EP0236210B1 - Verfahren zur Herstellung von reifem, menschlichem Serum-Albumin - Google Patents

Verfahren zur Herstellung von reifem, menschlichem Serum-Albumin Download PDF

Info

Publication number
EP0236210B1
EP0236210B1 EP87400355A EP87400355A EP0236210B1 EP 0236210 B1 EP0236210 B1 EP 0236210B1 EP 87400355 A EP87400355 A EP 87400355A EP 87400355 A EP87400355 A EP 87400355A EP 0236210 B1 EP0236210 B1 EP 0236210B1
Authority
EP
European Patent Office
Prior art keywords
plasmid
gene
serum albumin
human serum
arg
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
EP87400355A
Other languages
English (en)
French (fr)
Other versions
EP0236210A1 (de
Inventor
Martine Latta
Jean-François Mayaux
Paolo Sarmientos
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genetica
Original Assignee
Genetica
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genetica filed Critical Genetica
Priority to AT87400355T priority Critical patent/ATE68826T1/de
Publication of EP0236210A1 publication Critical patent/EP0236210A1/de
Application granted granted Critical
Publication of EP0236210B1 publication Critical patent/EP0236210B1/de
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/76—Albumins
    • C07K14/765—Serum albumin, e.g. HSA
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence

Definitions

  • the present invention relates to a process for the preparation of mature human serum albumin from a human serum albumin produced microbiologically as a fused protein.
  • mammalian cells modified by recombinant DNA techniques has the advantage of leading to products very close to those of natural origin; however, the culture of these cells is delicate and can only be carried out in limited volumes.
  • microorganisms such as bacteria
  • bacteria proteins normally glycosylated in humans are not, in general, glycosylated by bacteria [P. Berman and LA Laskey, Trends Biochem. Sci., (1985) 10 , p.51 et seq.].
  • human proteins expressed at high level in bacteria such as E. coli often acquire a non-native conformation which is accompanied by intracellular precipitation [RG Schoner et al., Bio. Technol. (1985), 3 , p.151 and following; JM Schoemaker et al., EMBO J. (1985), 4 , p.775 and following].
  • the protein obtained When SAH is expressed on the basis of a genetic construct of the "Promoter-Translation start site-ATG-Gene of mature SAH" type, the protein obtained generally retains a methionine as an N-terminal residue.
  • N-terminal methionine from heterologous proteins expressed in E. coli, several methods can be envisaged, such as enzymatic cleavage in vivo , proteolytic excision during or immediately after transport through the membrane or even proteolytic digestions or chemical in vivo .
  • the secreted proteins are generally initially synthesized in the form of a preprotein comprising a "signal sequence" which includes the first residue. This sequence undergoes proteolytic excision during or immediately after transport through the membrane [R. Scheckman, Trends Biochem (1985), 10 , p.177].
  • this system is generally not suitable in the case of cytoplasmic or heterologous proteins because of the transport problems due either to certain parts of the primary sequence of the protein [J. Tommassen et al, EMBO J. (1985), 4 p.1041] or too rapid intracytoplasmic precipitation of the protein.
  • proteases such as collagenase and factor X, recognize a sequence of several amino acids, which makes them relatively specific.
  • a genetic construction therefore makes it possible to position the sequence recognized by the protease in question in front of the first amino acid of the desired protein.
  • This fused protein thus becomes a substrate of the protease, the main product of the reaction being the protein having in N-terminal position the same amino acid as the mature protein.
  • the major drawback of this method lies in the price of the protease especially when it comes to producing a protein in large quantities.
  • SAH is synthesized by human cells first in the form of prepro-SAH ( Figure 1).
  • An 18 amino acid signal sequence is removed during the transport of HSA through the lumen of the endoplasmic reticulum and there are still 6 amino acids remaining at the N-terminus (Arg- Gly- Val- Phe- Arg- Arg-) which are not present in circulating HSA.
  • This propeptide does not seem to play any role in the secretion of HSA.
  • mature SAH can be obtained by using an N-terminal peptide extension ("pseudo-pro-peptide") whose sequence differs from that of the first 6 amino acids of the cII protein of bacteriophage lambda, to provided that this extension allows sufficient expression of the fused protein, has the necessary hydrophilicity and has a trypsin cleavage site.
  • the "pseudo-pro-peptide” can consist of the first 5 amino acids of the signal sequence of penicillin amidase (6, if the first methionine residue is counted).
  • Liver cells are used, obtained for example by biopsy, and the messenger RNA is extracted therefrom according to the method described for example by V. Glisin et al., Biochemistry (1974), 13 , p. 2633 and following; and by R. Deeley et al., J. Biol. Chem. (1977), 252 , p. 8310 and following.
  • the biopsy is treated with a 6M guanidine thiocyanate solution, and the total RNA is purified by several cycles of precipitation in ethanol at -20 ° C., centrifugation and redissolution of the centrifugation pellets.
