DE1485851U - - Google Patents

Info

Publication number
DE1485851U
DE1485851U DENDAT1485851D DE1485851DU DE1485851U DE 1485851 U DE1485851 U DE 1485851U DE NDAT1485851 D DENDAT1485851 D DE NDAT1485851D DE 1485851D U DE1485851D U DE 1485851DU DE 1485851 U DE1485851 U DE 1485851U
Authority
DE
Germany
Prior art keywords
becomes
xlnn
woloher
vaohden
untmoa
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
DENDAT1485851D
Other languages
German (de)
English (en)
Publication of DE1485851U publication Critical patent/DE1485851U/de
Active legal-status Critical Current

Links

Landscapes

  • Machine Translation (AREA)
  • Stored Programmes (AREA)
DENDAT1485851D Active DE1485851U (https=)

Publications (1)

Publication Number Publication Date
DE1485851U true DE1485851U (https=)

Family

ID=790948

Family Applications (1)

Application Number Title Priority Date Filing Date
DENDAT1485851D Active DE1485851U (https=)

Country Status (1)

Country Link
DE (1) DE1485851U (https=)

Similar Documents

Publication Publication Date Title
James Weak compactness and reflexivity
Gass et al. Parametric objective function (part 2)—generalization
DE2215088A1 (de) Verfahren und anordnung zur zeichenerkennung
CH372732A (de) Steuereinrichtung für einen Servomechanismus
DE1485851U (https=)
DE3783974T2 (de) Optischer buchstabenleser.
DE1499553A1 (de) Verteilungssystem fuer Poststuecke,wie Briefe
Duda et al. Graphical-data-processing research study and experimental investigation
Lumley et al. A model for investments in the natural resource industry with switching costs
DE3612231A1 (de) Bilddaten-verarbeitungssystem
Malik et al. Boundary value problem for an infinite system of second order differential equations in $\ell_p $ spaces
Vijayabalaji et al. Cubic inverse soft set
Warschawski 17. On Conformal Mapping of Variable Regions1
DE70047C (de) Verfahren, Sümpfe und Unland kulturfähig zu machen
Normand Convex structuring element decomposition for single scan binary mathematical morphology
Exon Exon I 52606855 tgagcataaaaggagggtccctcgggctgggaggaggtaggctggggaccATGAAGACTT M·· K·· T·· 52606795 AGAGGGCCAGCCTCTCCCTGGGACGGTGGTCACTGTGGCTACTGCTGCTGGGACTAGCGC X·· R·· A·· S·· L·· S·· L·· G·· R·· W·· S·· L·· W·· L·· L·· L·· L·· G·· L·· A·· 52606735 TGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGGCTGTGCTTCGTGCTGTGGATC
DE827125C (de) Schnellrechenmaschine
DE2364863C3 (de) Verfahren zum Sortieren von blattartigem Schriftgut
Nathanson Integrals of binary sequences
Diana et al. Eilenberg swindles and higher large scale homology of products of trees
Morris et al. Application of an optimizing path algorithm in the comparison of farm work methods
DE2620767A1 (de) Verfahren und vorrichtung zur pruefung der druckqualitaet von druckbildern, insbesondere banknoten
DE213798C (https=)
Villarroel Pacheco Improvement of the logistics system of a chemical company
Eyres et al. Erratum: ALMA reveals the aftermath of a white dwarf–brown dwarf merger in CK Vulpeculae