combination with, for example, an appropriate diluent, a carrier and/or an adjuvant Pharmaceutically acceptable diluents include saline and aqueous buffer solutions. Pharmaceutically acceptable carriers include polyethylene glycol (Wie et al. (1981) Int. Arch. Allergy Appl. Immunol.64:84-99) and liposomes (Strejan et al. (1984) /. Neuroimmimol. 7: 27). Such compositions will generally be administered by injection, oral administration, inhalation, transdermal application or rectal administration. The therapeutic compositions of the invention are administered to Bermuda grass pollen-sensitive individuals at dosages and for lengths of time effective to reduce sensitivity (i.e, reduce the allergic response) of the individual to Bermuda grass pollen. Effective amounts of the therapeutic compositions will vary according to factors such as the degree of sensitivity of the individual to Bermuda grass pollen, the age, sex, and weight of the individual, and the ability of the Bermuda grass pollen allergen or fragment thereof to elidt an antigenic response in the individual. cDNA coding for a Bermuda grass pollen allergen (or the mRNA from which it was transcribed) or a portion thereof can be used to identify similar sequences in any variety or type of plant and thus, to identify or "pull out" sequences which have suffident homology to hybridize to the cDNA of the protein allergen or mRNA or portion thereof. For example, cDNA of the present invention may hybridize to DNA from temperate grasses such as rye-grass, Kentucky Blue grass, Timothy grass and orchard grass, and from other grasses such as Bahia grass and sorghum, under conditions of low stringency. Those sequences which have suffident homology (generally greater than 40%) can be selected for further assessment using the method described herein. Alternatively, high stringency conditions can be used. In this manner, DNA of the present invention can be used to identify, in other types of plants, preferably related families, genera, or spedes, sequences encoding polypeptides having amino add sequences similar to that of a Bermuda grass pollen allergen, and thus to identify allergens in other species. Thus, the present invention includes not only Bermuda grass allergens, but also other allergens encoded by DNA which hybridizes to DNA of the present invention. The invention further includes protein allergens or fragments thereof which are immunologically related to a Bermuda grass protein allergen or fragments thereof, such as by antibody cross-reactivity, wherein the protein allergens or fragments thereof are capable of binding to antibodies specific for the Bermuda grass pollen protein or fragments of the invention.

Proteins or peptides encoded by the cDNA of the present invention can be used, for example as "purified" allergens. Such purified allergens are useful in the standardization of allergen extracts which are key reagents for the diagnosis and treatment of sensitivity to a Bermuda grass pollen allergen. Furthermore, by using proteins or fragments thereof based on the nudeic add sequences of dones Bl, B2 and B4, anti-peptide antisera, polyclonal antibodies or monoclonal antibodies can be made using standard methods. These sera or polyclonal or monoclonal antibodies can be used to standardize allergen extracts and/or used in purification of native or recombinant protein allergens.

Through use of the Bermuda grass pollen proteins and antigenic fragments of the present invention, preparations of consistent, well-defined composition and biological activity can be made and administered for therapeutic purposes (e.g. to modify the allergic response of a Bermuda grass pollen-sensitive individual. Administration of such peptides or protein may, for example, modify B-cell response to Bermuda grass protein allergen, T cell response to a Bermuda grass protein allergen or both responses. Purified peptides can also be used to study the mechanism of immunotherapy of Bermuda grass pollen allergy and to design modified derivatives or analogues useful in immunotherapy.

