CN1911961B - Application of paddy rice flower meristem control gene EG1 - Google Patents
Application of paddy rice flower meristem control gene EG1 Download PDFInfo
- Publication number
- CN1911961B CN1911961B CN2006100531805A CN200610053180A CN1911961B CN 1911961 B CN1911961 B CN 1911961B CN 2006100531805 A CN2006100531805 A CN 2006100531805A CN 200610053180 A CN200610053180 A CN 200610053180A CN 1911961 B CN1911961 B CN 1911961B
- Authority
- CN
- China
- Prior art keywords
- gene
- ala
- rice
- gly
- val
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention discloses one kind of rice bloom meristem controlling gene EG1 coded protein with the amino acid sequence as shown in SEQ ID No. 2; the protein coding gene with the nucleotide sequence as shown in SEQ ID No. 1; plant expression vector containing the said gene and transgenic plant cell containing the said gene; and the method of improving rice bloom meristem. The method includes transforming rice cell with gene containing the nucleotide sequence of SEQ ID No. 1, and culturing the transformed rice cell into plant. The present invention can improve rice bloom meristem and rice bloom growth and raise rice yield ultimately.
Description
Technical field
The invention belongs to plant genetic engineering field.Specifically, the present invention relates to a kind of map based cloning technology of utilizing and clone paddy rice EG1 (EXTRA GLUME 1) gene, and utilize transgene complementation test to identify the function of this gene; Also relate to simultaneously and utilize this gene thing that paddy rice floral meristem and the growth of spending are improved, improve the output of paddy rice.
Background technology
Paddy rice is one of most important food crop in the world, also is the idealized model plant that monocotyledons grows molecular biology research.Many features that monocotyledonous floral meristem and floral organ are formed obviously are different from dicotyledons (successively form from outside to inside by calyx, petal, stamen and carpel four-wheel floral organ for the flower of dicotyledons).The unit of paddy rice inflorescence meristem is a small ear, and small ear is made up of Xiao Hua and two lepicena, and Xiao Hua is from outside to inside successively by coetonium, inner glume, 2 lodicules, 6 pieces of stamens and 1 gynoecium.In recent years, the growth of floral organ gets more and more people's extensive concerning and becomes one of focus of modern molecular biology research.This is not only because flower is in the central position in growth and development of plant, and the growth course of floral organ provides a very unique system for the relation between the form generation of research gene expression regulation and organ.By the understanding to flower development mechanism, we just can change the growth of floral meristem and flower, the flowering time of control crop by engineered means.Floral organ stamen and the gynoecium of grass are guarded; The homologous organ that lodicule is considered to the dicotyledons petal have also obtained the confirmation of many experimental results.Someone thinks coetonium all is the organ consistent with the dicotyledons calyx with inner glume.Yet coetonium and inner glume there are differences on form, and also different on arranging, and is what kind of concerns between coetonium and inner glume and the dicotyledons floral organ, and is still unclear at present.Therefore, utilize the rice glume mutant, study the molecular regulation mechanism of paddy rice flower development, improve the model of paddy rice flower development, significant.
The present invention utilizes the how clever mutant of paddy rice, has been cloned into the EG1 gene first by the map based cloning technology in paddy rice, and this genes encoding one class lipase albumen is controlled the formation of paddy rice floral meristem, and influences the number of rice flower organ.Lipase is a class lytic enzyme, in plant, in cell metabolism, play an important role by decomposing lipid, also have at present and discover that lipase has the function of control anther dehiscence and postponement leaf senile, but also do not find that lipase influences the report that floral meristem is grown at present.
Summary of the invention
At the technical problem that exists in the prior art, the invention provides a kind of protein and gene thereof that can influence little flower development of paddy rice and fringe bilge construction, and thus obtained transgenic plant cells and the method for utilizing described gene pairs paddy rice Xiao Hua and fringe portion to transform.
The present invention is to realize by such technical scheme for reaching above purpose: a kind of paddy rice flower meristem control gene EG 1 encoded protein matter is provided, and it has the aminoacid sequence shown in the SEQ ID NO:2.
As a kind of improvement of the present invention: above-mentioned aminoacid sequence also is included in and add, replace, insert or delete the derivative that one or more amino acid generate in the aminoacid sequence shown in the SEQ ID No:2.
