CN212504889U - PCR reaction prefabricated pipe - Google Patents

Abstract

The utility model discloses a prefabricated pipe of PCR reaction, including transparent material's retort and joint support piece, retort upper end opening, opening edge a week sets up the joint support piece, and the retort upper end still is provided with the elasticity arc extrusion piece of evagination, and elasticity arc extrusion piece middle part is provided with big-end-up's toper extrusion portion, and toper extrusion portion lower extreme opening part sets up the sealing membrane. The utility model discloses a transparent material's retort holds detect reagent in the retort, adopts behind the first sample collection sample of sampling test paper of cotton swab head form and adopts the protection of protection liquid to it, and the sampling test paper head after the protection pushes away the toper extrusion portion and impales sealing film and carries out the extrusion, will protect the sample and extrude into the retort reaction, can realize that the protection sample of maximum extrudes into the retort, improves reaction effect and detection accuracy nature.

Description

PCR reaction prefabricated pipe

Technical Field

The utility model relates to a prefabricated pipe of PCR reaction belongs to the prefabricated pipe technical field of PCR reaction.

Background

The PCR system reaction tube based on the pathogen gene detection is generally prepared at present, and a sample needs to be added in the operation under a low-temperature environment, and meanwhile, the long-time storage cannot be realized. In the original pathogen detection, operations such as elution and the like are required for the pathogen, time and labor are consumed, and the detection time cost and the economic cost are increased by phase change; meanwhile, pathogens are directly exposed in the environment, so that sample pollution is easily caused, and meanwhile, the pathogens can bring biological safety threats to testers.

Disclosure of Invention

The to-be-solved technical problem of the utility model is: provides a PCR reaction prefabricated tube to solve the problems in the prior art.

The utility model discloses the technical scheme who takes does: the utility model provides a prefabricated pipe of PCR reaction, includes transparent material's retort and connection backing sheet, retort upper end opening, opening edge a week sets up the connection backing sheet, and the retort upper end still is provided with the elasticity arc extrusion piece of evagination, and elasticity arc extrusion piece middle part is provided with big-end-up's toper extrusion portion, and toper extrusion portion lower extreme opening part sets up sealing membrane.

Preferably, a collecting groove is formed around the tapered squeezing portion.

Preferably, the reaction tank is tapered in a large upper part and a small lower part.

Preferably, the reaction tank is made of transparent polyethylene plastic.

The utility model has the advantages that: compared with the prior art, the utility model discloses an effect as follows:

(1) the utility model adopts the reaction tank made of transparent material, the reaction tank is filled with detection reagent, the sampling test paper head in the shape of a cotton swab head is adopted to collect a sample and is protected by protection liquid, the sampling test paper head after protection is pushed into the conical extrusion part to pierce the sealing film and extrude the sealing film, the protection sample is extruded into the reaction tank for reaction, the maximum amount of the protection sample can be extruded into the reaction tank, and the reaction effect and the detection accuracy are improved;

(2) the flow collecting groove is arranged, so that the extruded protection sample can conveniently flow into the reaction tank, and the reverse suction into the sampling test paper is avoided;

(3) the upper part is of a conical structure with a large upper part and a small lower part, so that the mixing of trace liquid drops is facilitated, and the detection precision is improved.

Drawings

Fig. 1 is a schematic structural view of the present invention;

fig. 2 is a schematic view of the cross-sectional structure of the conical extrusion portion in plan view.

Detailed Description

The present invention will be further described with reference to the accompanying drawings and specific embodiments.

Example 1: as shown in figures 1-2, a PCR reaction prefabricated tube comprises a reaction tank 1 and a connection support sheet 2 made of transparent materials, the upper end of the reaction tank 1 is open, the connection support sheet 2 is arranged on the periphery of the edge of the opening, an outward-protruding elastic arc-shaped extrusion sheet 3 is further arranged on the upper end of the reaction tank 1, a conical extrusion part 4 with a large upper part and a small lower part is arranged in the middle of the elastic arc-shaped extrusion sheet 3, a sealing film 5 is arranged on the opening at the lower end of the conical extrusion part 4, a collecting groove 6 is arranged around the conical extrusion part 4, the reaction tank 1 is conical with a large upper part and a small lower part, the reaction tank 1 is made of transparent polyethylene plastics, a detection reagent is contained in the reaction tank, a cotton swab-shaped sampling test paper head 7 is used for collecting samples and then adopting a protective solution to protect the samples, the protected sampling test paper head is pushed into the conical extrusion part to pierce the sealing, the maximum amount of the protection sample can be extruded into the reaction tank, and the reaction effect and the detection accuracy are improved.

