CN212800301U - Portable PCR detection device - Google Patents
Portable PCR detection device Download PDFInfo
- Publication number
- CN212800301U CN212800301U CN202020864429.6U CN202020864429U CN212800301U CN 212800301 U CN212800301 U CN 212800301U CN 202020864429 U CN202020864429 U CN 202020864429U CN 212800301 U CN212800301 U CN 212800301U
- Authority
- CN
- China
- Prior art keywords
- heating device
- reaction
- prefabricated
- pcr
- support ring
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Investigating Or Analyzing Non-Biological Materials By The Use Of Chemical Means (AREA)
- Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)
- Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
Abstract
The utility model discloses a portable PCR detection device, including detecting box, the prefabricated pipe of PCR reaction, fluorescence probe and heating device, detect box upper end opening, be provided with the support ring in the upper end, the prefabricated pipe fixed connection of PCR reaction is on the support ring and the through-hole at middle part lower protruding support ring center, and fluorescence probe fixed connection just is just to the prefabricated intraductal convex part down of PCR reaction at the lower terminal surface of support ring, and heating device is installed to the prefabricated intraduct below of PCR reaction, and heating device fixed connection is in detecting the box. The utility model discloses a heating device heats to the settlement temperature, will sample the overhead sample of test paper and crowd the prefabricated intraductal reaction that carries out of PCR reaction, adopts fluorescence probe to survey, realizes PCR short-term test, and the structure is simplified greatly, portable, cost greatly reduced.
Description
Technical Field
The utility model relates to a portable PCR detection device belongs to PCR check out test set technical field.
Background
The traditional PCR equipment is only used in a laboratory, has large volume, complex mechanical design and low circuit integration degree, can simultaneously detect a plurality of samples, but has poor portability; PCR instruments in the market all use 220V alternating current power supplies, so that the use scenes of the instruments are limited; meanwhile, the equipment uses an industrial PC, does not have the function of a network module, and cannot realize real-time sharing of data, report of an early warning result and disease control.
Disclosure of Invention
The to-be-solved technical problem of the utility model is: a portable PCR detection device is provided to solve the above problems in the prior art.
The utility model discloses the technical scheme who takes does: the utility model provides a portable PCR detection device, includes detection box, the prefabricated pipe of PCR reaction, fluorescence probe and heating device, detects box upper end opening, is provided with the support ring in the upper end, and the prefabricated pipe fixed connection of PCR reaction is on the support ring and the through-hole at middle part lower protruding support ring center, and fluorescence probe fixed connection just is just to the prefabricated intraductal convex part down of PCR reaction at the lower terminal surface of support ring, and heating device is installed to the prefabricated intraduct below of PCR reaction, and heating device fixed connection is in the detection box.
Preferably, the PCR reaction prefabricated pipe comprises a reaction tank and a connection support sheet, the reaction tank is provided with an opening at the upper end, the connection support sheet is arranged around the edge of the opening, the upper end of the reaction tank is also provided with an outer convex elastic arc extrusion sheet, the middle part of the elastic arc extrusion sheet is provided with a conical extrusion part with a larger upper part and a smaller lower part, and the opening at the lower end of the conical extrusion part is provided with a sealing film.
Preferably, a collecting groove is formed around the tapered squeezing portion.
Preferably, the reaction tank is tapered in a large upper part and a small lower part.
Preferably, the reaction tank is made of transparent polyethylene plastic.
Preferably, a temperature sensor is installed at the outlet of the heating device.
Preferably, the upper end of the detection box is covered with a box cover.
Preferably, the fluorescent probe and the heating device are connected to a controller, and the controller is connected to a temperature sensor.
Preferably, the controller is connected to a user terminal through a bluetooth module, the user terminal is connected to a cloud server, and the cloud server is connected to a management mechanism terminal.