It is possible to modify the structure of the protein allergens or fragments thereof of the invention, for such purposes as increasing solubility, enhancing therapeutic or preventive efficacy, or stability (e.g., shelf life ex vivo, and resistance to proteolytic degradation in vivo). A modified protein allergen or a modified fragment thereof can be produced in which the amino add sequence has been altered, such as by amino add substitution, deletion, or addition, to modify immunogenidty and/or reduce allergenidty, or to which a component has been added for the same purpose. For example, the amino add residues essential to T cell epitope function can be determined using known techniques (e.g., substitution of each residue and determination of presence or absence of T cell reactivity). Those residues shown to be essential can be modified (e.g., replaced by another amino add whose presence is shown to enhance T cell reactivity), as can those which are not required for T cell reactivity (e.g., by being replaced by another amino add whose incorporation enhances T cell reactivity but does not diminish binding to relevant MHC). In order to enhance stability and/or reactivity, a protein allergen or fragment thereof can also be modified to incorporate one or more polymorphisms in the amino add sequence of a protein allergen resulting from natural allelic variation. Additionally, D-amino adds, non- natural amino adds or non-amino add analogues can be substituted or added to produce a modified protein or fragment within the scope of this invention. Furthermore, protein allergens or fragments can be modified using the polyethylene glycol (PEG) method of A Sehon and co-workers (Wie et al. supra) to produce a peptide conjugated with PEG. Modifications of protein allergens or fragments thereof can also indude reduction/alkyiation (Tarr in: Methods of Protein Microcharacterization, JJΞ. Silver ed. Humana Press, Clifton, NJ, pp 155- 194 (1986)); acylation (Tarr, supra),' esterification (Tarr, supra); chemical coupling to an appropriate carrier (Mishell and Shiigi, eds, Selected Methods in Cellular Immunology WH Freeman, San Francisco, CA (1980); U.S. Patent 4,939,239); or mild formalin treatment (Marsh International Archives of Allergy and Applied Immunology All 199-215 (1971)).

Site-directed mutagenesis of DNA encoding a protein allergen or fragment thereof can be used to modify the structure. Such methods may involve PCR (Ho et al., Gene 77:51-59 (1989)) or total synthesis of mutated genes (Hostomsky, Z., et al., Biochem. Biophys. Res. Comrn. 1611056-1063 (1989)). To enhance bacterial expression, the aforementioned methods can be used in conjunction with other procedures to change the eucaryotic codons in DNA constructs encoding recombitope peptides to ones preferentially used in E. coll

Using the structural information now available, it is possible to design Bermuda grass protein allergen peptides which, when administered to a Bermuda grass pollen sensitive individual in suffident quantities, will modify the individual's allergic response to Bermuda grass pollen. This can be done, for example, by examining the structure of a Bermuda grass pollen allergen or peptide such as those partially or fully encoded for by clones Bl, B2 and B4, produdng peptides (via an expression system, synthetically or otherwise) to be examined for their ability to influence B cell and/or T cell responses in Bermuda grass pollen sensitive individuals and selecting appropriate B or T cell epitopes recognized by the cells. Protein, peptides or antibodies of the present invention can also be used for detecting and diagnosing sensitivity to Bermuda grass pollon allergens. For example, this could be done by combining blood or blood products obtained from an individual to be assessed for sensitivity to Bermuda grass pollen with an isolated antigenic fragment of a Bermuda grass pollen allergen, or isolated Bermuda grass pollen allergen, under conditions appropriate for binding of components (e.g., antibodies, T cells, B cells) in the blood with the fragments) or protein and determining the extent to which such binding occurs.