  • the preparation is enriched with messenger RNA by several cycles of affinity chromatography on oligo (dT) -cellulose columns, according to the technique described by H. Aviv and P. Leder, Proc. Natl. Acad. Sci. (USA) (1972), 69 , p. 1408 and following.
  • the messenger RNA thus isolated, containing 1 to 2% of the total RNA, is stored in aqueous solution at -70 ° C.
  • the proportion of messenger RNA specific for human serum albumin can be determined in the total population (for example by in vitro translation of an aliquot of the RNA solution in rabbit reticulocyte lysates).
  • One method consists in using the reticulocyte lysate supplied by the company Amersham, according to the protocol recommended by this supplier. It is thus possible to determine the fraction of newly formed protein immunoprecipitable by anti-albumin antibodies within all of the newly formed proteins. For example, a fraction of the order of 6% is obtained.
  • RNA is used for example in a final volume of 50 microliters of a solution containing: 100 mM Tris-HCl pH 8.3, 10 mM MgCl2, 0.4 mM DTT, 20 mM KCl, 0.4 mM Na pyrophosphate, 1 mM of each nucleotide triphosphate (dNTP), 100 ⁇ g / ml of oligo (dT) 12 ⁇ 18, 0.5 U / ml of ribonuclease inhibitor, 50 picomoles of tracer radioactive and 40 units of reverse Transcriptase (Life Science Company, Inc.).
  • the rate of synthesis of cDNA is calculated by measuring the rate of incorporation of the radioactive tracer into acid-precipitable molecules, according to a known technique.
  • the reaction is stopped by addition of EDTA (20 mM), and the messenger RNA is destroyed by alkaline digestion in 50 mM NaOH, at 42 ° C, for 3 hours.
  • the newly formed cDNA is separated from the non-incorporated dNTPs and from the alkaline degradation products of the RNAs by chromatography, for example, on a column of Sephadex G100 (Pharmacia Fine Chemicals). 1.5 ⁇ g of single-stranded cDNA are obtained from 5 ⁇ g of total messenger RNA.
  • Single-stranded cDNA is converted into double-stranded DNA by the action of the "Klenow" fragment of DNA polymerase I.
  • the reaction conditions are: 100 mM Hepes pH 7, 10 mM MgCl2, 2.5 mM DTT, 70 mM KCl, 0.5 mM of each dNTP, and 50 units of the "Klenow" fragment of DNA polymerase I (sold for example by New England Blolabs Inc.).
  • the reaction is continued for 15 hours, at 15 ° C., and the double-stranded DNA is separated from the dNTPs which are not incorporated again by chromatography on a column of Sephadex G100.
  • the unpaired sequences with nuclease S1 are treated according to the technique described by A. Efstradiatis et al., Cell (1976), 7 , p. 279 and following.
  • the double-stranded neoforced DNAs are separated according to their size by centrifugation in a sucrose gradient.
  • a gradient of 5% - 20% of sucrose is generally used in 50 mM Tris-HCl pH 8.5, 10 mM EDTA, 800 mM NaCl, centrifuged at 210,000 g for 15 hours, at 20 ° C, and fractionation is carried out of the aliquot gradient after centrifugation.
  • the size of the molecules in each fraction is controlled by electrophoresis of samples made in parallel with DNA standards of known sizes, and the fractions containing a DNA constituted by the chain of more than 500 base pairs are pooled.
  • the double-stranded DNA described above is then hybridized to the vector plasmid, according for example to the technique of L. Villa Komaroff et al., Proc. Natl. Acad. Sci. (USA) (1978), 75 , p. 3727 and following.
  • a “bank” of liver cDNA clones is created by transformation of the bacterium E. coli with the DNA thus described according to the method described by M. Mandel and A. Higa, J. Mol. Biol. (1970), 53 , p. 154 et seq. And M. Dagert and SD Erlich., Gene (1979), 6 , p. 23 and following.
  • a colony hybridization technique is used using synthetic oligonucleotides whose sequences are deduced from the protein sequence of human albumin (B. Meloun et al., FEBS Letters (1975), 58 , p. 134 et seq .; M. Grunstein and D. Hogness, Proc. Natl. Acad. Sci. (USA) (1975), 72 , p. 3961 et seq .; RB Wallace et al., Nucleic Acids Res. (1981), 9 , p. 879 et seq.).
  • the clones are cultured in series of 96 on Luria medium containing 25 ⁇ g / ml of tetracycline, in square dishes, directly on nitrocellulose filters. After growth at 37 ° C. and then amplification in the presence of 250 ⁇ g / ml of chloramphenicol, the colonies are lysed with sodium hydroxide and then hybridized with the radioactivated oligonucleotides in 5 ′ by kination, in a solution containing: 5 X SSC, 0.5% NP 40, 100 ⁇ g / ml DNA of salmon sperm denatured by boiling and quickly cooled in ice, 0.5 ng / ml of kinase oligonucleotide. Hybridization is carried out at 37 ° C for 18 hours. The filters are then washed in 5 X SSC, at 25 ° C, then 37 ° C, then 45 ° C and this for four times 15 minutes at each step.
  • the filters are then exposed on Kodak X-OMAT films, at -70 ° C, with an amplifier screen for 15 to 24 hours.
  • the clones hybridizing with the probes are reisolated and then lysed.
  • the plasmid DNA is purified by centrifugation in cesium chloride-ethidium bromide medium according to a known technique.
  • the insertion DNA is sequenced by the Maxam-Gilbert technique (A. Maxam and W. Gilbert, Methods Enzymol. (1980), 65 , p. 499 et seq.) To compare the protein sequence derived from the nucleotide sequence. and that of human serum albumin.