The utility model has the advantages that: compared with the prior art, the utility model discloses an effect as follows:
(1) the utility model heats the sample on the sampling test paper head to the set temperature through the heating device, extrudes the sample on the sampling test paper head into the PCR reaction prefabricated pipe for reaction, adopts the fluorescent probe for detection, realizes the rapid detection of PCR, greatly simplifies the structure, is convenient to carry, greatly reduces the cost, has smaller required voltage, and can be equipped with a power supply at any time;
(2) the reaction tank is made of transparent materials, detection reagents are contained in the reaction tank, a cotton swab-shaped sampling test paper head is used for collecting samples and protecting the samples by a protective liquid, the protected sampling test paper head is pushed into the conical extrusion part to pierce the sealing film and extrude the sealing film, the protective samples are extruded into the reaction tank to react, the maximum amount of the protective samples can be extruded into the reaction tank, and the reaction effect and the detection accuracy are improved;
(3) the flow collecting groove is arranged, so that the extruded protection sample can conveniently flow into the reaction tank, and the reverse suction into the sampling test paper is avoided;
(4) the liquid drop mixing device has a conical structure with a large upper part and a small lower part, so that the mixing of trace liquid drops is facilitated, and the detection precision is improved;
(5) the temperature sensor is arranged, so that the heating temperature can be accurately monitored, the detection accuracy is improved, and the constant temperature detection is convenient to realize;
(6) the box cover is arranged, so that the detection box is protected conveniently;
(7) and (3) adopting a controller to carry out temperature control and fluorescence signal detection, and realizing the automatic detection of the PCR result:
(8) adopt bluetooth module to be connected to user terminal, realize the automatic receipt and the monitoring of data to with the data upper end to high in the clouds server, the management mechanism terminal receives behind the data, if the detection result is positive, reports to the police the suggestion automatically, and the management mechanism of being convenient for in time makes prevention and control measures.
Drawings
Fig. 1 is a schematic structural view of the present invention;
FIG. 2 is a schematic diagram of a PCR reaction prefabricated tube;
FIG. 3 is a schematic top sectional view of the tapered squeezing portion.
Detailed Description
The present invention will be further described with reference to the accompanying drawings and specific embodiments.
Example 1: as shown in fig. 1-3, a portable PCR detection device, including detecting box 1, PCR reaction prefabricated pipe 2, fluorescence probe 3 and heating device 4, detect box 1 upper end opening, be provided with support ring 5 in the upper end, PCR reaction prefabricated pipe 2 detachably fixed connection is on support ring 5 and the middle part extrudes the through-hole at support ring 5 center down, fluorescence probe 3 fixed connection just is just to PCR reaction prefabricated pipe 2 lower convex part under the lower terminal surface of support ring 5, heating device 4 is installed to PCR reaction prefabricated pipe 2 middle part below, heating device 4 fixed connection is in detecting box 1, detect box 1 bottom and set up box bottom 8, heating device 4 fixed connection is on box bottom 8, the connection can be dismantled of PCR reaction prefabricated pipe 2, be convenient for realize the change of PCR reaction prefabricated pipe 2, reduce equipment cost.
Preferably, the PCR reaction prefabricated tube 2 comprises a reaction tank 201 and a connection support sheet 202 made of transparent materials, the upper end of the reaction tank 201 is open, the connection support sheet 202 is arranged around the edge of the opening, an outward-protruding elastic arc-shaped extrusion sheet 203 is further arranged at the upper end of the reaction tank 201, a conical extrusion part 204 with a large upper part and a small lower part is arranged in the middle of the elastic arc-shaped extrusion sheet 203, a sealing film 205 is arranged at the lower end opening of the conical extrusion part 204, a collecting groove 206 is arranged around the conical extrusion part 204, the reaction tank 201 is in a conical shape with a small upper part and a large lower part, the reaction tank 201 is made of transparent polyethylene plastics, the reaction tank is made of transparent materials, a detection reagent is contained in the reaction tank, a sampling test paper head 207 in a cotton swab head shape is used for collecting a sample and is protected by a protection solution, the protected test paper sampling head is pushed into the conical extrusion part to pierce the sealing film and extrude, the reaction effect and the detection accuracy are improved.
Preferably, a temperature sensor 6 is installed at an outlet of the heating device 4, the heating device 4 includes a box body with an opening at an upper end and a semiconductor heating plate installed in the box body, and two fluorescent probes 3 are used and extend into the alignment reaction tank 201 from a through hole on a side surface of the upper end of the box body.
