CN1793373A - Process for preparing human leucocyte interleukin 24 by genetic engineering and it expressing carrier and engineering bacterium - Google Patents
Process for preparing human leucocyte interleukin 24 by genetic engineering and it expressing carrier and engineering bacterium Download PDFInfo
- Publication number
- CN1793373A CN1793373A CN 200510057367 CN200510057367A CN1793373A CN 1793373 A CN1793373 A CN 1793373A CN 200510057367 CN200510057367 CN 200510057367 CN 200510057367 A CN200510057367 A CN 200510057367A CN 1793373 A CN1793373 A CN 1793373A
- Authority
- CN
- China
- Prior art keywords
- hil
- hsil
- pet32a
- renaturation
- digestion
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a method used to effectively manufacture genetic engineering human interleukin with certain bioactivity and its expression vector and engineering bacterial. It adopts fusion expression vector to express hIL-24 or hsIL-24 protein. The expression vector is plasmid vector pET32a(+) with hIL-24 or hsIL-24 and their coded sequence is between Kpn1 and BamH1 enzyme cutting sites. The gene enfineering is escherichia coli and transformed to pET32a(+)-hIL-24/BL21 or pET32a(+)-hsIL-24/BL21 by the expression vector. The invention offers complete set technologies of dissolving, renaturation, digestion, and purification. This can make protein expression quantity reach 30%; renaturation rate be over 50%; IL-24 purity be over 95%. And it can be applied to industry large-scale production.
Description
Technical field
The present invention relates to utilize the DNA recombinant technology to produce the field of protein or polypeptide drugs, more specifically, the present invention relates to genetically engineered and prepare human interleukin 24 (human interleukin-24, hIL-24) and the method for mutant hsIL-24, also relate to related expression carriers and engineering bacteria.
Background technology
IL-24 has the effect of significant inhibition tumour, can optionally suppress the kinds of tumors growth, inducing apoptosis of tumour cell comprises Humanmachine tumour, neuroglia blastoma, osteosarcoma, mammary cancer, cervical cancer, colorectal carcinoma, lung cancer, cancer of the stomach, nasopharyngeal carcinoma, prostate cancer etc.This restraining effect does not rely on cancer suppressor genes such as p53, Rb and p16, and to not influence of normal cell.The mechanism that IL-24 suppresses tumour is unclear as yet, thinks that at present antineoplastic effect is very remarkable, becomes the research and development focus of tomour specific medicine by the effect of number of ways performance inhibition tumour.
To be the nineteen ninety-five Paul.B.F of Columbia University subtract hybridizing method with difference to IL-24 finds new and a melanoma differentiation associated gene in melanoma cell cDNA library, be mda-7 (melanoma differentiation-associatedgene 7), and tentative experiment has proved that mda-7 has the ability that suppresses melanoma hyperplasia characteristic and promote the differentiation of whole end in the melanoma process.Mda-7 is studied as tumor inhibitor always subsequently, up to Caudell in 2002 etc. with a series of experiment confirm the cytokine attribute of mda-7, proposition renames mda-7 that (interleukin-24 IL-24), belongs to IL-10 family into interleukin 24.
The IL-24 gene is positioned at human chromosome 1q32.2-1q41, and 7 exons and 6 introns are arranged.The IL-24 full length mRNA is 1975bp (GENEBANK NM_006850).IL-24 has 206 amino acid, and wherein 48 amino acid are arranged is signal peptide for N end, and guiding IL-24 is secreted into the extracellular functionating.The IL-24 molecular weight of band signal peptide is 23.8kD, the molecular weight 18.4kD of maturation protein.
There is higher tissue specificity in being expressed in of IL-24 in people's cell, be mainly immunocyte subgroup, comprise monocyte and T cell normal or that LPS stimulates, further the hypotype classification shows that the CD19+ of about 15-20% and the CD56+ of 50-80% are that the IL-24 expression is positive.IL-24 all has expression in eumelanin cell and initial stage melanoma cell, the expression that develops IL-24 along with melanoma reduces gradually, and almost detects the expression less than IL-24 in melanomatous transfer with between infiltration stage.In the tumor cell line of more than 50 Different Origin, all do not measure the IL-24 protein expression.The IL-24mRNA that studies show that of Vincenti etc. can be by proinflammatory cytokine---interleukin-1 ' beta ' is induced strong rise, hint IL-24 be early stage responsive genes have response stress function.
IL-24 inducing apoptosis of tumour cell and change mitochondrial permeability, and the content of plastosome related apoptosis regulatory factor is relevant with ratio.In the NSCLC Subcutaneous tumor of p53 wild-type and p53 defective type, adenovirus mediated IL-24 crosses to express and causes that significant tumor growth suppresses.Compare with the control group tumour, the tumor group entity that Ad.IL-24 or IL-24 plasmid transform is littler, vasculogenesis still less, hint IL-24 has anti-angiogenic activity.The blood vessel quantity of Ad.IL-24 transfection tumour obviously reduces in lung cancer model, and apoptosis quantity increases.Data presentation vascular endothelial growth factor (VEGF) and transforming growth factor (TGF-β) downward modulation.IL-24 can suppress the lung tumor growth on the mouse heteroplastic transplantation model, and tumor microvessel density and content of hemachrome reduce, and shows that IL-24 has tumor-blood-vessel growth and suppresses active.
IL-24 can induce multiple signal path for transformation such as p38MAPK, PKR and STAT3, and wherein p38MAPK and PKR are that the IL-24 mediated apoptosis is essential.Cause expression amount change, the phosphorylation of apoptosis-related protein or relate to the activation of death receptor Fas/FADD approach, finally cause tumour cell selectivity apoptosis.From people's placenta genomic library, separate the IL-24 promoter region.A plurality of AP-1 and C/EBP transcription factor recognition site are identified in the GCG sequential analysis, and the ectopic expression of AP-1/cJun or C/EBP can significantly improve the expression of melanoma cell IL-24 promotor, confirm IL-24 gene regulating mechanism.
The endogenous expression of iNOS strengthens and promotes melanomatous generation, invasion and attack and transfer.NO has that tumour promotes and suppress double effect, depends on the interaction of other molecule in partial NO concentration and NO and the tumour, and most important may be cytokine in the tumor microenvironment.The Ad.IL-24 transfection is after malignant melanoma, and IL-24 expression will reduction iNOS expresses, and the melanoma cell of handling with recombinant human il-2's 4 albumen also causes the iNOS down-regulated expression, shows that IL-24 expresses and tumour iNOS expression is negative correlation.