  • FIG. 2 is shown the restriction map of the serum albumin gene, as well as the position of three of the most representative insertions, designated by "pT1B11", “pAA38”, “p6D8".
  • a synthetic oligonucleotide having 21 bases in length, having a triplet "ATG” in front of the nucleotides coding for the amino acids of human serum albumin, as well as an NcoI restriction site, is prepared, the sequence of which is next: 5′GAATCCATGGATGCACACAAG 3 ′.
  • the PstI-BamHI DNA fragment is denatured, and hybridized with the synthetic oligonucleotide.
  • the hybridization is done by the sequence 5 ′ ... GATGCACACAAG 3 ′, the 3 ′ end of the complementary DNA strand being mismatched.
  • the mismatched ends are digested, then polymerized in the 5 ′ ... 3 ′ direction with the "Klenow" fragment of DNA polymerase I, according to the techniques of H. Jacobsen et al., Eur. J. Biochem. (1974), 45 , p. 623 and following.
  • a fragment is thus obtained containing at 5 ′ a blunt end, an NcoI site then the ATG triplet and at 3 ′ a BamHI site.
  • a plasmid (pXL52) is isolated which fuses the 5 ′ end of the human serum albumin gene with the ⁇ -galactosidase gene from E. coli .
  • the DNA of the plasmid "p6D8" is digested with EcoRI, and partially with BglII, according to a technique already described.
  • the large EcoRI-BglII fragment containing the sequence coding for the last 405 amino acids of human serum albumin is isolated, then the origin of replication of the plasmid and the tetracycline resistance gene.
  • the DNA of the plasmid "pXL52" described above is digested with EcoRI and Sau3A, and a fragment containing 200 base pairs is isolated.
  • the DNA of the plasmid "pAA38" is digested with Sau3A and a fragment containing 540 base pairs is isolated.
  • the three fragments are ligated (in the order [pXL52 EcoRI-Sau3A] - [pAA38-Sau3A] - [p6D8 BglII-EcoRI]) by taking advantage of the compatibility between the Sau3A and BglII sites.
  • a plasmid is obtained, called "pXL53", the quality of the construction of which is controlled by complete sequencing of the fragment between the EcoRI site and the PstI site corresponding to the junction of the insertion and of the vector plasmid.
  • the plasmid "pXL53” is linearized by partial digestion with the enzyme NcoI, considering only the NcoI site 5 ′ of the initiation codon and clear edges are formed by filling according to the technique of RM Wartell and WS Reznikoff, Gene (1980), 9 , p. 307 and following).
  • the adapter sequence is: 5′GGATCCTAGGAGGAAC 3 ′.
  • Ligation of the 5 ′ adapter of blunt-edge DNA has been described, for example, by CP Bahl et al., Gene (1976), 1 , p. 81 and following.
  • the reaction is continued for 10 hours at 15 ° C. This ligation creates a BamHI site without deleting the NcoI site.
  • the ligation product is digested with BamHI and with HinDIII. Due to the presence of a HinDIII site at 3 ′ of the human serum albumin gene, a DNA fragment is obtained containing the entire coding sequence.
  • the HinDIII-BamHI fragment thus obtained is subcloned, for example in the plasmid "pBR322" by transforming E.coli according to the method already described above to obtain the plasmid "pXL61".
  • the plasmid "pXL61" does not contain a promoter.
  • the bacteriophage lambda "P L " promoter is placed on the bacteriophage chromosome between a BglII site and a BamHI site (see E. Szybalski and W. Szybalski, Gene (1979) 7 , p. 217 et seq.), And whose nucleotide sequence is known (F. Sanger et al., J. Mol. Biol. (1982), 162 , p. 279 et seq.). We can clone this fragment and modify its restriction sites according to known methods.
  • the plasmids carrying P L must be propagated in strains of E. coli carrying the repressor gene cI, this in order to prevent this promoter from being expressed in a constitutive manner.
  • P L is available in the form of a BamHI fragment from the plasmid "pPL-lambda” (Pharmacia PL Biochemicals).
  • pPL-lambda Pharmacia PL Biochemicals.
  • the insertion of this BamHI fragment into the BamHI site of the plasmid "pXL61” makes it possible to obtain the plasmid "pXL65", in which it has been verified that the orientation of the promoter relative to the structural gene of human serum albumin is correct.
  • Plasmids can be made from available plasmids. It is possible, for example, to excise from the plasmid "pP L -lambda” a HaeIII-HaeIII fragment containing the promoter P L and to insert it into the SmaI site of a multisite cloning sequence carried on a plasmid, such as the plasmid " pUC8 "(J. Vieira and J. Messing, Gene, (1982), 79 , p. 259 et seq.) to obtain” pUC8-P L "" in which the EcoRI site is 5 ′ from the promoter.
  • the lambda bacteriophage cII gene whose sequence and site of initiation are known, can be efficiently translated (E. Schwarz et al., Nature (1978), 272 , p. 410 et seq.).
  • a plasmid is constructed containing the "Promoter” P L "expression system - RBS cII - ATG - serum albumin gene”.
  • the RBS of the cII gene is extracted from the plasmid "pPS1". This plasmid is digested with NdeI and a BamHI adapter is inserted after blunt ends have been formed. The RBS is then excised in the form of a HinDIII-BamHI fragment.
  • a plasmid "pXL88” is first constructed in which this HinDIII-BamHI fragment is linked to the large HinDIII-BamHI fragment of the plasmid "pXL73".
  • the RBS cII is inserted in the correct orientation relative to the promoter P L , all in a multisite system so that the whole P L -RBS cII is carried on a DNA fragment EcoRI-BamHI of 578 base pairs.