The present invention also provides a kind of coding above-mentioned two kinds of proteinic genes, and it has the nucleotide sequence shown in the SEQ ID No:1.
As a kind of improvement of the present invention: above-mentioned nucleotide sequence also is included in and add, replace, insert or delete mutant, allelotrope or the derivative that one or more Nucleotide generate in the nucleotide sequence shown in the SEQ ID No:1.
The present invention also provides a kind of plant expression vector that comprises said gene.
The present invention also provides a kind of transgenic plant cells that comprises above-mentioned two kinds of nucleic acid.
The present invention also provides a kind of method that the paddy rice floral meristem is transformed, and comprises that the rice cell after will transforming is again cultivated into plant with the gene transformation rice cell with the nucleotide sequence shown in the SEQID No:1.
Further specifically: the purpose of this invention is to provide a kind of new gene EG1 that from rice mutant extra glume 1, clones, dna sequence dna shown in Fig. 6 and SEQ ID No:1 also comprises the gene order that has 70% homology with the dna sequence dna shown in the SEQ ID No:1 at least.SEQ ID No:2 and protein shown in Figure 7 among the present invention belong to lipase lipase, wherein carry out one or several and replace, and insert or lack the functional analogue that is obtained.In addition, be also included within the mutant, allelotrope or the derivative that add, replace, insert or delete one or more Nucleotide among the SEQ ID No:1 and generate, the sequence with identical function also can reach purpose of the present invention.
Another object of the present invention provides a kind ofly carries out the method for Plant Transformation efficiently with the EG1 gene, specifically, the invention provides gene or the segmental carrier of Gene Partial with SEQ ID No:1 and sequence shown in Figure 6, wherein, pCAMBIA1300-EG1 as shown in Figure 4, this carrier can express above-mentioned nucleotide sequence coded polypeptide or its homology analogue.
The present invention also provides a kind of plant expression vector transformed plant cells of utilizing to influence the method that the paddy rice floral meristem is grown.
Realize that concrete technological step of the present invention is as follows:
One, separation and the genetic analysis of the how clever mutant eg1 of paddy rice:
By a large amount of screening mutant, the present invention has obtained a how clever mutant eg1 of paddy rice, and by testing with wild-type paddy rice reciprocal cross, we have obtained a cryptic mutant that meets the genetic development of single-gene control, as shown in Figure 1.
Two, the EG1 gene of map based cloning control paddy rice floral meristem:
1), the Primary Location of EG1 gene:
In order to separate the EG1 gene, the present invention adopts the method for map based cloning, has at first created a F2 target group, for maternal, selects for use long-grained nonglutinous rice Zhejiang spoke 802 to be recessive individual composition the among the F2 of paternal hybrid acquisition by EG1 homozygote (spending 11 in the japonica rice).And utilize the SSR molecule marker that Primary Location is carried out in the EG1 site and see Fig. 2.Positioning result shows, the EG1 Primary Location at the 1st the short arm of a chromosome between RM1361 and two marks of RM3482.
2), the Fine Mapping of EG1 gene:
By to the BAC sequential analysis between RM1361 and two marks of RM3482, developing new SSR, STS and CAPS mark accurately is positioned EG1 on the BAC P0035F12 between the P4 and P2 mark within about 31kb scope, and be divided into from (Fig. 3) with molecule marker P3, infer candidate gene by analyzing this section open reading frame (ORF).
3), the evaluation of EG1 gene and functional analysis:
By transgenic technology, the result shows that the present invention has obtained to make mutant to recover the transgenic paddy rice (Fig. 5) of normal phenotype, has proved that the present invention has correctly cloned EG1 gene (Fig. 6), and amino acid sequence analysis shows the EG1 class lipase albumen (Fig. 7) of encoding.
China is rice production and consumption big country, along with Increase of population, to the rice demand with in rising trend.But therefore the trend that exists cultivated area to reduce at present press for and cultivate the high-yield rice kind.The development of genetic engineering technique makes that application EG1 gene is adjusted paddy rice flower development mode and the fringe bilge construction becomes possibility.Eg1 of the present invention (extra glume 1) mutant is the single-gene recessive mutation, meets Mendelian's mode genetic development.The eg1 mutant separates acquisition by the present inventor.The present invention obtains the gene EG1 of control floral meristem by the map based cloning technology, and has identified the function of this gene by transgenic function complementation experiment.Thereby the present invention can to the paddy rice floral meristem and the flower growth improve, finally can improve rice yield.