It is now also possible to design an agent or a drug capable of blocking or inhibiting the ability of Bermuda grass pollen allergen to induce an allergic reaction in Bermuda grass pollen sensitive individuals. Such agents could be designed, for example, in such a manner that they would bind to relevant anti- Bermuda grass protein allergen-IgE's, thus preventing IgE-allergen binding and subsequent mast cell degranulation. Alternatively, such agents could bind to cellular components of the immune system, resulting in suppression or desensitization of the allergic response to Bermuda grass pollen allergens. A non- restrictive example of this is the use of appropriate B and T cell epitope peptides, or modifications thereof, based on the cDNA/protein structures of the present invention to suppress the allergic response to Bermuda grass pollen. This can be carried out by defining the structures of B- and T cell epitope peptides which affect B and T cell function in in vitro studies with blood components from Bermuda grass pollen sensitive individuals. The DNA used in any embodiment of this invention can be cDNA obtained as described herein, or alternatively, can be any oligodeoxynudeotide sequence having all or a portion of a sequence represented herein, or their functional equivalents. Such oligodeoxynudeotide sequences can be produced chemically or mechanically, using known techniques. A functional equivalent of an oligonudeotide sequence is one which is capable of hybridizing to a complementary oligonudeotide to which the sequence (or corresponding sequence portions) of Fig. 3, Fig. 5, or Fig. 8 or fragments thereof hybridizes, or the sequence (or corresponding sequence portion) complementary to the nudeic add sequences of Fig. 3, Fig. 5, or Fig. 8, and/or which encodes a product (e.g., a polypeptide or peptide) having the same functional characteristics of the product encoded by the sequence (or corresponding sequence portion) of Fig. 3, Fig. 5, or Fig. 8. Whether a functional equivalent must meet one or both criteria will depend on its use (e.g., if it is to be used only as an oligoprobe, it need meet only the first criterion and if it is to be used to produce a Cynodon dactylon allergen, it need only meet the second criterion).

This invention is further illustrated by the following non-limiting examples.

Example 1 Characterization and isolation of cDNA clones encoding Bermuda grass pollen allerg ns

Pollen of Bermuda grass, Cynodon dactylon, was purchased from Greer

Laboratories, Lenoir, NC, USA. Bermuda grass inflorescence containing near mature anthers were collected in Melbourne and used as a source of fresh pollen.

Soluble proteins were extracted from rye-grass pollen by vigorous shaking in PBS (150 mM NaCl, pH 12) containing ImM PMSF on ice for 3 hours.

Conditions for electrophoresis and immunoblotting were essentially as described (Singh, M.B., and Knox, RB., Int. Archs. Allergy Appl. Immun.78:

300-304 (1985). For IgE antibody binding, blots were incubated in serum from an individual allergic to Bermuda grass pollen , diluted 1:5 in TBS/0.5% w/v

BSA. The bound IgE was detected (Ford, D., and Baldo, B A., Int. Archs.

Allergy Appl. Immun.81: 193-203 (1986), using ^I-labelled anti-human IgE (Kallestad, USA).

Western blots were made from Bermuda grass pollen extract separated by

SDS-PAGE and incubated in grass pollen -allergic patient's serum (Figure 1).

The components in the pollen extract bind IgE, of which five bands show a particularly intense reaction. These are assumed to be major allergens. The five bands show apparent molecular weights of 17,30,32,45 and 55 kDA (Figure

1). Poly (A⁺) mRNA was isolated essentially as described (Herrin, D. and Michaels, F B., Plant Mol. Bid. Reporter 2: 24-29 (1984)). cDNA was synthetized (Gubler, U. and Hoffman, BJ., GenelS: 263-367 (1983)) and cloned into the EcoRl site of the vector 1-gtll. Immunological screening was done by plating the cDNA library, and screening duplicate filters with IgE from the serum of allergic individuals. Bound IgE was detected as above. The plaques which were IgE-positive on both of the duplicate filters were picked off and purified. The cDNA library was screened with IgE antibodies from allergic patient's serum KR. The serum used was from a single patient (KR) who showed strong reactivity to Bermuda grass and rye-grass pollen samples. No patient's sera showed IgE binding only to Bermuda grass in the samples tested to date. Three dones were positive, Bl, B2 and B4. Of these three dones, the fusion proteins of Bl and B4 bound IgE more strongly than B2 (Figure 2).

The sizes of the cDNA inserts of these dones were as follows: Bl, 468 base pairs (bp); B2, 997bp; B4429bp.