G in cell cycle in the K-1735 of Ad.IL-24 transfection and the NSCLC clone
2/ M phase cell proportion increases, and does not have cell cycle arrest in normal black cell and endotheliocyte, illustrates that Ad.IL-24 can block the carrying out of tumour cell cycle, and to the not influence of Normocellular cell cycle.
Introgen company and the cooperation research and development gene therapy preparation Ad.IL-24 of University of Texas (commodity are called INGN 241) have entered the II clinical trial phase, and its internal and external test and clinical experiment have all confirmed the significant antitumous effect of IL-24.But by adenovirus mediated IL-24 transient expression in tumour cell, the effect of cell death inducing is very remarkable, and existing problems one are the securities of adenovirus, the 2nd, and action effect is of short duration, uses clinically to be restricted.Two pieces of documents are arranged at home, and one piece is transient expression in the COS cell, and the effect of its cell death inducing is remarkable, but also has the action effect transient problems, uses clinically to be restricted; Though another piece of writing is used intestinal bacteria and is expressed IL-24 albumen, has a big obstacle---its inclusion body protein dissolving renaturation is very difficult, does not carry out follow-up experimental study and the checking of its biologic activity.
Along with the further investigation of IL-24 inducing apoptosis of tumour cell mechanism and the one side of carrying out in a deep going way of inside and outside test and clinical experiment have affirmed that the IL-24 selectivity suppresses the function of tumor growth, the potential applicability in clinical practice of IL-24 is more and more wide on the other hand, expanded its range of application, also shown heavy demand simultaneously IL-24.So, become inevitable by the better bioactive recombinant human il-2 4 of genetic engineering means scale operation high purity.
Have to studies confirm that the IL-24 that non-glycosylated back is modified has the ability of selective induction apoptosis of tumor cells equally, this just provides theoretical basis for the activated IL-24 of prokaryotic expression.
Summary of the invention
Purpose of the present invention just provides a kind of preparation efficiently and has certain bioactive genetically engineered human interleukin 2's 4 method, and related expression carriers and engineering bacteria.
A first aspect of the present invention, a kind of expression vector of genetically engineered human interleukin 24 is provided, this carrier is for containing the plasmid vector pET32a (+) of human interleukin 24 gene order (IL-24) or human interleukin 24 transgenation sequence (sIL-24), and hIL-24 or hsIL-24 encoding sequence are positioned on pET32a (+) carrier between the Kpn1 and BamH1 restriction enzyme site.This expression vector is pET32a (+)-hIL-24 or pET32a (+)-hsIL-24, and its building process as shown in Figure 1.
A second aspect of the present invention provides a kind of genetic engineering bacterium, and it is intestinal bacteria (Escherichia coli) BL21 (DE) (purchasing NOVEGA company), and expression vector described by the present invention transforms.This genetic engineering bacterium is pET32a (+)-hIL-24/BL21 or pET32a (+)-hsIL-24/BL21.
A third aspect of the present invention provides a kind of method of expressing gene engineering human interleukin 24, and this method comprises:
A) gene recombination engineering bacteria pET32a (+)-hIL-24/BL21 or pET32a (+)-hsIL-24/BL21 fermentor tank high density fermentation;
A) centrifugal collection bacterium;
B) washing and dissolving inclusion body, the solubilization of inclusion bodies liquid formula is 10mmol/L Tris-Hcl, 5mmol/L EDTA, 8mol/L urea, pH 9.0;
C) renaturing inclusion bodies: under 4 ℃ of stirring condition, slowly drip the renaturation buffer I of 10-20 times of volume, 4 ℃ are stirred renaturation 24h, if the renaturation buffer II of 10-20 times of volume again, fully behind the mixing, 4 ℃ are stirred renaturation 24h.The prescription of renaturation buffer I is 10mmol/L Tris-Hcl, 0.9mmol/L gsh oxidized form, and 0.8mmol/L gsh reduced form, pH 8.5.The prescription of renaturation buffer II is 10mmol/L Tris-HCl, 1mmol/L EDTA, pH8.0;
D) ultrafiltration and concentration 100-400 doubly;
E) fusion rotein Trx-hIL-24 or the hydrolysis of Trx-hsIL-24 enteropeptidase: adjusting total protein concentration with the digestion damping fluid is 2-8mg/ml, press albumen weight ratio 1: 300-1: 400 add enteropeptidase, digest fusion rotein down at 16 ℃-25 ℃, time is 24-32h, preparation hIL-24 or hsIL-24 albumen.The prescription of digestion damping fluid is 10mmol/LTris-HCl, pH8.0;
F) affinitive layer purification;
G) gel permeation chromatography desalination;
H) evaluation of target protein hIL-24 or hsIL-24;
I) activity experiment of target protein hIL-24 or hsIL-24 inducing apoptosis of tumour cell: MTT colorimetric method for determining tumor cell proliferation situation; DNA ladder experiment; The flow cytometer quantitative analysis.
The present invention selects for use fusion expression vector to express hIL-24 or hsIL-24 albumen first, it is advantageous that: the one, can utilize the molecular chaperones in the fusion expression vector---the function of Trx (oxygen is sulfoprotein also), Trx has the function such as stable that promotes that target protein is correctly folding and help target protein; The 2nd, can utilize the purification tag of the 6xHis of fusion rotein, very be beneficial to follow-up purifying process; The 3rd, can utilize enteropeptidase (enterokinase) digestion to obtain complete IL-24, for avoiding introducing Ala and two unnecessary amino acid of Met (any one amino acid whose variation all may cause its activity change for interleukin-) at the N end, in design coding base with enteropeptidase recognition site during primer, promptly add black italicized item, join in the upstream primer.Biological activity test has confirmed that the present invention can the highly purified IL-24 of efficient production, has confirmed that also the IL-24 of the present invention's preparation has good biologic activity.This is one of innovative point of the present invention.