Description of drawings
Fig. 1 be the how clever mutant eg1 of paddy rice with in spend the fringe portion and the Xiao Hua phenotype of 11 wild-types;
Fig. 2 is the Primary Location figure of EG1 gene on paddy rice the 1st karyomit(e);
Fig. 3 is the Fine Mapping of EG1 gene;
Fig. 4 is a pCAMBIA1300-EG1 carrier collection of illustrative plates;
Fig. 5 is function complementation experiment T
0The phenotype of transgenic paddy rice; Wherein eg1 is how clever mutant plant; EG1/eg1 is that T0 is for transgenic rice plant;
Fig. 6 is the dna nucleotide sequence of EG1 gene;
Fig. 7 is the aminoacid sequence of EG1 genes encoding.
Embodiment
Embodiment 1:
1, rice material:
Paddy rice (Oryza sativa ssp.zhonghua11) mutant eg1 (extra glume 1), original wild material spends 11 in being.
2, analysis and target group:
Homozygote eg1 mutant and wild-type kind Zhejiang spoke 802 are hybridized, and F1 obtains F2 colony for selfing, therefrom select 713 eg1 mutant phenotype individualities as target group at heading stage.Every strain at heading stage get 1 the gram about tender leaf, be used for extracting total DNA.
3, by SSR, STS and CAPS mark location EG1 gene:
Adopt the rapid extracting method of paddy rice minim DNA from rice leaf, to extract the genomic dna that is used for the assignment of genes gene mapping.Get about 0.2g paddy rice young leaflet tablet, through liquid nitrogen freezing, pulverize in the little mortar of diameter 5cm is transferred in the 1.5ml centrifuge tube and is extracted DNA, and the DNA resolution of precipitate of acquisition is in 150 μ l ultrapure waters.Each PCR reacts with 2 μ l DNA samples.
In the Primary Location test of EG1 gene, to 80 F
2Individuality carries out ssr analysis.Molecular genetic linkage map according to japonica rice of announcing and long-grained nonglutinous rice establishment, choose the approximate SSR primer that is uniformly distributed on each bar karyomit(e), carry out pcr amplification according to known reaction conditions, separate and bromination second pyridine (EB) dyeing at 5% agarose gel electrophoresis then, detect the polymorphism of PCR product, with the EG1 Primary Location between No. 1 long-armed RM1361 of karyomit(e) and RM3482 mark.
When Fine Mapping EG1 gene, to by 713 strain F
2The individual colony that forms carries out SSR, STS and CAPS analyzes.According to the BAC sequence between molecule marker RM1361 and the RM3482, we have designed 1 STS molecule marker (P4), 1 SSR molecule marker (P3) and 1 CAPS molecule marker (P2), and primer sequence is:
P2U-5’CTGTATGTAGGCAAGACGTGAG3’，P2L-5’TGATTGTTAGGAATGTGTGACTG3’(NdeI?digestion)；
P3U-5’CTCCCTCACTAACTTAACCTGC?3’，P3L-5’AGCCTCGCTCTTCTACCTACA?3’；
P4U-5’AAGAAGAGGGTGTGACAGCC?3’，P4L-5’GTGTGTTCGGTTCACGCTAA?3’。
Utilize these 3 molecule markers to 713 strain F
2Individuality carries out linkage analysis.
5, predictive genes and comparative analysis:
According to the result of Fine Mapping, the EG1 gene is on the BAC clone P0035F12 between P2 and the P4 mark within the 31kb scope.According to Rice Automated Annotation System (
Http:// RiceGAAS.dna.affrc.go.jp) prediction, finding has 2 candidate genes in this interval, design 10 pairs of primers then, adopts PCR method to spend from EG1 and wild-type respectively in 11 the genome and amplifies this two candidate genes, (totally 10 dna fragmentations) carry out sequencing analysis.Find in 1 dna fragmentation of 1 gene wherein, spend 11 a base replacement (T is to A) is relatively arranged in the product of mutant ge1 amplification and the wild-type.With this repeated authentication twice as a result, find mutant eg1 gene with in spend 11 more all to have this base to replace.According to the gene annotation information (NCBI) of BAC clone P0035F12 sequence, find this genes encoding lipase albumen, very high with the gene DAD1 homology of Arabidopis thaliana control anther dehiscence.