The cDNA dones Bl, B2, and B4 were isolated from the phage, subdoned into pGEM-3Z vectors (Promega) and sequenced. DNA sequencing of the inserts of dones Bl and B4 was performed using T7 DNA polymerase and dideoxy nudeotide termination reactions (Sander el aL, Pmc. Natl. AraH <^gή LISA 24; 5460-5463, 1977). ^S] dATP was used as the label (See Fig. 3 and Fig. 5). DNA sequencing of the EcoRl insert in clone B2 was performed using standard dideoxy nudeotide termination reactions containing 7-deaza dGTP. 7-deaza dITP was used, if necessary, to resolve severe GC band compressions. [^JdATP was used as the label (See Fig. 8). Example 2 Production of fusion protein from done Bl

The protein encoded by done Bl was expressed as a fusion with b- galactosidase. Lambda-gtll containing done Bl cDNA inserts in E. coli were plated onto Luria-Bertani (LB) plates. After three hours growth at 42°C, the plates were overlayed with isopropyl-b-D-thiogalacto-pyranoside (IPTG) impregnated nitrocellulose filters (Hybond-C extra, Amersham) in order to induce production of fusion protein. The plates were then incubated for four hours at 37°C, after which the filters were inverted and left for an additional four hours to enable the transfer of recombinant b-gal-Bl fusion protein to the nitrocellulose. These protein plaque lifts were incubated in 10% milk powder in phosphate buffered saline (PBS), to block unreacted binding sites.

Example 3 Production of pGEX-B2 fusion protein

The cDNA clone B2 was subdoned into the pGEX plasmid expression system. The expression of the protein as a fusion with glutathione S- transferase (GST) was carried out according to the procedure outlined by Smith and Johnson, Gene 67: 31-40 (1988). Overnight cultures of E. cotø with recombinant pGEX-B2 plasmid were diluted 1:10 in fresh Luria broth and grown for 1 hour at 37°C with vigorous shaking. Fusion protein production was induced by adding IPTG to a final concentration of 0.1 mM. The cells were grown for a further 4-5 hours after which they were pelletted and resuspended in PBS (150mM NaCl, 16mM Na_jHPO.,, 4mM NaHPθ₄, pH 12). The cells were lysed by subjecting the mixture to 3 freeze-thaw cydes in liquid nitrogen and the supernatant containing the GST-B2 fusion protein collected after centrifugation. The supernatant containing the GST-B2 fusion protein was applied to the

Superdex 75 HR 10\30 column (Pharmada LKB, Sweden). The sample was eluted from the column with 50 mM PBS containing 0.02% sodium azide, at a constant flow rate of lml/min at room temperature (RT). The fractions containing the fusion protein were identified by dotting 5ml of each fraction onto nitrocellulose membrane (BA 0.45mm, Schleicher and Schuell, Dassel, Germany) and screening with sera from allergic patients for binding of specific IgE. The protein was concentrated using minicon Ultrafree-MC lOOOONM WL filter unit (Millipore). Example4 Immnnoblot Analysis and the production of polyclonal and monoclonal antibodies

Soluble proteins were extracted from Bermuda grass pollen by vigorous shaking in PBS (15mM NaCl, pH 7.2) on ice for 3 hours. Proteins were separated on 12% polyacrylamide gels using the Biorad mini Protean II system. The gels were either stained with Coomassie brilliant blue to visualize proteins or the proteins were transferred to nitrocellulose as according to the method described by Towbin et al, Proc. Nat. Acad. Sci. USA, 76: 4350,4354 (1979). Unreacted binding sites on these Western blots were blocked by incubation in 10% milk powder for at least one hour.

A Screening with pnlyclnnfll anrihnrite .