Preferably, the upper end of the detecting box 1 is covered with a box cover 7.
Preferably, the fluorescent probe 3 and the heating device 4 are connected to a controller, and the controller is connected to a temperature sensor 6.
Preferably, the controller is connected to a user terminal through a bluetooth module, the user terminal is connected to a cloud server, and the cloud server is connected to a management mechanism terminal.
The utility model discloses used fluorescence quantitative PCR's rationale, integrateed temperature control module, fluorescence module and bluetooth communication module, designed purpose-made PCR reaction and prefabricated the pipe, with the small-size lightweight design of equipment, cooperation mobile client (cell-phone APP), realize short-term test and data sharing analysis, in time make the early warning to the disease.
The use principle is as follows: the device comprises a temperature control module, a fluorescence detection module and a Bluetooth communication module, and a reaction system uses a prefabricated PCR tube. Placing a sample into a reaction tube, starting a detection mode, leading the chain polymerization reaction of nucleic acid by a temperature control module, detecting a fluorescence value by a fluorescent probe, and judging a disease detection result after comparing the detection value with a blank correction value of common disease detection; the Bluetooth communication module transmits instructions and shares data with the client, and the client uploads detection data to the central server in real time by using a network, so that early warning and detection of diseases are realized, and rapid response is conveniently handled.
The PCR reaction prefabricated tube (rapid detection kit) uses prefabricated mixing, and the industrial production sample mixing is carried out in a nitrogen closed gas system in sequence in a cold chain transportation and storage mode. The reagent is prepared and packaged by using a PCR tube, a primer, dNTP, Taq DNA polymerase and a reaction buffer solution system are formed, a 20 mu L reaction system and a 31 mu L reaction system are developed at present according to the quality guarantee period of each component, and the specific components and the compositions are as follows:
table 1: 20 mu L prefabricated PCR reaction tube ingredient list
TABLE 2 composition Table of 26. mu.L prefabricated PCR reaction tubes
At present, the recommended primers are adopted as primers for detecting the novel coronavirus, and the sequences are as follows:
target one (ORF 1 ab):
forward primer (F): CCCTGTGGGTTTTACACTTAA
Reverse primer (R): ACGATTGTGCATCAGCTGA
Fluorescent probe (P): 5'-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3'
Target two (N):
forward primer (F): GGGGAACTTCTCCTGCTAGAAT
Reverse primer (R): CAGACATTTTGCTCTCAAGCTG
Fluorescent probe (P): 5'-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3'
As the PCR tube is a prefabricated tube, the effective period is the key content of the current experiment. And (3) placing the prefabricated PCR tube in liquid nitrogen for quick freezing, then transferring the tube to-20 ℃ for long-term storage, and performing an expiration date test and a stability test.
The utility model discloses a prefabricated pipe is convenient for cooperate heating chip and fluorescence equipment to detect to have the portability, this prefabricated pipe is used for the prefabricated intensive mixing of preserving of reaction liquid and being convenient for after the sample adds.
The above description is only for the specific embodiments of the present invention, but the protection scope of the present invention is not limited thereto, and any person skilled in the art can easily think of the changes or substitutions within the technical scope of the present invention, and all should be covered within the protection scope of the present invention, therefore, the protection scope of the present invention should be subject to the protection scope of the claims.
Claims (9)
1. A portable PCR detection device is characterized in that: including detecting box (1), prefabricated pipe of PCR reaction (2), fluorescence probe (3) and heating device (4), detect box (1) upper end opening, be provided with support ring (5) in the upper end, prefabricated pipe of PCR reaction (2) fixed connection is on support ring (5) and the through-hole at middle part lower extrusion support ring (5) center down, fluorescence probe (3) fixed connection just is just to prefabricated pipe of PCR reaction (2) lower convex part at the lower terminal surface of support ring (5), heating device (4) are installed to prefabricated pipe of PCR reaction (2) middle part below, heating device (4) fixed connection is in detecting box (1).