For albumen with inclusion body form amalgamation and expression, efficient production and purifying obtain the target protein that high purity has inducing apoptosis of tumour cell---and IL-24 is a key point, the expression amount that the invention provides the technology target protein of a complete set of dissolving, renaturation, digestion and purifying can reach 30%, the renaturation yield is greater than 50%, the purity of IL-24 is greater than 95%, and be applicable to industrial mass production fully, this does not at home and abroad report as yet, is two of innovative point of the present invention.The remarkable advantage of technology of the present invention is: first, adopt 2mol/L urea dissolving inclusion body under the pH9.0 condition, be different from conventional 8mol/L urea dissolving solubilization of inclusion bodies condition, can be by improving pH at the albumen that just can fully be soluble and fused than low urea concentration, low urea concentration can reduce the influence to property of protein, has also improved renaturation effect and yield.The second, adopt two-step approach renaturation technology, in renaturation, the pH of protein solution is slowly reduced to the suitableeest working value (pH8.0) of enteropeptidase, avoided big pH value fluctuation to cause separating out of target protein, also guaranteed the effect of renaturation simultaneously.Because renaturation is abundant, target protein obtains the target protein that high purity has inducing apoptosis of tumour cell---IL-24 in next step affinity chromatography of state of renaturation.
Description of drawings
Fig. 1: the design of graphics of recombinant plasmid pET32a (+)-hIL-24 or pET32a (+)-hsIL-24
Fig. 2: the RT-PCR clone of goal gene hIL-24 or hsIL-24
The enzyme of Fig. 3: pET32a (+)-hIL-24 and pET32a (+)-hsIL-24 recombinant expression plasmid is cut evaluation.
Fig. 4: hIL-24 and hsIL-24 gene recombination bacterium abduction delivering PAGE electrophorogram
Fig. 5: fusion rotein Trx-hIL-24 or Trx-hsIL-24 enteropeptidase digestion effect PAGE electrophorogram
Fig. 6: target protein hIL-24 or hsIL-24 purification effect figure
Fig. 7: the hIL-24 of different concns or hsIL-24 are to the influence (MTT colorimetry) of the survival rate of MCF-7 cell
Fig. 8: hIL-24 or hsIL-24 induce the apoptotic DNA ladder of MCF-7 experimental result
Fig. 9: the result of flow cytometer quantitative analysis hIL-24 or hsIL-24 inducing apoptosis of tumour cell
Embodiment
Below in conjunction with drawings and Examples the present invention is further described.
The clone of embodiment 1 human IL-2's 4 encoding gene:
1. extracted total RNA: get healthy each 5mL of people's anticoagulation, collect the tunica albuginea layer with lymphocyte separation medium.Adding RPMI1640 perfect medium and total concn is the ConA of 25mg/L, 37 ℃, and 50mL/L CO
2Hatch 48h, centrifugal collecting cell.RNA extraction agent box extracted total RNA.
2.RT-PCR: with total mRNA is template, and reverse transcription obtains IL-24cDNA, and condition is 30 ℃ of 10s, 50 ℃ of 30s, 99 ℃ of 5s, 5 ℃ of 5s, 1 circulation.
3. the pcr amplification of goal gene: according to a pair of primer of IL-24 sequences Design that GenBank announces, primer is:
P1 5’-
GGTACCGACGACGACGACAAGGCCCAGGGCCAAGAATT(Kpn1)
P2 5’-
GGATCCTTACAGAGCTTGTAGAATTTCTG (BamHI)
For avoiding introducing Ala and two unnecessary amino acid of Met at the N end, the coding base (adding black italicized item) with the enteropeptidase recognition site when the design primer joins in the upstream primer.Adopt following PCR system and program:
In one 500 μ l Eppendorf tubes, add following reagent:
10 * PCR damping fluid (containing magnesium chloride), 5 μ l
dNTPs(10mmol/L) 4μl
Each 1 μ l of upstream and downstream primer (0.025mmol/L)
Taq archaeal dna polymerase (5u/ μ l) 1 μ l
Add deionized water to final volume 50 μ l
Mix the back and add 3 in mineral oil
Reaction conditions: 94 ℃ of pre-sex change are after 5 minutes, and 94 ℃, 90s; 60 ℃, 60s; 72 ℃, 90s, 35 loop cycles, 72 ℃ are extended 10min then.
Amplify human interleukin 24 gene order (hIL-24) or human interleukin 24 transgenation sequence (hsIL-24), the sequence that the dna sequence dna of IL-24 and GENBANK announce is in full accord, the sequence contrast that the dna sequence dna of hsIL-24 and Genbank announce is in the point mutation of same position generation base, and the sequence of nucleic acid is seen sequence table.
4.PCR the clone of product
Adopt TA cloning process clone PCR products, method is seen document [Yang Guizhen: TA clone and double-stranded DNA check order, and introduce the method for a kind of quick clone and analysis PCR product, Chinese Journal of Immunology, 1994,10 (1): 5 for Yu Yongli, numb red brightness].
5.PCR the sequential analysis of product
The TA clone is transformed bacterial strain deliver to company, (J.Sambrook, molecular cloning, the 1989 polyacrylamide gel electrophoresis 1.21-1.32 of press of cold spring harbor laboratory) extract plasmid according to a conventional method, adopt the terminal cessation method of two deoxidations, carry out sequencing inserting fragment.
The pcr amplification effect is as shown in Figure 2:
Show goal gene hIL-24 and hsIL-24 and expectation size basically identical.
The structure of embodiment 2 recombinant expression plasmid pET32a (+)-IL-24 or pET32a (+)-hsIL-24 and the structure and the screening of efficient expression engineering
1. construction of recombinant plasmid
IL-24 or hsIL-24 gene amplification (PCR) product are connected with carrier pMD-18T after reclaiming purifying through 1.0% agarose electrophoresis, glue, and transformed into escherichia coli DH5 α extracts plasmid, cuts with Kpn1 and BamH1 enzyme, and 1.0% agarose gel electrophoresis is identified.
The pMD-18T carrier and the pET-32a (+) that will contain IL-24 or hsIL-24 goal gene cut with Kpn1 and BamH1 enzyme, enzyme is cut product after 1.0% agarose electrophoresis, purpose fragment glue reclaim purifying, connect with ligase enzyme, transformed into escherichia coli DH5 α, extract plasmid, Kpn1 and BamH1 enzyme are cut, and 1.0% agarose gel electrophoresis is identified.Enzyme is cut qualification result as shown in Figure 3:
The endonuclease bamhi size is consistent with design, tentatively proves the construction of recombinant plasmid success.
Relevant operation concrete steps are as follows:
1) plasmid DNA extracting (using Omega company plasmid extraction test kit)
[1] separates good bacterium colony transferred species on the picking flat board in being with corresponding antibiotic LB nutrient solution, 37 ℃ of shaking table overnight incubation.