Mouse antibodies specific for B2 antigens were prepared by immunizing female BALB/c mice with an intraperitoneal (i.p.) injection of 50mg of FPLC purified GST-B2 fusion protein in 0.1ml PBS and 0.1ml RIBI adjuvant Fourteen days later a booster i.p. of the same material was given. After 10 days the mice were bled. The serum was screened for binding to dot blots of GST-B2 protein. Fourteen days later, the selected mice were given an i.p. booster of 02ml containing 50mg fusion protein only. Four days after the last immunization the mouse was bled. Serum was obtained by incubation at 37°C for 1 hour followed by centrifugation at 2500 rpm for 10 minutes. Polydonal antibodies will be generated against the proteins or peptides partially or fully encoded by the nudeic add sequences of dones Bl and B4 using the same method. Western blots were incubated with the antibodies obtained above, for 3 hours at room temperature (RT). These blots were washed twice in PBS containing 0.1% Tween-20, twice in PBS, then incubated in peroxidase labelled-anti-mouse Ig for one hour at RT. This was followed by washing and color development as described by Singh, M.B. and Knox, R.B., Int. Archs. Allergy Appl. Immun.78: 300-304 (1985). Results are shown in Fig. 10. Figure 8 illustrates Western blots of Bermuda grass pollen proteins probed with (a) 1/100 dilution of clone B2 spedfic antiserum. (b) 1/250 dilution of clone B2 specific antiserum. (c) Serum of an allergic individual (d) soluble Bermuda grass pollen proteins separated by SDS-PAGE. The clone B2 specific antiserum recognizes a protein with MW of approximately 61kD. This protein binds IgE from serum of an allergic individual. Monoclonal antibodies will be raised against the proteins or peptides partially or fully encoded by the nucleic add sequences of clones Bl, B2 and B4. The spleen cells are being collected from mice selected as above four days after the boostering injection. B cells in the spleen will be fused with a suitable myeloma fusion partner using standard methodology (Harlow, E, and Lane D., Antibodies. A Laboratory Manual. Cold Spring Harbor Laboratory, New York (1988)).

B. Screening with human serum or affinity purified TgE Six b-gal-Bl fusion protein plaque lifts and non-recombinant 1-gtll protein plaque lifts (as control) were prepared as described above. These protein plaque lifts were incubated overnight in serum from an individual allergic to Bermuda grass pollen, washed twice with PBS containing 0.1% Tween 20 and then twice with PBS only. The bound IgE antibodies were eluted with 0.1 M glydne-HQ, pH 2.6/1% BSA and used as affinity purified IgE to probe Western blots. Western blots were incubated in sera from allergic individuals or in affinity purified IgE overnight at RT. IgE binding was deteded by incubation of the blot in ^I-labelled anti-human IgE overnight at RT and autoradiography, or by incubation in rabbit anti-human IgE followed by incubation in peroxidase labelled anti-rabbit Ig and color development as described above. Results are shown in Fig. 4.

Figure 4, columns b-d illustrate Western blots of Bermuda grass pollen proteins separated by SDS-PAGE and probed with (b) IgE affinity purified from non-recombinant Lambda-gtll. (c) IgE affinity purified from clone Bl fusion protein, (d) serum after incubation with Bl protein plaque lifts, (e) serum before incubation with Bl protein plaque lifts (total serum). After incubation of Bl protein plaque lifts in serum, IgE specific to a protein with MW 12kD is depleted from the serum. IgE affinity purified from Bl fusion protein is specific for the same protein. This protein is indicated by the arrow.

Example 5 IgE Binding Studies with Recombinant Bl_r B2 and B4 clones

The sera of 12 patients that bound strongly to crude extracts of Cynodon dactylon pollen were tested for binding to recombinant Bl, B2 and B4 clones expressed as a fusion protein. The results demonstrate that nine of 12 C. dactylon allergic patients that have antibodies binding to C. dactylon pollen crude extract on a Western blot of an SDS-PAGE gel have IgE antibody that binds to dones Bl and B4 as a fusion protein. Six of 12 C. dactylon allergic patients that have antibodies binding to C. dactylon pollen crude extract on a Western blot of an SDS-PAGE gel have IgE antibody that binds to clone B2 as a fusion protein. These results are shown in Table 1.