Embodiment 2,
Plant Transformation:
BAC is cloned OSJNBa0089G14 BamH I complete degestion, after the electrophoretic separation, the dna fragmentation that extracts 5.1kb is connected among the pCAMBIA1300, and this clone has covered the genome area of whole ORF, comprises the downstream sequence of ATG upstream 804bp promoter sequence and 3506bp.
It is rice transformation among the EHA105 that this plasmid changes Agrobacterium (Agrobacterium tumefaciens) strain over to by the method that shocks by electricity.We utilize mutant rataria inductive callus, after the process inducing culture cultivated for 3 weeks, select the vigorous callus of growth as the acceptor that transforms.Infect rice callus with the EHA105 bacterial strain that contains the double base plasmid vector, under dark, 25 ℃ of conditions, cultivate 3 days altogether after, cultivate containing on the screening culture medium of 40mg/LHygromycin.The screening kanamycin-resistant callus tissue breaks up in advance on the substratum and to cultivate about 10 days containing 50mg/L.The callus of differentiation is in advance gone on the division culture medium and cultivates under illumination condition.Obtain the resistant transgenic plant about one month.Plant is identified and successive is observed, finds that at heading stage the Xiao Hua of fringe portion has recovered normal form, with the mutant of same growth phase relatively, mutant phenotypes such as many grain husks disappear, Xiao Hua recovers normal (Fig. 5).
The above only is several embodiments of the present invention, should be pointed out that the content disclosed by the invention of all distortion can directly derive or associate from to(for) those of ordinary skill in the art, all should think protection scope of the present invention.
Sequence table
SEQ?ID?NO：1
1 atgacgctcc?cgaggcaatg?cgcggcggcg?tgtaggacag?gcggcggcgg?cggcggcgtg
61 gtgcggtgca?gggcggtggc?ggcggcgggt?ggggcggtgg?cggtgaggga?tgcggtggtg
121 gcgccggtgg?cgaggcgagg?ggcggcgagg?aagacggcgg?agacggtggc?ggggatgtgg
181 agggaggtgc?aggggtgcgg?ggattgggag?gggatgctgg?agccggcgcc?gcacccggtg
241 ctgagggggg?aggtggcgcg?gtacggcgag?ctggtgggcg?cgtgctacaa?ggcgttcgac
301 ctggacccgg?cgtcgcggag?gtacctcaac?tgcaagtacg?ggagggagag?gatgctggag
361 gaggtcggga?tgggcggcgc?cgggtacgag?gtcacccgct?acatctacgc?ggcggcggac
421 gtcagcgtgc?cgaccatgga?gccgtcgacg?agcgggcgcg?ggcggtggat?cgggtacgtc
481 gcggtgtcca?ccgacgagat?gtcgcggcgg?ctcgggcggc?gcgacgtgct?cgtctcgttc
541 cggggcacgg?tcacccccgc?cgagtggatg?gccaacctca?tgagctcgct?ggaggcggcg
601 cggctcgacc?cgtgcgaccc?gcgccccgac?gtcaaggtgg?agtccgggtt?cctcagcctc
661 tacacctccg?ccgacaagac?gtgccgcttc?ggcggcgccg?ggagctgccg?ggagcagctc
721 ctccgcgagg?tgtcccgcct?cgtcgccgcc?tactccggcg?gcggcgagga?cgtcagcgtc
781 acgctcgccg?gccacagcat?gggcagcgcg?ctggcgctcc?tctccgccta?cgacctcgcc
841 gagctcggcc?tcaaccgcgc?cgccccggtc?accgtcttct?ccttcggcgg?gccgagggtg
901 gggaacgcgg?cgttcaaggc?gcgctgcgac?gagctcggcg?tcaaggcgct?ccgcgtcacc
961 aacgtacacg?acccgatcac?caagctcccc?ggcgtcttcc?tcaacgaggc?caccgccggc
1021 gtgctccgcc?cgtggcgcca?ctcctgctac?acccacgtcg?gcgtcgagct?ccccctcgac
1081 ttcttcaagg?tcggcgacct?cgcctccgtc?cacgacctcg?ccacctacat?ctccctcctc