[2] get bacterium liquid and be sub-packed in the 1.5mL centrifuge tube, the centrifugal 3min of 12000g leaves and takes precipitation.
[3] every pipe adds 100 μ L SolutionI suspension, and mixing fully vibrates.
[4] add 100 μ L SolutionII, soft mixing, ice-water bath 5min.
[5] add 250 μ L SolutionIII, the mixing that gently shakes, room temperature is placed 10min.
[6] 4 ℃, the centrifugal 10min of 12000g move to supernatant in the separator tube.
[7] the centrifugal 1min of 12000g topples over the waste liquid in the collection tube.
[8] add 500 μ L washing buffer in separator tube, the same centrifugal and discard waste liquid in the collection tube.Repeated washing once.
[9] the centrifugal 1min of 12000g volatilizees ethanol fully.
[10] separator tube is placed another clean EP pipe and add a certain amount of TE buffer, 65 ℃ of water-bath 5min, the centrifugal 1min of 12000g.
[11] get a certain amount of elutriant and carry out electrophoresis, all the other place-20 ℃ of preservations standby.
2) agarose gel electrophoresis:
1.0% sepharose, 1 * TAE damping fluid, 120-150mA, electrophoresis 20-40 minute.
50 * TAE storage liquid prescription: 2.0mol/L Tris base, 1.0mol/L NaAc, 0.1mol/L Na
2EDTA; Regulate pH8.3 with Glacial acetic acid.
3) endonuclease reaction of plasmid DNA:
1 μ g plasmid DNA
1 μ l, 10 * damping fluid (seeing Takara company product description)
1 μ l restriction enzyme Kpn1 (10u/ μ l)
1 μ l restriction enzyme and BamH1 (10u/ μ l)
With distilled water polishing to 10 μ l
Mixed back 37 ℃ of incubation 2-3 hours.
4) target DNA of agarose electrophoresis glue reclaims purifying:
Under ultraviolet lamp, observe and downcut the target DNA electrophoresis band on the sepharose, move into 1.5mL EP pipe.
Add Omega company glue and reclaim the DNA binding buffer of test kit, 65 ℃ of water-baths are dissolved gel fully and are kept pH value of solution between 5.0 ~ 6.0.Sol solutions is moved into separator tube, and the centrifugal 1min of 12000g discards the liquid in the collection tube.
Add supporting Washing buffer, the centrifugal 1min of 12000g discards the liquid in the collection tube.Repeated washing 1 time.
The centrifugal 1min of 12000g, another clean 1.5mL EP pipe of separator tube dislocation, the TE buffer of adding certain volume is hatched 10min for 65 ℃, and the centrifugal 1min of 12000g gets a certain amount of electrophoresis, and the UVP ultraviolet scanner detects and reclaims purification effect.5) ligation (using Takara company to connect test kit)
By the concentration of UV spectrophotometer measuring target DNA fragment and carrier segments, be generally 1: 2～10 principle according to external source fragment and carrier mole ratio, design ligation system is as follows:
Target DNA 1 μ L
ligation?solution 5μL
ddH
2O 2～3μL
Total?volume 10μL
16 ℃ connect 12-24h.
6) preparation (CaCl of competence bacteria
2Method)
(1) the aseptic inoculation ring dips in and gets-70 ℃ of frozen bacteriums guarantor kind of liquid, and the trilinear method streak inoculation was cultivated 12～16 hours for 37 ℃ in the LB flat board.
(2) the single colony inoculation of picking is in 2mL LB nutrient solution, and 37 ℃ of shaking tables are cultivated 12～16h.
(3) with the DH5a of incubated overnight in 1% ratio transferred species to the LB nutrient solution, 37 ℃ of shaking tables are cultured to OD
600Be 0.2～0.4 o'clock, the centrifugal 5min of 8000g collects bacterium.
(4) the 0.1M CaCl of adding 1mL precooling
2Resuspended precipitation, ice-water bath 3h.4 ℃ of centrifugal 5min of 8000g abandon supernatant.The 0.1M CaCl that adds 100 μ L precoolings
2Suspend and precipitate, ice-water bath 1h, standby.
7) connecting product transforms
(1) gets competence bacteria liquid 100 μ L, add the ligation product; Ice-water bath 60min, 42 ℃ of water-bath heat-shocked 100s place ice-water bath 1～2min rapidly.
(2) add 100 μ L LB nutrient solutions, 37 ℃ of shaking tables are cultivated 1h.
(3) with the centrifugal 10min of 8000g, mixing precipitated after 100 μ L supernatants were abandoned in suction, respectively got 50 μ L spread plates, 37 ℃ of incubator overnight incubation.
2. efficiently express the structure and the screening of fusion rotein engineering bacteria
To contain recombinant plasmid pET-32a (+) the transformed into escherichia coli BL21 (DE) of IL-24 or hsIL-24 gene and extract the plasmid enzyme restriction evaluation.The plasmid extraction enzyme of the competence bacteria preparation of gene engineering colibacillus BL21, conversion and reorganization bacterium is cut and is identified ditto.
Get and identify that errorless reorganization bacterium is inoculated in 3mL and contains in the LB nutrient solution of Amp 37 ℃ of shaking table overnight incubation.Contain the recombinant bacterial strain of incubated overnight in the LB nutrient solution of Amp in 20mL in 1% ratio transferred species next day, and 37 ℃ of shaking tables were cultivated 2.5 hours, induced 4 hours with IPTG, and SDS-PAGE detects Expression of Fusion Protein form and expression amount, the screening efficient expression strain.
Abduction delivering and phraseology qualification result be as shown in Figure 4:
Swimming lane 1: engineering bacteria pET32a (+)-hIL-24/BL21 induces back (4hr);
Swimming lane 2: engineering bacteria pET32a (+)-hIL-24/BL21 induces preceding (0hr);
Swimming lane 3: engineering bacteria pET32a (+)-hsIL-24/BL21 induces back (4hr);
Swimming lane 4: engineering bacteria pET32a (+)-hsIL-24/BL21 induces preceding (0hr);
Swimming lane 5: empty plasmid bacterium pET32a (+) induces back (4hr);
Swimming lane 6: empty plasmid bacterium pET32a (+) induces preceding (0hr);
Swimming lane 7: protein molecular weight standard (Marker).