Table 1. Allergenicity of Bl, B2, and B4 clones

ALLERGEN CLONE IgE BINDING % POSITIVE

Bl 9/12 75%

B2 6/12 50%

B4 9/12 75%

Example 6 Qoning a mil-length Cyn d allergen containing the sequence of B2 clone

Double-stranded cDNA is synthesized from approximately 4 mg pollen RNA using the cDNA Synthesis System Plus kit (BRL, Bethesda, MD). After a phenol extraction and ethanol precipitation, the cDNA is blunted with T4 DNA polymerase (Promega, Madison, WI), and ligated to ethanol precipitated, self- annealed, AT, 5' GGGTCTAGAGGTACCGTCCGATCGATCATT, and AL 5' p-AATGATCGATGCT, oligonucleotides for use in a modified Anchored PCR reaction (Marsh et al., Allergen Nomenclature Bull. WΗ.0 64: 767-770 (1986); Roux and Dhanarajan, Biotech. 8: 48-57(1990); Rafnar et al., J. Bid. Chem.266 linkered cDNA (5 ml) from a 20 ml reaction with 1 mg each of oligonucleotides AP, 5' GGGTCTAGAGGTACCGTCCG, and a primer CD-I, 5' TGGTCACGTTGGAGGAGT, which is based on B2 sequence. The primary polymerase chain reactions (PCR) is carried out in a programmable thermal controller from MJ Research, Inc. (Cambridge, MA) using the GeneAMP DNA Amplification kit (Perkin Elmer Cetus, Norwalk, CT) in a reaction containing 10 ml lOx buffer containing dNTPs mixed with 1 mg of each primer, cDNA, 0.5 ml Amplitaq DNA polymerase, and distilled water to 100 ml. Twenty-five rounds of amplification consisting of denaturation at 94°C for 1 minute, annealing of primers to the template at 60°C for 1.5 minutes, and chain elongation at 72°C for 2 minutes is carried out Five percent (5 ml) of this primary amplification is then used in a secondary amplification with 1 mg each of CD-2, 5' GGGGATCCGGTGATGTCTTTGCACTT, a nested oligonudeotide primer based on known B2 sequence, and AP, as above. Oligonudeotide primers AP, AT and AL have been previously described (Rafnar et al., 1991, supra, Morgenstem et al., Proc. Natl.Acad. Sci. USA8S: 9690-9694; Griffith et al., FEBS Lett.279 (199): 215 (1991); Rogers et al., /. Immul.147: 2547-2552 (1991).

Amplified DNA is recovered by sequential chloroform, phenol, and chloroform extractions, followed by predpitation at ^'20°C with 0.5 volumes of 7.5 ammonium acetate and 1.5 volumes of isopropanol. After predpitation and washing with 70% ethanol, the DNA is simultaneously digested with Xba and Bam HI in a 15 ml reaction and electrophoresed through a preparative 3% SeaPlaque low melt agarose (FMC Corp., Rockland, ME). The appropriate sized DNA band is visualized by ethidium bromide (EtBr) staining, excised, and ligated into appropriately digested M13mpl9 dideoxy DNA sequencing (Sanger et al., supra) with the Sequenase kit (U.S. Biochemicals, Cleveland, OH).

Full-length cDNA sequences comprising the cDNA sequences of clones Bl and B4 which full-length sequences encode Bermuda grass pollen protein allergens are being elucidated using PCR methodology as described for clone B2 above. Nested oligonudeotide primers based on the non-coding strand sequence complementary to the nudeotide sequences given in Figs. 3 and 5 will be used with oligonudeotide primer AP to amplify full-length clones from AT/AL linkered cDNA derived from Cynodon dactylon RNA

Alternatively, double stranded or single stranded probes will be prepared from all or a portion of the nudeotide sequence of clones Bl, B2 or B4 (see Figs. 3, 5, and 8). These probes will be used to probe a library, for example a lgtlO or lgtll library, to identify homologous clones. Selected clones will be sequenced as described to identify full-length clones for Bl, B2 and B4. Specific probes will be generated and the libraries will be screened using standard procedures (Smart et al., supra).