  • the EcoRI-BamHI fragment of 578 base pairs is subcloned between the EcoRI and BamHI sites of the plasmid "pMC1403" (MJ Casadaban et al., J. Bacteriol. (1980), 143 , p. 971 et seq.) Which carries the ⁇ -galactosidase (lacZ) gene after the BamHI site.
  • pMC1403 MJ Casadaban et al., J. Bacteriol. (1980), 143 , p. 971 et seq.
  • the BamHI-BglII fragment of the plasmid "pXL61" described above is subcloned in the BamHI site of the plasmid "pMC1403". (Ligation of a BglII site into a BamHI site is possible, but excision by BamHI to BglII is no longer possible; there therefore remains only one BamHI site).
  • pXL71 leads to the insertion of a DNA fragment of 700 base pairs comprising the sequence "BamHI- [RBS” consensus "-ATG-NcoI-partial gene for serum albumin - (coding for amino acids 1 to 218) -beta-galactosidase gene].
  • This plasmid is cut with BamHI and SacI (the SacI site is present in the ⁇ -galactosidase gene) and it is inserted into the plasmid "pXL91" described above in place of the preexisting BamHI-SacI fragment.
  • the plasmid "pXL97” is digested with BamHI and partially with NcoI, considering only the NcoI site close to the initiation codon and the free edges are formed by the action of nuclease SI, then it is closed on itself.
  • This manipulation on the one hand, suppresses the DNA sequence of RBS “consensus” and, on the other hand, puts an ATG of RBS cII in phase with the sequence of serum albumin.
  • the plasmid "pXL136" is thus obtained which contains the sequence "EcoRI-P L site -RBS cII-ATG-partial serum-albumin gene- ⁇ -galactosidase gene” sequence.
  • the plasmid "pXL136" is digested with EcoRI and PvuII and a fragment of 760 base pairs is extracted which is inserted between the EcoRI and PvuII sites of the plasmid "pXL70” described above .
  • the plasmid "pXL139" described above is cut at the unique site SalI, between the promoter PL and the RBS cII.
  • the DNA is digested with the enzyme Ba131, so that the end of transcription site tR1 in 5 ′ of the RBS cII is digested then a HinDIII adapter is added and the HinDIII-XbaI fragment containing the RBS cII amputated is isolated.
  • This HinDIII-XbaI fragment is combined with on the one hand the XbaI-EcoRl fragment of the plasmid pXL139 containing the end of the human serum albumin gene and on the other hand the EcoRl-HinDIII fragment carrying the P L promoter obtained from the plasmid pUC8-P L after destruction of the BamHI site.
  • the plasmid pXL324 is thus obtained.
  • a DNA fragment is constructed by hybridization of two synthetic oligonucleotides having the structure given in FIG. 6A.
  • the sequence contains a start codon "ATG” followed by the first 6 codons of the lambda bacteriophage cII gene.
  • This fragment has a cohesive end of the HinDIII type and another cohesive end of the SalI type.
  • This synthetic fragment is cloned between the HinDIII and SalI sites of the vector M13mp10 (J. Messing, Methods Enzymol., (1984), 101 , p.20 and following).
  • the replicative DNA purified from cells infected with the resulting bacteriophage is used in the next stage of construction.
  • a 765 base pair SalI-BglII fragment from the plasmid pXL324 containing the start of the gene (cDNA) coding for HSA is cloned into this recombinant bacteriophage.
  • the E.coli JM101 strain is infected with this new bacteriophage and the supernatant of a 5-hour culture is used as a source of phage particles containing the single-stranded DNA characteristic of filamentous phage type M13.
  • This single strand then serves as a template for an oligonucleotide-directed mutagenesis enabling the sequence between the sixth codon of the cII gene and the first codon of mature SAH (GAT) to be deleted according to the methods described, for example, by JP Adelman et al. ., DNA (1983), 2 , p.183.
  • the oligonucleotide used in this site-directed mutagenesis is described in Figure 6B.
  • the resulting phage contains the start of a new fused gene.
  • the DNA fragment structure used in the subsequent constructions is verified by the enzymatic sequencing method (F. Sanger et al., Proc. Natl. Acad. Sci. USA, (1977), 74 , p.5463).
  • a reconstruction of the complete gene coding for the "pseudo-pro-SAH" fusion is then carried out.
  • a vector containing an ampicillin resistance gene, an origin of replication, a transcription terminator and part of the cDNA coding for HSA is prepared from the plasmid pXL70 by treating this plasmid with the restriction enzymes EcoRI and PvuII. The fragment of approximately 7200 base pairs is purified by electrophoresis in agarose gel and electroelution.
  • a 430 base pair fragment containing the P L promoter and the modified ribosome attachment site (RBS) of the cII gene is purified from a digestion of the plasmid "pXL324" by the enzymes EcoRI and NdeI by electrophoresis. polyacrylamide gel and electroelution.
  • a 200 base pair NdeI-PvuII fragment containing the start of the cII-SAH hydride gene is purified from the replicative form of the recombinant bacteriophage M13 modified by in vitro mutagenesis described above. A ligation reaction to three partners was carried out. The resulting plasmid is called "pXL462" ( Figure 7).
  • the plasmid "pXL462" was introduced into the strain G819 by transformation.
  • This strain is derived from strain E103S (L. SIMON, Waksman Institute for Microbiology, Rutgers-The State University, Piscataway, NJ, USA) by transformation with the plasmid pRK248clts (HU. Bernard et al., Gene (1979), p .59 and following).