Gene recombination bacterium is through the protein expression band of increase is arranged at molecular weight 35KDa place after inducing, and is consistent with the target protein molecular weight.The fermentation of embodiment 3 gene recombination bacteriums
Zymotechnique is as follows:
Adopt German B.Bron 10L fermentor tank, plant the inoculation of daughter bacteria 10% ratio in the fermenting process, keep 70% dissolved oxygen, 37 ℃ of temperature, pH7.0, do not reach at 2 o'clock at A600 and do not add feed supplement, every afterwards 0.5h flow feeding once makes the final concentration of glucose, tryptone and 8% yeast extract be respectively 0.5%, 0.2% and 0.2%.Treat after the 4th feed supplement that glucose concn is reduced at 0.1% o'clock and added IPTG 500 μ mol/L and induce 4h to receive bacterium.
Fermenting process on the batch culture basis of cascade dissolved oxygen control, flow feeding.
The used substratum of fermenting process adds 0.6% yeast leach liquor and 2mg/L ZnCl for improvement M9-CAA substratum on the basis of M9-CAA
24H
2O, 2mg/LCoCl
24H
2O, 4mg/L FeSO
416H
2O, 5mg/L H
3BO
3, 1.6mg/LMnCl
24H
2O, 4mg/L CuSO
4Form.
Reclaim bacterium liquid, 4 ℃ centrifugal (8000g) 15 minutes after the fermentation ends.Supernatant is abandoned in suction, collects bacterium, and the back of weighing is frozen standby.
The result: the 10L zymocyte liquid can be gathered in the crops bacterium weight in wet base 800 grams.
Preparation and the purifying of embodiment 4 target protein hIL-24 or hsIL-24
1. inclusion body extracts: the thalline 200-500g that efficiently expresses is suspended with 1: 10 (W/V) ratio of TE damping fluid, adopt the cell homogenates machine that it is mixed after 4 ℃ of precoolings.Adopting high pressure homogenizer is break bacterium (breaking bacterium 4 ~ 6 times altogether) under the condition of 40-70Mpa at pressure, after broken bacterium finishes, bacterium liquid smear staining takes a morsel, the integrity of microscopically observation of cell guarantees that cytoclasis is complete, subsequently with the centrifugal 25min of 500g, abandon precipitation, with 15, the centrifugal 40min of 000g abandons the supernatant collecting precipitation again.Ratio with 1: 10 (W/V) is respectively washed 2 times with washings A and B respectively.Wash conditions is: 4 ℃ are stirred 20min, and 15, the centrifugal 40min of 000g collects the inclusion body precipitation; At last inclusion body is used the mixed of solubilization of inclusion bodies liquid with 1: 10 (W/V), 4 ℃ are stirred 3h, and 15, the centrifugal 45min of 000g, it is standby to get supernatant.
Inclusion body extracts used damping fluid:
1) TE damping fluid: 20mmol/L Tris, 5mmol/L EDTA, pH 7.5
2) inclusion body washings A:5mmol/L EDTA, 20mmol/L Tris, 1%Triton X-100, pH 7.5
3) inclusion body washings B:20mmol/L Tris, pH 7.5
4) solubilization of inclusion bodies liquid: 1mmol/L EDTA, 20mmol/L Tris, 2mol/L urea (pH 9.0)
2. protein renaturation: under 4 ℃ of stirring condition, slowly drip the renaturation buffer I of 10-20 times of volume, 4 ℃ are stirred renaturation 24h, if the renaturation buffer II of 10-20 times of volume again, fully behind the mixing, 4 ℃ are stirred renaturation 24h.The prescription of renaturation buffer I is 10mmol/L Tris-Hcl, 0.9mmol/L gsh oxidized form, 0.8mmol/L gsh reduced form, pH8.5.The prescription of renaturation buffer II is 10mmol/L Tris-HCl, 1mmol/L EDTA, pH8.0.
3. the ultrafiltration desalination concentrates: carry out ultrafiltration with under 4 ℃ of the above-mentioned renaturation solution, membrane pore size is 10KDa, and volume concentrates 100-400 doubly.Use 10mmol/L Tris-HCL again, it is about 2mg/ml-5mg/ml that pH 8.0 is diluted to protein concentration with it.
4.IL-24 or the preparation of hsIL-24: press albumen weight ratio 1: 300-1: 400 add enteropeptidase, digest fusion rotein down at 16 ℃-25 ℃, and the time is 24-32h, preparation hIL-24 or hsIL-24 albumen.The prescription of digestion damping fluid is 10mmol/L Tris-HCl, pH8.0.The effect of enteropeptidase digestion fusion rotein is seen Fig. 5:
Swimming lane 1: engineering bacteria pET32a (+)-hIL-24/BL21 abduction delivering fusion rotein Trx-hIL-24;
Swimming lane 9: stream is worn 10 times of peak partial concentration;
Swimming lane M: protein molecular weight standard (Marker).
Fusion rotein Trx-hIL-24 or Trx-hsIL-24 are digested to two polypeptide segments by enteropeptidase, one is the purification tag that Trx section (theoretical molecular is 20KDa) contains 6 His, on the nickel ion affinity chromatograph post, can then be eluted, appeared in the elution peak by affine absorption; One is the purification tag that IL-24 section (theoretical molecular is 18.3KDa) does not contain 6 His, can not be adsorbed onto on the nickel ion affinity chromatograph post, appears at stream and wears in the peak.Experimental result is consistent with design, and Trx and hIL-24 two portions water fully separates, and goes on foot nickel ion affinity chromatograph through one and can obtain purity greater than 95% hIL-24.
5. nickel ion affinity column purifying: XK16/10 Chelating Sepharose Fast Flow nickel ion affinity column chromatography filler: sample-loading buffer is 20mmol/L Tris-HCL, and pH 8.0; Last sample Tot Prot is about 30mg; Elution buffer is 20mmol/L Tris-HCL, the 20mmol/L imidazoles, and pH 8.0.Wash with sample-loading buffer stream behind the upper prop, treat that stream is worn the peak and occurred and be washed till baseline after, 30min, 0-50% gradient elution.Collect stream respectively and wear the cut of peak and elution peak, the protein affinity purification process is seen Fig. 6:
Peak
0: stream is worn the peak
Peak
1: elution peak
HIL-24 or hsIL-24 that fusion rotein Trx-hIL-24 or Trx-hsIL-24 obtain through enteropeptidase digestion with nickel ion affinity chromatograph post single stage method purifying, all wear in the peak at stream and flow out, and obtain the purity more than 95%, and the rate of recovery of target protein is about 70%.
6.Superdex gel permeation chromatography purifying: with gel-filtration column Superdex purifying, with gel-filtration level pad balance.