Although the invention has been described with reference to its preferred embodiments, other embodiments can achieve the same results. Variation and modifications to the present invention will be obvious to those skilled in the art and it is intended to cover in the appended claims all such modifications and equivalents that follow in the true spirit and scope of this invention.

Claims

1. A nudeic acid sequence coding for a protein allergen of the species Cynodon dactylon, or at least one antigenic fragment thereof or the functional equivalent of said nudeic add sequence.

2. The nucleic acid sequence of daim 1 comprising a nucleic acid sequence selected from the group consisting of the nudeic acid sequence of Clone Bl as shown in Fig.3, the nucleic add sequence of Clone B4 as shown in Fig.5, and the nucleic acid sequence of Clone B2 as shown in Fig. 8.

3. An expression vector comprising the nucleic acid sequence of claim 1.

4. An expression vector of daim 3 wherein said nudeic acid sequence is selected from the group consisting of the nudeic add sequence of Qone Bl as shown in Fig.3, the nudeic add sequence of Qone B4 as shown in Fig.5, and the nudeic add sequence of Qone B2 as shown in Fig. 8.

5. A host cell transformed to express a protein or peptide encoded by the nudeic add sequence of daim 1.

6. A host cell transformed to express a protein or peptide encoded by the nudeic add sequence of daim 2.

7. An isolated protein allergen of the spedes Cynodon dactylon oτ at least one antigenic fragment thereof.

8. The isolated protein allergen or antigenic fragment of claim 7 produced in a host cell transformed with the nucleic acid sequence of claim 1.

9. The isolated protein allergen or antigenic fragment of claim 7, produced in a host cell transformed with the nucleic add sequence of claim 2.

10. A method of produdng a protein allergen of the spedes Cynodon dactylon or at least one antigenic fragment thereof comprising, culturing a host cell transformed with a nucleic acid sequence encoding a protein allergen of the spedes Cynodon dactylonor antigenic fragment thereof in an appropriate medium to produce a mixture of cells and medium containing said protein allergen or antigenic fragment thereof; and purifying said mixture to produce substantially pure protein allergen of the spedes Cynodon dactylon or fragment thereof.

11. An isolated protein allergen of the spedes Cynodon dactylon comprising an amino add sequence selected from the group consisting of the amino add sequence of done Bl as shown in Fig. 3, the amino add sequence of clone B4 as shown in Fig. 5, and the amino add sequence of done B2 as shown in Fig. 8, or at least one isolated antigenic fragment thereof.

12. An antigenic fragment of daim 7 which has T cell stimulating activity.

13. An antigenic fragment of daim 11 which has T cell stimulating activity.

14. An antigenic fragment of claim 13 which has minimal immunoglobulin E stimulating activity.

15. An antigenic fragment of daim 13 which does not bind immunoglobulin E specific for a protein allergen of the spedes Cynodon dactylon or if binding of the fragment to said immunoglobulin E occurs, such binding does not result in histamine release from mast cells or basophils.

16. An isolated antigenic fragment of claim 13 which binds immunoglobulin E to a substantially lesser extent than the protein allergen from which the fragment is derived binds said immunoglobulin E.

17. An isolated protein allergen or antigenic fragment of claim 7 which modifies, in a Bermuda grass pollen-sensitive individual to which it is administered, the allergic response of the individual to a Bermuda grass pollen allergen.

18. An isolated protein allergen or antigenic fragment of claim 11 which modifies, in a Bermuda grass pollen-sensitive individual to which it is administered, the allergic response of the individual to a Bermuda grass pollen allergen.

19. An isolated protein allergen or antigenic fragment of claim 17 which modifies the B cell response of the individual to a Bermuda grass pollen allergen, the T cell response of the individual to a Bermuda grass pollen allergen, or both the B cell response and the T cell response of the individual to a Bermuda grass pollen allergen.

20. An isolated protein allergen or antigenic fragment of daim 18 which modifies the B cell response of the individual to a Bermuda grass pollen allergen, the T cell response of the individual to a Bermuda grass pollen allergen, or both the B cell response and the T cell response of the individual to a Bermuda grass pollen allergen.