  • This plasmid is compatible with "pXL462” and carries the lambda bacteriophage cI gene which codes for a heat-sensitive repressor of the P L promoter. This repressor becomes inactive above 38.5 ° C.
  • the strain obtained has the number G1398.
  • plasmid pXL462 From plasmid pXL462, other plasmids were constructed where the P L promoter contained on an EcoRI-HinDIII restriction fragment was replaced by different inducible bacterial promoters. The construction of these plasmids used the unique XbaI site of pXL462 and a ligation reaction with three partners of the type described above (see FIG. 7). The present invention does not depend on the type of bacterial promoter used, only the case of the plasmid pXL462 carrying the promoter P L will be mentioned in the following.
  • the cell pellet collected by centrifugation is resuspended in 1/30 of PBS volumes (0.2 g / l KC1, 0.2 g / l KH2PO4, 8 g / l NaCl and 1.25 g / l Na2HPO4).
  • PBS volumes 0.2 g / l KC1, 0.2 g / l KH2PO4, 8 g / l NaCl and 1.25 g / l Na2HPO4
  • the sonication of the bacteria is carried out at 0 ° C, for example, with a Branson sonicator (Model B30) in continuous mode for twice six minutes with cooling.
  • the insoluble fraction is collected by centrifugation at 12,000 g at 4 ° C for 15 minutes then washed with PBS and dried under vacuum at 30 ° C for 15 minutes.
  • the sonication pellet containing the insoluble products from 1 liter of culture is taken up in 4 ml of denaturing and reducing solution (6M guanidine-HCl, 0.1M KH2PO4 pH 7.5, 0.1M ⁇ -mercaptoethanol).
  • the suspension thus obtained is gently stirred in a closed tube at 4 ° C for 16 hours. An almost clear solution is then obtained. A slight insoluble precipitate is removed by centrifugation. A 1/100 dilution of the supernatant is made in a renaturation solution (50 mM Tris-HCl pH 8.5, 100 mM NaCl, 1 mM EDTA) and this mixture is left at 4 ° C for 24 hours.
  • a renaturation solution 50 mM Tris-HCl pH 8.5, 100 mM NaCl, 1 mM EDTA
  • the solution is then centrifuged to remove a whitish opalescence.
  • the supernatant obtained is concentrated approximately 100 times by ultrafiltration (“cut-off” membrane of 30,000 daltons; for example using the single-use ultrafiltration units Millipore CS-30), again clarified by centrifugation and then dialyzed against a buffer. 20 mM phosphate (Na) pH 7.5.
  • the fusion protein cII-SAH (pseudo-pro-SAH) thus obtained is more than 90% homogeneous according to an analysis by SDS polyacrylamide gel electrophoresis.
  • a trypsin solution (prepared for example from lyophilized trypsin for analytical use marketed by Boehringer Mannheim) is prepared in the reaction solution.
  • CII-SAH is treated at a concentration, for example of the order of 1 mg / ml, with an amount of trypsin of between 1/5000 and 1/1000 (mass ratio to SAH) at 37 ° C. for 30 to 60 minutes in 50 mM phosphate buffer (Na) pH 7.5, 50 ⁇ M CaCl2.
  • the N-terminal sequence of this trypsin-modified protein was examined by Edman degradation and the results obtained confirm that the proteolysis site is located after the dipeptide Lys-Arg, at the end of the cII part of the hydride protein. .
  • the protein thus generated has aspartic acid as an N-terminal residue; it is therefore identical to natural HSA.
  • the plasmid "pXL288” is characterized in that it contains the Ptrp promoter of the tryptophan operon of E.coli upstream of the PAM promoter, the site of binding of the PAM gene ribosomes, the initiation codon ATG and the PAM signal peptide nucleotides fused with the HSA structural gene.
  • the N-terminus of the PAM leader peptide contains a sequence of 5 basic amino acids. This basicity constitutes one of the general characteristics of a secretory signal peptide (MEE Watson, Nucl. Acids. Res., 12 , p, 5145 and following). It has now been found that the first 6 amino acids of this signal peptide (Met Lys Asn Arg Asn Arg-, "PAM 1”) can play the role of "pseudo-pro" sequence.
  • the nucleotides corresponding to amino acids 7 to 26 of the PAM leader peptide have been deleted in order to exactly merge the sequence "PAM1" with the sequence of mature HSA using the oligonucleotide directed deletion technique described above ( figure 9).
  • the oligonucleotide allowing this suppression to be carried out is represented by FIG. 11A.
  • the modified sequence is then substituted in the plasmid "pXL288" to give the plasmid "pXL641" whose structure is as follows: "EcoR1-Ptrp-Sall- [PAM-RBS promoter PAM-nucleotide sequence coding for PAM1] -SAH gene” .
  • Two derivatives of the sequence "PAM1" are constructed by oligonucleotide-directed mutagenesis, after subcloning into the bacteriophage M13mp18amIV, according to the method described by P. CARTER et al., Nucl. Acids Res., 1985, 13 , p.4431 and following.
  • the oligonucleotides allowing this mutagenesis to be carried out are represented in FIGS. 11B and 11C.
  • hybrid protein is found in the insoluble fraction of the cell lysate and can be renatured and partially purified according to the methods described above.
  • Each hybrid protein obtained after renaturation can be converted into mature SAH by careful digestion using an optimized concentration of trypsin under the conditions described above.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Claims (11)