7. purified target protein is carried out SDS-PAGE, examines and determine its purity.The Lowry method detects protein concentration.
The activity experiment of embodiment 6 target protein hIL-24 or hsIL-24 inducing apoptosis of tumour cell
It is MCF-7 (breast cancer cell is purchased in ATCC) that anti-tumor activity is tested used tumour cell.
The tumor cell culture base is the PRIM1640 (GIBCO company) that contains 1% calf serum, and trypsin is a promega company product).
Anti-tumor activity experiment relates to albumen hIL-24 or hsIL-24, and it is 7.2 standby regulating the pH value with NaOH.
The anti-tumor activity experiment comprises three aspects:
I.MTT colorimetric method for determining tumor cell proliferation situation: the logarithmic phase cell inoculation treats that cell quantity reaches 10 in 96 orifice plates
3-10
4Individual/ml, behind the hIL-24 or hsIL-24 albumen processing 24h with various dose, every hole adds 25 μ l MTT solution (final concentration 1mg/ml), 37 ℃ are continued to cultivate 4h down, every hole adds 100 μ l 20%DMF again, place 20h for 37 ℃, measure its absorbance value (OD value) at the 570nm place with the micropore microplate reader.The protein concentration that adds on 96 orifice plates is respectively 1,2,4,8,16 and 32mg/L, and the albumen hIL-24 of MTT colorimetric method for determining various dose or hsIL-24 are to the influence of MCF-7 cell proliferation.The result shows that albumen hIL-24 or hsIL-24 are dose-dependently to the growth-inhibiting of breast cancer cell MCF-7, and two kinds of albumen do not have notable difference.Experimental group (hIL-24) has significant difference (P＜0.05) with negative control group, see Fig. 7: the MTT test-results shows, behind the hIL-24 of various dose or the hsIL-24 albumen effect 24h, growth-inhibiting to the MCF-7 cell increases with the increase of handling concentration, reached 50% during the 8mg/L treatment group, had the significant cytotoxicity effect.
Ii.DNA ladder experiment: logarithmic phase cell 10
6-10
7Individual/ml, behind the albumen hIL-24 or hsIL-24 processing 24h with 30ng/ml, after 0.25% trysinization, PBS or physiological saline are washed once, the centrifugal 1-2 of 1000-2000g minute, abandon supernatant, collecting cell.After sample preparation finishes, add 5 microlitre Proteinase Ks, mixing in per 1 ml sample lysate.For the above-mentioned sample of handling well, per 5 milligrams of tissues or 10
6Add the sample dissociation liquid that 500 microlitres have added Proteinase K in the individual cell, Vortex mixing, fully cracking tissue or cell.50 ℃ of water-bath digestion are spent the night.Add 500 microlitre Tris balance phenol extracting samples.Adding behind the Tris balance phenol can Vortex, or acutely puts upside down or rock 10-30 second so that phenol mutually and water fully interact.4 ℃ then, centrifugal 5 minutes of about 12000g.Sucking-off phenol reaches intermediate phase (can absorb a small amount of aqueous phase liquid near intermediate phase) mutually, and extracting is once again with equal-volume Tris balance phenol for remaining water.Sucking-off phenol reaches intermediate phase (can absorb a small amount of aqueous phase liquid near intermediate phase) mutually, the remaining water equal-volume chloroform about 300 microlitre supernatant liquors of a sucking-off of extracting again, add 60 microlitre 10M ammonium acetates and 600 microlitre dehydrated alcohols, put upside down mixing for several times, this moment, visible DNA precipitation produced.-20 ℃ frozen 1 hour, with abundant precipitation small pieces DNA.12, centrifugal 10 minutes of 000g abandons supernatant.Add 70% washing with alcohol DNA precipitation once.Absorb remaining ethanol as far as possible, wait can't see tangible liquid, add 50-100 microlitre TE dissolving DNA immediately.Get the genomic dna that the part extracting obtains,, just observe typical DNA ladder, see Fig. 8 if carry out electrophoretic analysis cell generation apoptosis in the 1.5%-1.8% sepharose:
Swimming lane 1: negative control group
Swimming lane 2:hIL-24 experimental group
Swimming lane 3:hsIL-24 experimental group
Swimming lane 4: positive controls
In the DNA agarose gel electrophoresis, hIL-24 or hsIL-24 induce the DNA of MCF-7 cell typical scalariform band (DNA ladder) all to occur, with control cells obvious difference are arranged.Because the appearance of DNA ladder is the features of apoptosis variation, confirm that further sTRAIL41～281 have induced classical apoptosis.
Iii. flow cytometer quantitative analysis apoptosis of tumor cells logarithmic phase cell 10
6-10
7Individual/ml, behind the hIL-24 or hsIL-24 albumen processing 24h with various dose, earlier with 0.25% trysinization, wash 2 times with PBS, Annexin-V (20ug/ml) 10ul that adds 100ul Binding Buffer and FITC mark, room temperature lucifuge 30min, add PI (50ug/ml) 5ul again, behind the lucifuge reaction 5min, add 400ul BindingBuffer, carry out flow cytometry detection by quantitative (generally being no more than 1h) with FACScan immediately, simultaneously with the pipe that do not add AnnexinV-FITC and PI as negative control.The result shows that albumen hIL-24 or hsIL-24 are dose-dependently to the growth-inhibiting of breast cancer cell MCF-7, and two kinds of albumen do not have notable difference, and experimental group and negative control group have significant difference, see Fig. 9.