21. A modified protein allergen of Bermuda grass pollen which, when administered to a Bermuda grass pollen sensitive individual, reduces the allergic response of the individual to a Bermuda grass pollen allergen.

22. A modified protein allergen of claim 21 wherein the protein allergen that is modified comprises an amino add sequence selected from the group consisting of the amino acid sequence of clone Bl as shown in Fig. 3, the amino add sequence encoded by done B4 as shown in Fig. 5, and the amino acid sequence encoded by clone B2 as shown in Fig. 8.

23. At least one modified fragment of a protein allergen of Bermuda grass pollen which, when administered to a Bermuda grass pollen-sensitive individual, reduces the allergic response encoded by the individual to said protein allergen.

24. At least one modified fragment of a protein allergen of daim 25 wherein said protein allergen comprises an amino acid sequence seleded from the group consisting of the amino add sequence encoded by done Bl as shown in Fig. 3, the amino acid sequence encoded by clone B4 as shown in Fig. 5, and the amino add sequence encoded by done B2 as shown in Fig. 8.

25. An isolated protein allergen or antigenic fragment thereof which is immunologically cross-reactive with a protein allergen of Bermuda grass pollen, said protein allergen of Bermuda grass pollen comprising an amino add sequence selected from the group consisting of the amino add sequence encoded by done Bl as shown in Fig. 3, the amino add sequence encoded by done B4 as shown in Fig. 5, and the amino add sequence encoded by clone B2 as shown in Fig. 8.

26. A therapeutic composition comprising a protein allergen of Bermuda grass pollen, or at least one fragment thereof and a pharmaceutically acceptable carrier or diluent.

27. A therapeutic composition of claim 26 wherein the protein allergen comprises an amino add sequence seleded from the group consisting of the amino acid sequence encoded by clone Bl as shown in Fig. 3, the amino add sequence encoded by done B4 as shown in Fig. 5, and the amino add sequence

SUBSTI encoded by done B2 as shown in Fig. 8.

28. A method of treating sensitivity in an individual to a protein allergen of Bermuda grass pollen, comprising administering to said individual a therapeutically effective amount of a therapeutic composition of claim 26.

29. A method of treating sensitivity to in an individual to Bermuda grass pollen, comprising administering to said individual a therapeutically effective amount of a therapeutic composition of daim 27.

30. A method of detecting in an individual sensitivity to a protein allergen of Bermuda grass pollen, comprising combining a blood sample obtained from said individual with an isolated protein allergen of Bermuda grass pollen or antigenic fragment thereof produced in a host cell transformed with the nudeic add sequence of daim 1, or chemically synthesized under conditions appropriate for binding of blood components with the protein allergen or fragment thereof and determining the extent to which such binding occurs.

31. The method of daim 30 wherein the extent to which binding occurs is determined by assessing T cell function, T cell proliferation, B cell function, binding of the protein or fragment thereof to antibodies present in the blood or a combination thereof.

32. A method of detecting in an individual sensitivity to a protein allergen of Bermuda grass pollen, comprising combining a blood sample obtained from said individual with an isolated protein allergen of Bermuda grass pollen or antigenic fragment thereof produced in a host cell transformed with the nudeic add sequence of daim 2, or chemically synthesized under conditions appropriate for binding of blood components with the protein allergen or fragment thereof and determining the extent to which such binding occurs.

33. The method of daim 32 wherein the extent to which binding occurs is determined by assessing T cell function, T cell proliferation, B cell function, binding of the protein or fragment thereof to antibodies present in the blood or a combination thereof.

34. Monoclonal antibodies specifically reactive with a Bermuda grass pollen allergen or an antigenic fragment thereof.

35. Polyclonal antibodies specifically reactive with a Bermuda grass pollen allergen or an antigenic fragment thereof.

SUSST:TϋTEf S