1. Verfahren zur Herstellung von reifem menschlichem Serum-albumin, dadurch gekennzeichnet, daß man
- in einer ersten Stufe ein Hybridprotein herstellt, das eine hydrophile N-endständige Peptidverlängerung von 5 bis 8, vorzugsweise 6 bis 7 Aminosäuren, abgeschlossen durch eine Trypsinschnittstelle, fusioniert mit der Peptidsequenz des reifen menschlichen Serumalbumins, herstellt durch Züchtung eines Stammes von E.coli, der den Bestand eines Plasmids zu gewährleisten vermag, das die für das Hybridprotein, dessen Expression durch einen induzierbaren bakteriellen Promotor regelbar ist, codierende Nukleotidsequenz enthält,
- in einer zweiten Stufe das so erhaltene denaturierte und unlösliche Molekül in ein renaturiertes und lösliches Molekül umwandelt, indem man eine Denaturierungs- und Renaturierungs-methode anwendet, die eine Umlagerung sekundärer und tertiärer Strukturen der Polypeptidkette ermöglicht, und
- in einer dritten Stufe dieses Hybridprotein mit Trypsin in ein Protein umwandelt, das in der Primärstruktur dem reifen menschlichen Serumalbumin identisch ist.
2. Verfahren nach Anspruch 1, dadurch gekennzeichnet, daß die die N-endständige Peptidverlängerung codierenden Codons aus gewählt sind aus den sieben ersten Codons des Gens cII des Bakteriophagen Lambda und den sechs ersten Codons des Gens von Penicillinamidase, gegebenenfalls transformiert durch gerichtete Mutagenese.
3. Plasmid "pXL462", hinterlegt unter der Nummer CBS 143-87, dadurch gekennzeichnet, daß es den Promotor PL, die Bindestelle der Ribosomen des Gens cII, abgeschlossen durch das Transkriptionsterminationssignal tR1, das Startcodon ATG und die sechs ersten Codons des Gens cII, fusioniert mit dem Strukturgen des reifen menschlichen Serumalbumins, enthält.
4. Plasmid "pXL641", hinterlegt unter der Nummer CBS 144-87, dadurch gekennzeichnet, daß es den Promotor Ptrp, gefolgt vom Promotor der Penicillinamidase, die Bindestelle der Ribosomen des Gens der Penicillinamidase und die sechs ersten Codons des Gens der Penicillinamidase, fusioniert mit dem Strukturgen des reifen menschlichen Serumalbumins, enthält.
5. Plasmid "pXL740", hinterlegt unter der Nummer CBS 145-87, dadurch gekennzeichnet, daß es den Promotor Ptrp, gefolgt vom Promotor der Penicillinamidase, die Bindestelle der Ribosomen des Gens der Penicillinamidase und die sechs ersten Codons des Gens der durch gerichtete Mutagenese modifizierten Penicillinamidase, die für das Polypeptid Met-Lys-Asn-Arg-Lys-Arg codieren, fusioniert mit dem Strukturgen des reifen menschlichen Serumalbumins, enthält.
6. Plasmid "pXL741", hinterlegt unter der Nummer CBS 146-87, dadurch gekennzeichnet, daß es den Promotor Ptrp, gefolgt vom Promotro der Penicillinamidase, die Bindestelle der Ribosomen des Gens der Penicillinamidase und die sechs ersten Codons eines Gens der durch gerichtete Mutagenese modifizierten Penicillinamidase, die für das Polypeptid Met-Lys-Lys-Arg-Lys-Arg codieren, fusioniert mit dem Strukturgen des reifen menschlichen Serumalbumins, enthält.
7. Hybridprotein, umfassend eine hydrophile N-endständige Peptidverlängerung von 5 bis 8, vorzugsweise 6 bis 7 Aminosäuren, abgeschlossen durch eine Trypsinschnittstelle, fusioniert mit der Peptidsequenz reifen menschlichen Serum-albumins, erhalten durch Züchtung eines Stammes von E.coli nach Anspruch 1.
8. Hybridprotein nach Anspruch 7, umfassend am N-endständigen Ende die sieben ersten Aminosäuren des Proteins cII des Bakteriophagen Lambda, (Met)-Val-Arg-Ala-Asn-Lys-Arg, fusioniert mit der Peptidsequenz des reifen menschlichen Serumalbumins, erhalten durch Züchtung eines Stammes von E.coli, der den Bestand des im Anspruch 3 definierten Plasmids "pXL462" zu gewährleisten vermag.
9. Hybridprotein nach Anspruch 7, umfassend am N-endständigen Ende die sechs ersten Aminosäuren der Penicillinamidase, Met-Lys-Asn-Arg-Asn-Arg, fusioniert mit der Peptidsequenz des reifen menschlichen Serumalbumins, erhalten durch Züchtung eines Stammes von E.coli, der den Bestand des im Anspruch 4 definierten Plasmids "pXL641" zu gewährleisten vermag.
10. Hybridprotein nach Anspruch 7, umfassend am N-endständigen Ende die sechs ersten Aminosäuren der durch gerichtete Mutagenese modifizierten Penicillinamidase, Met-Lys-Asn-Arg-Lys-Arg, fusioniert mit der Peptidsequenz des reifen menschlichen Serumalbumins, erhalten durch Züchtung eines Stammes von E.coli, der den Bestand des im Anspruch 5 definierten Plasmids "pXL740" zu gewährleisten vermag.
11. Hybridprotein nach Anspruch 7, umfassend am N-enständigen Ende die sechs ersten Aminosäuren der durch gerichtete Mutagenese modifizierten Penicillinamidase, Met-Lys-Lys-Arg-Lys-Arg, fusioniert mit der Peptidsequenz des reifen menschlichen Serumalbumins, erhalten duch Züchtung eines Stammes von E.coli, der den Bestand des im Anspruch 6 definierten Plasmids "pXL741" zu gewährleisten vermag.
EP87400355A 1986-02-21 1987-02-19 Verfahren zur Herstellung von reifem, menschlichem Serum-Albumin Expired - Lifetime EP0236210B1 (de)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AT87400355T ATE68826T1 (de) 1986-02-21 1987-02-19 Verfahren zur herstellung von reifem, menschlichem serum-albumin.