Sequence table
＜110〉Military Medical Univ No.3, P.L.A
＜120〉method of yeast cell to express human interleukin 24
<160>3
<210>1
<211>473
<212>DNA
＜213〉human interleukin 24
<400>1
cagggccaag?aattccactt?tgggccctgc?caagtgaagg?gggttgttcc?ccagaaactg 60
tgggaagcct?tctgggctgt?gaaagacact?atgcaagctc?aggataacat?cacgagtgcc 120
cggctgctgc?agcaggaggt?tctgcagaac?gtctcggatg?ctgagagctg?ttaccttgtc 180
cacaccctgc?tggagttcta?cttgaaaact?gttttcaaaa?actaccacaa?tagaacagtt 240
gaagtcagga?ctctgaagtc?attctctact?ctggccaaca?actttgttct?catcgtgtca 300
caactgcaac?ccagtcaaga?aaatgagatg?ttttccatca?gagacagtgc?acacaggcgg 360
tttctgctat?tccggagagc?attcaaacag?ttggacgtag?aagcagctct?gaccaaagcc 420
cttggggaag?tggacattct?tctgacctgg?atgcagaaat?tctacaagct?ctg 473
<210>2
<211>473
<212>DNA
＜213〉has the human interleukin 24 of a base mutation
<400>2
cagggccaag?aattccactt?tgggccctgc?caagtgaagg?gggttgttcc?ccagaaactg 60
tgggaagcct?tctgggctgt?gaaagacact?atgcaagctc?aggataacat?cacgagtgcc 120
cggctgctgc?agcaggaggt?tctgcagaac?gtctcggatg?ctgagagctg?ttaccttgtc 180
cacaccctgc?tggagttcta?cttgaaaact?gttttcaaaa?accaccacaa?tagaacagtt 240
gaagtcagga?ctctgaagtc?attctctact?ctggccaaca?actttgttct?catcgtgtca 300
caactgcaac?ccagtcaaga?aaatgagatg?ttttccatca?gagacagtgc?acacaggcgg 360
tttctgctat?tccggagagc?attcaaacag?ttggacgtag?aagcagctct?gaccaaagcc 420
cttggggaag?tggacattct?tctgacctgg?atgcagaaat?tctacaagct?ctg 473
<210>3
<211>158
<212>PRT
＜213〉human interleukin 24
<400>3
Ala?Gln?Gly?Gln?Glu?Phe?His?Phe?Gly?Pro?Cys?Gln?Val?Lys?Gly?Val
1 5 10 15
Val?Pro?Gln?Lys?Leu?Trp?Glu?Ala?Phe?Trp?Ala?Val?Lys?Asp?Thr?Met
20 25 30
Gln?Ala?Gln?Asp?Asn?Ile?Thr?Ser?Ala?Arg?Leu?Leu?Gln?Gln?Glu?Val
35 40 45
Leu?Gln?Asn?Val?Ser?Asp?Ala?Glu?Ser?Cys?Tyr?Leu?Val?His?Thr?Leu
50 55 60
Leu?Glu?Phe?Tyr?Leu?Lys?Thr?Val?Phe?Lys?Asn?Tyr?His?Asn?Arg?Thr
65 70 75 80
Val?Glu?Val?Arg?Thr?Leu?Lys?Ser?Phe?Ser?Thr?Leu?Ala?Asn?Asn?Phe
85 90 95
Val?Leu?Ile?Val?Ser?Gln?Leu?Gln?Pro?Ser?Gln?Glu?Asn?Glu?Met?Phe
100 105 110
Ser?Ile?Arg?Asp?Ser?Ala?His?Arg?Arg?Phe?Leu?Leu?Phe?Arg?Arg?Ala
115 120 125
Phe?Lys?Gln?Leu?Asp?Val?Glu?Ala?Ala?Leu?Thr?Lys?Ala?Leu?Gly?Glu
130 135 140
Val?Asp?Ile?Leu?Leu?Thr?Trp?Met?Gln?Lys?Phe?Tyr?Lys?Leu
145 150 155
Claims (8)
1. the expression vector of a genetically engineered human interleukin 24, it is characterized in that, this carrier is the plasmid vector pET32a (+) that contains human interleukin 24 gene order hIL-24 or human interleukin 24 transgenation sequences h sIL-24, and hIL-24 or hsIL-24 encoding sequence are positioned on pET32a (+) carrier between the Kpn1 and BamH1 restriction enzyme site, and this carrier is pET32a (+)-hIL-24 or pET32a (+)-hsIL-24; The primer of clone hIL-24 or hsIL-24 gene is:
P1?5’-
GGTACCGACGACGACGACAAGGCCCAGGGCCAAGAATT(Kpn1)
P2?5’-
GGATCCTTACAGAGCTTGTAGAATTTCTG(BamH?I)
For avoiding introducing Ala and two unnecessary amino acid of Met at the N end, when the design primer,, promptly add black italicized item with the coding base of enteropeptidase recognition site, join in the upstream primer.
2. a genetic engineering bacterium is characterized in that, it is transformed by the described carrier of claim 1.
3. genetic engineering bacterium as claimed in claim 2 is characterized in that, it is intestinal bacteria (Escherichia coli) BL21 (DE).
4. method for preparing human interleukin 24, it is characterized in that, intestinal bacteria pET32a (+)-hIL-24/BL21 or pET32a (+)-hsIL-24/BL21 expressed fusion protein Trx-hIL-24 or Trx-hsIL-24 under 25 ℃ of-37 ℃ of cultivations and IPTG inductive condition obtain hIL-24 or hsIL-24 through inclusion body washing, solubilization of inclusion bodies and fusion rotein renaturation, enteropeptidase digestion and purifying;
May further comprise the steps:
(1) recombinant bacterial strain pET32a (+)-hIL-24/BL21 or pET32a (+)-hsIL-24/BL21 ferment tank;
(2) centrifugal collection bacterium;
(3) washing and dissolving inclusion body;
(4) renaturing inclusion bodies;
(5) ultrafiltration and concentration;
(6) fusion rotein enteropeptidase digestion;
(7) affinitive layer purification;
(8) gel permeation chromatography desalination.
5. method as claimed in claim 4 is characterized in that, the solubilization of inclusion bodies liquid formula is as follows: 10mmol/L Tris-Hcl, 5mmol/L EDTA, 2mol/L urea, pH9.0.
6. method as claimed in claim 4 is characterized in that, the renaturation step is as follows:
Under 4 ℃ of stirring condition, slowly drip the renaturation buffer I of 10-20 times of volume, 4 ℃ are stirred renaturation 24h, add the renaturation buffer II of 10-20 times of volume again, and fully behind the mixing, 4 ℃ are stirred renaturation 24h; The prescription of renaturation buffer I is 10mmol/L Tris-Hcl, 0.9mmol/L gsh oxidized form, 0.8mmol/L gsh reduced form, pH8.5; The prescription of renaturation buffer II is 10mmol/L Tris-HCl, 1mmol/L EDTA, pH8.0.
7. method as claimed in claim 4 is characterized in that, ultrafiltration and concentration 100-400 doubly.