2. The portable PCR detection apparatus of claim 1, wherein: the PCR reaction prefabricated tube (2) comprises a reaction tank (201) and a connecting support sheet (202) which are made of transparent materials, the upper end of the reaction tank (201) is open, the connecting support sheet (202) is arranged on the periphery of the edge of the opening, an outward-protruding elastic arc-shaped extrusion sheet (203) is further arranged at the upper end of the reaction tank (201), a conical extrusion part (204) with a large upper part and a small lower part is arranged in the middle of the elastic arc-shaped extrusion sheet (203), and a sealing film (205) is arranged at the opening at the lower end of the.
3. The portable PCR detection apparatus according to claim 2, wherein: the periphery of the conical extrusion part (204) is provided with a collecting groove (206).
4. The portable PCR detection apparatus according to claim 2, wherein: the reaction tank (201) is in a conical shape with a small top and a big bottom.
5. The portable PCR detection apparatus according to claim 2, wherein: the reaction tank (201) is made of transparent polyethylene plastic.
6. The portable PCR detection apparatus of claim 1, wherein: a temperature sensor (6) is arranged at the outlet of the heating device (4).
7. The portable PCR detection apparatus of claim 1, wherein: the upper end of the detection box (1) is covered with a box cover (7).
8. The portable PCR detection apparatus of claim 1, wherein: the fluorescent probe (3) and the heating device (4) are connected to a controller, and the controller is connected with a temperature sensor (6).
9. The portable PCR detection apparatus of claim 8, wherein: the controller is connected to the user terminal through the Bluetooth module, the user terminal is connected to the cloud server, and the cloud server is connected to the management mechanism terminal.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202020864429.6U CN212800301U (en) | 2020-05-21 | 2020-05-21 | Portable PCR detection device |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202020864429.6U CN212800301U (en) | 2020-05-21 | 2020-05-21 | Portable PCR detection device |
Publications (1)
Publication Number | Publication Date |
---|---|
CN212800301U true CN212800301U (en) | 2021-03-26 |
Family
ID=75092026
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202020864429.6U Active CN212800301U (en) | 2020-05-21 | 2020-05-21 | Portable PCR detection device |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN212800301U (en) |
-
2020
- 2020-05-21 CN CN202020864429.6U patent/CN212800301U/en active Active
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US11465142B2 (en) | Multiplexed biological assay device with electronic readout | |
CN107340154B (en) | Device for sampling water body and working method thereof | |
US20230278030A1 (en) | Multiplexed Biological Assay Device with Electronic Readout | |
CN206431040U (en) | A kind of Automatic On-line ammonia Nitrogen Analyzer | |
CN104713816A (en) | Whole blood CRP detection apparatus, method thereof, and blood cell analyzer | |
CN103808948A (en) | Micro-fluidic chip system and method for pesticide residue field detection | |
KR20150092265A (en) | Systems, devices, and methods for bodily fluid sample collection and transport | |
CN103353513A (en) | Liquid path system based on unit metering and use method thereof | |
WO2009083975A3 (en) | Small molecules and protein analysis devices based on molecular imprinted polymers | |
ATE391918T1 (en) | DEVICE FOR ANALYZING SAMPLES | |
CN101876661A (en) | Device for analyzing analyte in liquid sample | |
US20230295700A1 (en) | Microfluidic nucleic acid detection kit and detection device | |
WO2007126668A3 (en) | Urine analysis collection kit for veterinary use | |
CN1847849A (en) | Real-time body blood viscosity measuring instrument | |
CN212800301U (en) | Portable PCR detection device | |
CN115703990A (en) | Micro amplification instrument, reactor and pocket type quick detection equipment | |
CN203479793U (en) | Liquid path system based on unit measure | |
CN105738361B (en) | Permanganate index automatic analyzer and analysis method in water | |
CN101315315A (en) | Single-pump double-gas path sampling device | |
CN216513849U (en) | Closed nucleic acid detection device | |
CN215506829U (en) | Rapid detection reaction reagent tube | |
CN111504972A (en) | PCR sampling detection device | |
CN208206546U (en) | A kind of sampler convenient for Locale Holding water sample | |
CN212504889U (en) | PCR reaction prefabricated pipe | |
CN204142520U (en) | A kind of novel water quality collector |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
GR01 | Patent grant | ||
GR01 | Patent grant |