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR8602379 1986-02-21
FR8602379A FR2594846B1 (fr) 1986-02-21 1986-02-21 Procede de preparation de la serum albumine humaine mature

Publications (2)

Publication Number Publication Date
EP0236210A1 EP0236210A1 (de) 1987-09-09
EP0236210B1 true EP0236210B1 (de) 1991-10-23

Family

ID=9332373

Family Applications (1)

Application Number Title Priority Date Filing Date
EP87400355A Expired - Lifetime EP0236210B1 (de) 1986-02-21 1987-02-19 Verfahren zur Herstellung von reifem, menschlichem Serum-Albumin

Country Status (6)

Country Link
US (2) US5100784A (de)
EP (1) EP0236210B1 (de)
JP (1) JPS62275695A (de)
AT (1) ATE68826T1 (de)
DE (1) DE3773963D1 (de)
FR (1) FR2594846B1 (de)

Families Citing this family (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2791418B2 (ja) * 1987-12-02 1998-08-27 株式会社ミドリ十字 異種蛋白質の製造方法、組換えｄｎａ、形質転換体
FR2649991B2 (fr) 1988-08-05 1994-03-04 Rhone Poulenc Sante Utilisation de derives stables du plasmide pkd1 pour l'expression et la secretion de proteines heterologues dans les levures du genre kluyveromyces
US5158875A (en) * 1989-08-25 1992-10-27 Amgen Inc. Production of biologically active insulin-like growth factor i from high expression host cell systems
NZ236819A (en) * 1990-02-03 1993-07-27 Max Planck Gesellschaft Enzymatic cleavage of fusion proteins; fusion proteins; recombinant dna and pharmaceutical compositions
FR2686899B1 (fr) * 1992-01-31 1995-09-01 Rhone Poulenc Rorer Sa Nouveaux polypeptides biologiquement actifs, leur preparation et compositions pharmaceutiques les contenant.
JPH07102147B2 (ja) * 1992-03-16 1995-11-08 株式会社ミドリ十字 ヒト血清アルブミンの着色抑制方法
DK0658569T3 (da) * 1993-12-17 2005-02-07 Mitsubishi Pharma Corp Fremgangsmåde til affarvning af humant serumalbumin
US6551618B2 (en) * 1994-03-15 2003-04-22 University Of Birmingham Compositions and methods for delivery of agents for neuronal regeneration and survival
US5698517A (en) * 1994-03-21 1997-12-16 University Of Hawaii, Office Of Technology Transfer And Economic Development Thyroxin-binding HSA fragments
US5516679A (en) * 1994-12-23 1996-05-14 Bristol-Myers Squibb Company Penicillin V amidohydrolase gene from Fusarium oxysporum
GB9526733D0 (en) 1995-12-30 1996-02-28 Delta Biotechnology Ltd Fusion proteins
US20030190740A1 (en) * 1998-10-13 2003-10-09 The University Of Georgia Research Foundation, Inc Stabilized bioactive peptides and methods of identification, synthesis, and use
US20050100991A1 (en) * 2001-04-12 2005-05-12 Human Genome Sciences, Inc. Albumin fusion proteins
CA2405557C (en) * 2000-04-12 2013-09-24 Human Genome Sciences, Inc. Albumin fusion proteins
US6946134B1 (en) 2000-04-12 2005-09-20 Human Genome Sciences, Inc. Albumin fusion proteins
US20050244931A1 (en) * 2001-04-12 2005-11-03 Human Genome Sciences, Inc. Albumin fusion proteins
US20060084794A1 (en) * 2001-04-12 2006-04-20 Human Genome Sciences, Inc. Albumin fusion proteins
US7507413B2 (en) 2001-04-12 2009-03-24 Human Genome Sciences, Inc. Albumin fusion proteins
US20050054051A1 (en) * 2001-04-12 2005-03-10 Human Genome Sciences, Inc. Albumin fusion proteins
WO2003030821A2 (en) * 2001-10-05 2003-04-17 Human Genome Sciences, Inc. Albumin fusion proteins
AU2002364587A1 (en) * 2001-12-21 2003-07-30 Human Genome Sciences, Inc. Albumin fusion proteins
EP2261250B1 (de) * 2001-12-21 2015-07-01 Human Genome Sciences, Inc. GCSF-Albumin Fusionsproteine
EP1594530A4 (de) 2003-01-22 2006-10-11 Human Genome Sciences Inc Albuminfusionsproteine
US11739166B2 (en) 2020-07-02 2023-08-29 Davol Inc. Reactive polysaccharide-based hemostatic agent

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0001929A2 (de) * 1977-11-08 1979-05-16 Genentech, Inc. Plasmid zur Transformation eines bakteriellen Wirts um ihn zu Polypeptid Expression fähig zu machen
EP0073646A2 (de) * 1981-08-28 1983-03-09 Genentech, Inc. Herstellung von DNS-Sequenzen und deren Verwendung zur mikrobiologischen Herstellung von Proteinen, insbesondere menschlichen Serum-Albuminen
EP0114506A1 (de) * 1982-12-22 1984-08-01 Genentech, Inc. Methoden zur Reinigung und Reaktivierung von gefällten heterologen Proteinen

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4468464A (en) * 1974-11-04 1984-08-28 The Board Of Trustees Of The Leland Stanford Junior University Biologically functional molecular chimeras
US4332892A (en) * 1979-01-15 1982-06-01 President And Fellows Of Harvard College Protein synthesis
US4338397A (en) * 1980-04-11 1982-07-06 President And Fellows Of Harvard College Mature protein synthesis
US4551433A (en) * 1981-05-18 1985-11-05 Genentech, Inc. Microbial hybrid promoters
EP0079739A3 (de) * 1981-11-12 1984-08-08 The Upjohn Company Auf Albumin basierende Nukleotiden, ihre Replikation und Verwendung und Plasmide zur Verwendung darin
US4511502A (en) * 1982-12-22 1985-04-16 Genentech, Inc. Purification and activity assurance of precipitated heterologous proteins
US4578355A (en) * 1983-01-12 1986-03-25 The United States Of America As Represented By The Department Of Health And Human Services Plasmid cloning vector pAS1
GB2140810B (en) * 1983-05-24 1987-07-08 Celltech Ltd Polypeptide and protein products, and process for their production
JPS6087792A (ja) * 1983-09-23 1985-05-17 ジェネックス・コーポレイション 雑種制御領域
US4703004A (en) * 1984-01-24 1987-10-27 Immunex Corporation Synthesis of protein with an identification peptide
FR2579224B1 (fr) * 1985-03-25 1987-05-22 Genetica Procede de preparation microbiologique de la serum-albumine humaine