The PCR prefabricated tube is based on the idea of integrating sample pretreatment, elution and reaction, is matched with a sampler and a PCR instrument for use, is preloaded with a reaction reagent, and is matched with a specially-made bayonet to elute a sample, so that the rapid detection is realized.

The utility model has the advantages of as follows:

1) the reagent can be commercialized, and the reagent of the PCR reaction system is filled into a tube under the low-temperature protection condition, and is stored at low temperature according to the test groping condition and can be used at any time;

2) can be used for detecting various diseases. According to the detection requirements, different primers can be pre-loaded for different pathogeny and disease detection, and different disease and pathogen detection can be carried out;

3) the sample is eluted. The sampling cotton swab is directly inserted into the prefabricated pipe for extrusion, and then the sample treatment liquid soaked by the cotton swab is mixed with the sample mixture in the pipe for repeated extrusion, so that the sample recovery efficiency is ensured;

4) is disposable. After the sample destroying device is used, the sample destroying function of the sampler is used, so that the sampling reagent is thoroughly destroyed, and the biological safety is ensured.

The PCR reaction prefabricated tube (rapid detection kit) uses prefabricated mixing, and the industrial production sample mixing is carried out in a nitrogen closed gas system in sequence in a cold chain transportation and storage mode. The reagent is prepared and packaged by using a PCR tube, a primer, dNTP, Taq DNA polymerase and a reaction buffer solution system are formed, a 20 mu L reaction system and a 31 mu L reaction system are developed at present according to the quality guarantee period of each component, and the specific components and the compositions are as follows:

table 1: 20 mu L prefabricated PCR reaction tube ingredient list

TABLE 2 composition Table of 26. mu.L prefabricated PCR reaction tubes

At present, the recommended primers are adopted as primers for detecting the novel coronavirus, and the sequences are as follows:

target one (ORF 1 ab):

forward primer (F): CCCTGTGGGTTTTACACTTAA

Reverse primer (R): ACGATTGTGCATCAGCTGA

Fluorescent probe (P): 5'-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3'

Target two (N):

forward primer (F): GGGGAACTTCTCCTGCTAGAAT

Reverse primer (R): CAGACATTTTGCTCTCAAGCTG

Fluorescent probe (P): 5'-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3'

As the PCR tube is a prefabricated tube, the effective period is the key content of the current experiment. And (3) placing the prefabricated PCR tube in liquid nitrogen for quick freezing, then transferring the tube to-20 ℃ for long-term storage, and performing an expiration date test and a stability test.

The utility model discloses a prefabricated pipe is convenient for cooperate heating chip and fluorescence equipment to detect to have the portability, this prefabricated pipe is used for the prefabricated intensive mixing of preserving of reaction liquid and being convenient for after the sample adds.

The above description is only for the specific embodiments of the present invention, but the protection scope of the present invention is not limited thereto, and any person skilled in the art can easily think of the changes or substitutions within the technical scope of the present invention, and all should be covered within the protection scope of the present invention, therefore, the protection scope of the present invention should be subject to the protection scope of the claims.

Claims (4)

1. A PCR reaction prefabricated tube is characterized in that: the reaction tank comprises a reaction tank (1) and a connecting support sheet (2), wherein the reaction tank (1) is made of transparent materials, the upper end of the reaction tank (1) is provided with an opening, the connecting support sheet (2) is arranged on the periphery of the edge of the opening, an outward-protruding elastic arc-shaped extrusion sheet (3) is further arranged at the upper end of the reaction tank (1), a conical extrusion part (4) with a large upper part and a small lower part is arranged in the middle of the elastic arc-shaped extrusion sheet (3), and a sealing film (5).

2. The pre-fabricated tube for PCR reaction of claim 1, wherein: the periphery of the conical extrusion part (4) is provided with a collecting groove (6).

3. The pre-fabricated tube for PCR reaction of claim 1, wherein: the reaction tank (1) is in a conical shape with a large upper part and a small lower part.

4. The pre-fabricated tube for PCR reaction of claim 1, wherein: the reaction tank (1) is made of transparent polyethylene plastic.

Images