1141 cgtggcgccg?acaagaagca?gcccgccgcc?gccgccgccg?acgccggcgg?cgtgctcgcc
1201 aaggtgatgg?acttcgtggg?tcggcggcgc?ggcggcggcg?cattgccgtg?gcacgacgcg
1261 gcgatgatac?agatgggcgg?cttggtgcag?acgctcgggc?taatctga
SEQ?ID?NO：2
1 Met?Thr?Leu?Pro?Arg?Gln?Cys?Ala?Ala?Ala?Cys?Arg?Thr?Gly?Gly
16 Gly?Gly?Gly?Gly?Val?Val?Arg?Cys?Arg?Ala?Val?Ala?Ala?Ala?Gly
31 Gly?Ala?Val?Ala?Val?Arg?Asp?Ala?Val?Val?Ala?Pro?Val?Ala?Arg
46 Arg?Gly?Ala?Ala?Arg?Lys?Thr?Ala?Glu?Thr?Val?Ala?Gly?Met?Trp
61 Arg?Glu?Val?Gln?Gly?Cys?Gly?Asp?Trp?Glu?Gly?Met?Leu?Glu?Pro
76 Ala?Pro?His?Pro?Val?Leu?Arg?Gly?Glu?Val?Ala?Arg?Tyr?Gly?Glu
91 Leu?Val?Gly?Ala?Cys?Tyr?Lys?Ala?Phe?Asp?Leu?Asp?Pro?Ala?Ser
106 Arg?Arg?Tyr?Leu?Asn?Cys?Lys?Tyr?Gly?Arg?Glu?Arg?Met?Leu?Glu
121 Glu?Val?Gly?Met?Gly?Gly?Ala?Gly?Tyr?Glu?Val?Thr?Arg?Tyr?Ile
136 Tyr?Ala?Ala?Ala?Asp?Val?Ser?Val?Pro?Thr?Met?Glu?Pro?Ser?Thr
151 Ser?Gly?Arg?Gly?Arg?Trp?Ile?Gly?Tyr?Val?Ala?Val?Ser?Thr?Asp
166 Glu?Met?Ser?Arg?Arg?Leu?Gly?Arg?Arg?Asp?Val?Leu?Val?Ser?Phe
181 Arg?Gly?Thr?Val?Thr?Pro?Ala?Glu?Trp?Met?Ala?Asn?Leu?Met?Ser
196 Ser?Leu?Glu?Ala?Ala?Arg?Leu?Asp?Pro?Cys?Asp?Pro?Arg?Pro?Asp
211 Val?Lys?Val?Glu?Ser?Gly?Phe?Leu?Ser?Leu?Tyr?Thr?Ser?Ala?Asp
226 Lys?Thr?Cys?Arg?Phe?Gly?Gly?Ala?Gly?Ser?Cys?Arg?Glu?Gln?Leu
241 Leu?Arg?Glu?Val?Ser?Arg?Leu?Val?Ala?Ala?Tyr?Ser?Gly?Gly?Gly
256 Glu?Asp?Val?Ser?Val?Thr?Leu?Ala?Gly?His?Ser?Met?Gly?Ser?Ala
271 Leu?Ala?Leu?Leu?Ser?Ala?Tyr?Asp?Leu?Ala?Glu?Leu?Gly?Leu?Asn
286 Arg?Ala?Ala?Pro?Val?Thr?Val?Phe?Ser?Phe?Gly?Gly?Pro?Arg?Val
301 Gly?Asn?Ala?Ala?Phe?Lys?Ala?Arg?Cys?Asp?Glu?Leu?Gly?Val?Lys
316 Ala?Leu?Arg?Val?Thr?Asn?Val?His?Asp?Pro?Ile?Thr?Lys?Leu?Pro
331 Gly?Val?Phe?Leu?Asn?Glu?Ala?Thr?Ala?Gly?Val?Leu?Arg?Pro?Trp
346 Arg?His?Ser?Cys?Tyr?Thr?His?Val?Gly?Val?Glu?Leu?Pro?Leu?Asp
361 Phe?Phe?Lys?Val?Gly?Asp?Leu?Ala?Ser?Val?His?Asp?Leu?Ala?Thr
376 Tyr?Ile?Ser?Leu?Leu?Arg?Gly?Ala?Asp?Lys?Lys?Gln?Pro?Ala?Ala
391 Ala?Ala?Ala?Asp?Ala?Gly?Gly?Val?Leu?Ala?Lys?Val?Met?Asp?Phe
406 Val?Gly?Arg?Arg?Arg?Gly?Gly?Gly?Ala?Leu?Pro?Trp?His?Asp?Ala
421 Ala?Met?Ile?Gln?Met?Gly?Gly?Leu?Val?Gln?Thr?Leu?Gly?Leu?Ile
Claims (1)
1. a method that improves the paddy rice floral meristem is characterized in that: comprise that the rice cell after will transforming is again cultivated into plant with being the gene transformation rice cell of the nucleotide sequence shown in the SEQ ID No:1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2006100531805A CN1911961B (en) | 2006-08-28 | 2006-08-28 | Application of paddy rice flower meristem control gene EG1 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2006100531805A CN1911961B (en) | 2006-08-28 | 2006-08-28 | Application of paddy rice flower meristem control gene EG1 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1911961A CN1911961A (en) | 2007-02-14 |
| CN1911961B true CN1911961B (en) | 2010-06-16 |
Family
ID=37721038
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2006100531805A Expired - Fee Related CN1911961B (en) | 2006-08-28 | 2006-08-28 | Application of paddy rice flower meristem control gene EG1 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1911961B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107603963A (en) * | 2017-10-18 | 2018-01-19 | 中国水稻研究所 | A kind of rice honeysuckle small ear gene DF1 and its coding protein and application |