8. method as claimed in claim 4 is characterized in that, fusion rotein enteropeptidase digestion step is as follows:
Adjusting total protein concentration with the digestion damping fluid is 2-8mg/ml, presses albumen weight ratio 1: 300-1: 400 add enteropeptidase, digest fusion rotein down at 16 ℃-25 ℃, and the time is 24-32h, preparation hIL-24 or hsIL-24 albumen; The prescription of digestion damping fluid is 10mmol/L Tris-HCl, pH8.0.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100573678A CN100408686C (en) | 2005-11-04 | 2005-11-04 | Process for preparing human leucocyte interleukin 24 by genetic engineering and it expressing carrier and engineering bacterium |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100573678A CN100408686C (en) | 2005-11-04 | 2005-11-04 | Process for preparing human leucocyte interleukin 24 by genetic engineering and it expressing carrier and engineering bacterium |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1793373A true CN1793373A (en) | 2006-06-28 |
| CN100408686C CN100408686C (en) | 2008-08-06 |
Family
ID=36805024
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2005100573678A Expired - Fee Related CN100408686C (en) | 2005-11-04 | 2005-11-04 | Process for preparing human leucocyte interleukin 24 by genetic engineering and it expressing carrier and engineering bacterium |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100408686C (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103665116A (en) * | 2013-12-16 | 2014-03-26 | 广东瀚森生物药业有限公司 | Mycobacterium tuberculosis rTPA38 protein inclusion body primary purification method applicable to mass production |
| CN103864914A (en) * | 2014-03-27 | 2014-06-18 | 华东理工大学 | Preparation method of high-purity interleukin-24 inclusion body |
| CN103897052A (en) * | 2014-03-27 | 2014-07-02 | 华东理工大学 | Interleukin-24 mutant and preparation method and application thereof |
| CN107118269A (en) * | 2017-06-05 | 2017-09-01 | 北京交通大学 | A kind of PEG method of modifying of the albumen of recombined human IL 24 |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2003223482A1 (en) * | 2002-04-11 | 2003-10-27 | Zymogenetics, Inc. | Use of interleukin-24 to treat ovarian cancer |
| CN1322135C (en) * | 2004-09-09 | 2007-06-20 | 武汉大学 | Configuration of cell facter IL-24 eucargon expression carrier and application |
| CN1274823C (en) * | 2004-11-19 | 2006-09-13 | 汕头大学医学院 | Production of human interleukin 288 and recombined IL-288 engineering bacteria |
| CN1305902C (en) * | 2004-11-25 | 2007-03-21 | 汕头大学医学院 | Method for preparing human interleukin 29 and recombinant IL-29 engineering strain |
-
2005
- 2005-11-04 CN CNB2005100573678A patent/CN100408686C/en not_active Expired - Fee Related
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103665116A (en) * | 2013-12-16 | 2014-03-26 | 广东瀚森生物药业有限公司 | Mycobacterium tuberculosis rTPA38 protein inclusion body primary purification method applicable to mass production |
| CN103665116B (en) * | 2013-12-16 | 2015-12-09 | 广东瀚森生物药业有限公司 | A kind of method that mycobacterium tuberculosis rTPA38 inclusion bodies of protein being applicable to scale operation is just pure |
| CN103864914A (en) * | 2014-03-27 | 2014-06-18 | 华东理工大学 | Preparation method of high-purity interleukin-24 inclusion body |
| CN103897052A (en) * | 2014-03-27 | 2014-07-02 | 华东理工大学 | Interleukin-24 mutant and preparation method and application thereof |
| CN103864914B (en) * | 2014-03-27 | 2016-08-31 | 华东理工大学 | The preparation method of high-purity interleukin II 4 inclusion body |
| CN107118269A (en) * | 2017-06-05 | 2017-09-01 | 北京交通大学 | A kind of PEG method of modifying of the albumen of recombined human IL 24 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100408686C (en) | 2008-08-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1529757A (en) | Fusion Protein for secretion of protein of interest in supernatant of bacterial culture | |
| CN1679930A (en) | Human papilloma virus and heat shock protein recombinant protein vaccine and use thereof | |
| CN1807456A (en) | Recombinant human parathormone PTH1-34 preparation method | |
| CN1924006A (en) | Anti-glioma peptide of scorpion, preparation method and application thereof | |
| CN1793373A (en) | Process for preparing human leucocyte interleukin 24 by genetic engineering and it expressing carrier and engineering bacterium | |
| CN1990871A (en) | Preparation method of recombinant human plasminogen Kringle 5(hk5) | |
| CN1766107A (en) | Recombinant human keratinized cell growth factor production method | |
| CN1500808A (en) | Recombination of human soluble TRAIL protein, the preparing method and the application in preparing antineoplastic medicine | |
| CN1513556A (en) | Recombination human Mucl-MBP fusion protein antitumour vaccine and production technology | |
| CN1786165A (en) | Preparation method of recombination staphylococcus aureus enterotoxin C2 | |
| CN1546528A (en) | Fusion protein of kininogen D5 and tumor necrosis factor related apoptosis-inducing ligand(D5-TRAIL), its preparation and use thereof | |
| CN1824325A (en) | Human nipple virus DNA inserted vaccine, its preparation method and application | |
| CN1171998C (en) | Antibacterial peptide gene of Chinese prawn and its colon technique | |
| CN1712536A (en) | Expression of interleukin 24 from yeast cell | |
| CN101067138A (en) | Gene engineering process of preparing human hair papilla cell protein HSPC016 and its expression vector and engineering bacterium | |
| CN1810971A (en) | Antibacterial peptide gene of Chinese prawn containing single whey acidic protein structure domain and its coded antibacterial peptide and application | |
| CN1257187C (en) | Calreticulin-tumor necrosis factor correlated apoptosis inducing ligand fusion protein and its prepn and use | |
| CN1225481C (en) | Recombinant fusion resisting tomur attack and transfer | |
| CN101066993A (en) | Recombinant staphylococcus aureus enterotoxin M and its prepn and application | |
| CN1184232C (en) | Human tumor necrosin relative death inducing ligand mutein and its prepn process and medicine composition | |
| CN1948461A (en) | Expression method of human heparinase and its special engineering bacteria | |
| CN1268751C (en) | Purification method of recombinant yeast strain and rhGM-CSF to express human granulocyte-macrophage colony stimulating factor | |
| CN1831126A (en) | High secretion expression of recombination thymosin-alpha 1 in Escherichia coli and separation and purification therefor | |
| CN101037478A (en) | Rebuild golden staphylococcus enterotoxin N and preparation and application thereof | |
| CN1314808C (en) | Pyocyanine gene and target gene therapy of cancer with its packing and guiding protein composite |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20080806 Termination date: 20131104 |