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0001929A2 (de) * 1977-11-08 1979-05-16 Genentech, Inc. Plasmid zur Transformation eines bakteriellen Wirts um ihn zu Polypeptid Expression fähig zu machen
EP0073646A2 (de) * 1981-08-28 1983-03-09 Genentech, Inc. Herstellung von DNS-Sequenzen und deren Verwendung zur mikrobiologischen Herstellung von Proteinen, insbesondere menschlichen Serum-Albuminen
EP0114506A1 (de) * 1982-12-22 1984-08-01 Genentech, Inc. Methoden zur Reinigung und Reaktivierung von gefällten heterologen Proteinen

Also Published As

Publication number Publication date
US5187261A (en) 1993-02-16
DE3773963D1 (de) 1991-11-28
EP0236210A1 (de) 1987-09-09
ATE68826T1 (de) 1991-11-15
FR2594846A1 (fr) 1987-08-28
FR2594846B1 (fr) 1989-10-20
JPS62275695A (ja) 1987-11-30
US5100784A (en) 1992-03-31

Similar Documents

Publication Publication Date Title
EP0236210B1 (de) Verfahren zur Herstellung von reifem, menschlichem Serum-Albumin
EP0200590B1 (de) Verfahren zur mikrobiologischen Herstellung von menschlichem Serum-Albumin
EP0625202B1 (de) Humanes serum albumin, herstellung und verwendung
EP0293357B1 (de) Expression von menschlichem Proapolipoprotein A-1
US5089397A (en) Superior mammalian expression system
JPH0829096B2 (ja) 融合蛋白質をコードするｄｎａ
EP0206783A2 (de) Expression und Sekretion von Polypeptiden aus Saccharomyces cerevisiae
FR2514783A1 (fr) Interferon immunitaire humain
HUT51329A (en) Process for producing human serum albumin and other heterologous proteins from yeast by microbiological method
EP0200655A1 (de) Expressions- und Ausscheidungsvektoren für Hirudin mittels transformierter Hefe
AU607973B2 (en) Process for production of physiologically active peptide containing cysteine residue
EP0408461B1 (de) Protein mit Urate-Oxidase-Aktivität, dafür kodierendes rekombinantes Gen, Expressionsvektor, Mikroorganismen und Transformanten
EP0198745B1 (de) Verfahren zur mikrobiologischen Herstellung von menschlichem Serum-Albumin
DK175534B1 (da) Rekombinant DNA-molekyle, fremgangsmåde til dets fremstilling, transformeret vært, fremgangsmåde til dens fremstilling, fremgangsmåde til fremstilling af et polypeptid samt pectinlyaser
WO1985005125A1 (fr) Vecteur d'expression du facteur ix, cellules transformees par ces vecteurs et procede de preparation du facteur ix
CA2113925A1 (fr) Promoteur de levure et son utilisation
FR2635115A1 (fr) Procede de preparation de la serum albumine humaine a partir d'une levure
JPH01501037A (ja) 有機化合物の又はそれに関連する改良
CH666284A5 (fr) Vecteur plasmide d'escherichia coli ameliore et son utilisation.
JPH06503718A (ja) メチロトローフ酵母細胞におけるヒトリゾチムの産生とその効率的な分泌
EP1071798B9 (de) Vektoren zur kontrollierter expression von rekombinanten genen in prokaryontischen zellen
FR2656531A1 (fr) Promoteur artificiel pour l'expression de proteines dans le levure.
JP2018531611A (ja) 遺伝的改変酵母細胞と血栓特異的ストレプトキナーゼ製造改良プロセス
EP0188555A1 (de) Klonierungsvektor für hefe
JPH01273591A (ja) ヒト成長ホルモン分泌プラスミド、ならびにそれを用いた形質転換体および蛋白質分泌生産法

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE FR GB IT LI LU NL SE

17P Request for examination filed

Effective date: 19870923

17Q First examination report despatched

Effective date: 19890824

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): AT BE CH DE FR GB IT LI LU NL SE

REF Corresponds to:

Ref document number: 68826

Country of ref document: AT

Date of ref document: 19911115

Kind code of ref document: T

ITF It: translation for a ep patent filed
REF Corresponds to:

Ref document number: 3773963

Country of ref document: DE

Date of ref document: 19911128

GBT Gb: translation of ep patent filed (gb section 77(6)(a)/1977)
PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: FR

Payment date: 19920113

Year of fee payment: 6

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: SE

Payment date: 19920123

Year of fee payment: 6

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: LU

Payment date: 19920130

Year of fee payment: 6

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: GB

Payment date: 19920210

Year of fee payment: 6

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: BE

Payment date: 19920212

Year of fee payment: 6

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: AT

Payment date: 19920221

Year of fee payment: 6

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: CH

Payment date: 19920227

Year of fee payment: 6

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: NL

Payment date: 19920229

Year of fee payment: 6

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: DE

Payment date: 19920320

Year of fee payment: 6

EPTA Lu: last paid annual fee
PLBE No opposition filed within time limit

Free format text: ORIGINAL CODE: 0009261

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT

26N No opposition filed
PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: LU

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 19930219

Ref country code: GB

Effective date: 19930219

Ref country code: AT

Effective date: 19930219

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SE

Effective date: 19930220

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: LI

Effective date: 19930228

Ref country code: CH

Effective date: 19930228

Ref country code: BE

Effective date: 19930228

BERE Be: lapsed

Owner name: GENETICA

Effective date: 19930228

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: NL

Effective date: 19930901

GBPC Gb: european patent ceased through non-payment of renewal fee

Effective date: 19930219

NLV4 Nl: lapsed or anulled due to non-payment of the annual fee
PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: FR

Effective date: 19931029

REG Reference to a national code

Ref country code: CH

Ref legal event code: PL

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: DE

Effective date: 19931103

REG Reference to a national code

Ref country code: FR

Ref legal event code: ST

EUG Se: european patent has lapsed

Ref document number: 87400355.1

Effective date: 19930912

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IT

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20050219