-
2006
- 2006-08-28 CN CN2006100531805A patent/CN1911961B/en not_active Expired - Fee Related
Non-Patent Citations (4)
| Title |
|---|
| GenBank Accession No. AP003313.2004, * |
| GeneBank Accession No. BAB89948.2004, * |
| JP特开2003-144170A 2003.05.20 |
| JP特开2005-278499A 2005.10.13 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1911961A (en) | 2007-02-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105602952B (en) | A kind of fertile gene and its application | |
| CN102803291B (en) | There is the plant of the Correlated Yield Characters of enhancing and/or the abiotic stress tolerance of enhancing and prepare its method | |
| CN101765609B (en) | There is the plant of the Correlated Yield Characters of enhancing and the method for the preparation of this plant | |
| US20150267219A1 (en) | Heat-resistance rice gene oszfp, screening marker and separation method thereof | |
| CN104450744B (en) | A kind of paddy rice SBP box transcription factor genes and its application | |
| CN102978221B (en) | A kind of rice tillering and final height-related protein HTDF and encoding gene thereof and application | |
| CN106399323B (en) | A kind of Rice Leaf color controlling gene YL1 and its application | |
| CN103555711A (en) | Non-transgenic genome directed molecule improvement method and application of main crops | |
| CN108864266B (en) | Protein SSH1 related to rice graininess and grain type as well as encoding gene and application thereof | |
| CN105693837A (en) | Rice spikelet development regulation protein, encoding genes MS1 thereof and application | |
| CN100582231C (en) | Use of rice leaf morphogenesis regulatory gene RLAL1 | |
| CN107353332B (en) | Protein and the application of a kind of rice chloroplast developmental regulation Gene A HS1 and its coding | |
| CN113637688A (en) | Rice amylose content regulating gene OsACF1 and application thereof | |
| CN107603963A (en) | A kind of rice honeysuckle small ear gene DF1 and its coding protein and application | |
| CN101857633B (en) | Leaf-shaped control gene SRNL1 of rice and application thereof | |
| CN103172715B (en) | Plant epidermal hair controlling gene and application thereof | |
| CN101778942A (en) | Plants having enhanced yield-related traits and a method for making the same | |
| CN102212122A (en) | Mutant lethal gene for controlling development of rice chloroplasts and application thereof | |
| CN101845086B (en) | Rice leaf-shaped regulatory gene NRL1 and application thereof | |
| CN108570474A (en) | Rice flower development gene EH1 and its application | |
| CN111826391B (en) | Application of NHX2-GCD1 double gene or protein thereof | |
| CN102219839B (en) | Gene SRL-1 for controlling leaf shape of paddy rice and application thereof | |
| CN102477091B (en) | Rice male sterile protein and coding gene and application thereof | |
| CN108441499A (en) | Male fertile related gene HT2925 and its application | |
| CN104911191B (en) | A kind of sterility changing gene FG3 and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20100616 Termination date: 20100828 |