CN1824325A - Human nipple virus DNA inserted vaccine, its preparation method and application - Google Patents

Abstract

A DNA-chimeric human papilla virus vaccine for treating the cancer of uterine cervix is prepared through using the PCR site-directed mutation method to change the cysteine codor at the site No.91 in Zn figure region at the terminal C of human papilla virus vaccine to glycine codor, fusing the gene 70 of heat shock protein of tubercle bacillus with the terminal C of mutated gene E7, inserting the fused gene in the plasmid pc DNA 3.1(-) of eucaryotic expression carrier, enzyme severing and sequence analysis for verifying the correctness of configuration, and using the vaccine to immunize mouse for testing it.

Description

Human nipple virus DNA inserted vaccine and preparation method and application

Technical field

The present invention relates to biotechnology, more relate to human papillomavirus (HPV) 16 type viral vaccines, also relate to the preparation method of human papilloma virus 16 type DNA therapeutic vaccine; Also relate to a kind of application of this vaccine simultaneously.

Background technology

Cervical cancer is one of malignant tumor of serious harm WomanHealth and life, 500,000 new cases are arranged global every year approximately, 250,000 people's death, it is the second largest reason that causes women's death, wherein most of in developing country, account for about 80% (Cain JM, Science, 2000,288:1753-1754).German scholar Zur Hausen in 1977 etc. have found the human papillomavirus from the cervical cancer specimen (it is relevant with the cervical cancer generation to infer that HPV infects for human papillomavirus, HPV) DNA.Further the molecular epidemiology evidence shows that HPV and human multiple cancer particularly have confidential relation with cervical cancer.Can detect HPV DNA in about 93% the cervical cancer tissues, wherein the HPV16 type accounts for 65% (Chen LP, et al.Proc NatlAcad Sci USA, 1991,88:110～114).HPV16 infection does not at present still have preventive measure clinically and cancerates easily, and precancerous lesion employing medication effect is poor, cost is high, and chemotherapy and operative treatment are also undesirable, and the prevention and the therapeutic vaccine of therefore researching and developing HPV16 have important practical sense.

One, the biological property of HPV

HPV belongs to Papovaviridae (Papovaviridae) Papillomavirus, is the small DNA virus that a class infects epidermis and mucosa squamous epithelial cancer.Its genome is a double-stranded cyclic DNA, long 7.5～8.0kb, contain 8 open reading frame (open reading frames, ORFs), divide 3 districts according to the function difference: (1) early stage district (early region, the E district): six early proteins such as E1, E2, E4, E5, E6, E7 of encoding respectively participate in the duplicating of viral DNA, transcribe, functions such as translational control and conversion.(2) late region (late region, L district): main coat protein L1 and less important coat protein L2 encode.(3) noncoding region (uncoding region, UCR) or upstream regulatory region (URR): the origin of replication and the HPV that contain the HPV genomic DNA express the yellow galaxy of literary talent of necessary controlling element, Molecular Virology, People's Health Publisher, 2002)..Identified more than 110 type at present, be divided into low risk, middle danger type and high-risk-type three classes by the big I of its carcinogenecity.Low risk HPV mainly causes the epidermis cell hyperplasia of prostate, can cause genital wart and child's recurrent papillary tumor as HPV6 and 11 types.The generation of high-risk-type (HPV16,18,31,45 etc.) HPV and Cervical intraepithelial neoplasia and cancerate and the generation of other epithelial tumours relevant.HPV infects comparatively common in the crowd, and most people are after sexual life begins, and all infecting should virus.Virus enters basal layer cell by impaired epithelial tissue, and its replicative cycle is subjected to strict adjusting, and depends on the protein and the epithelial differentiation degree of host of encoding viral.Viral infection is generally partial restriction, and reaction does not cause inflammation.Most of people can both remove virus voluntarily, have only the sub-fraction people owing to immune reason can't be removed virus, cause HPV to continue to exist, and develop into cervical cancer then.

Because the HPV virion only exists in the stratified squamous epithelium tissue of end differentiation eventually, up to the present content seldom, lack complete vitro culture system, also can't prepare attenuated live vaccine or inactivated vaccine, so the HPV vaccine development is only finished by technique for gene engineering.

Two, the present Research of HPV vaccine

At present, the vaccine at HPV16 mainly comprises preventative and therapeutic vaccine (Yuan Guang Wen Wuling English, cancer progression magazine 2004,2 (5): 339-342).Preventative vaccine is divided into protein level (comprising synthetic peptide vaccine and genetic engineering subunit vaccine) and nucleic acid level; all concentrate on HPV late gene (L1 and L2 gene) and/or its encoded protein product (coat protein); this mainly is because coat protein has conservative and the similar epitope of natural viral; can induce body to produce specific humoral immunity and mucosal immunity, the protection body is avoided HPV and is infected.The HPV therapeutic vaccine mainly is at HPV early gene E6, E7 and/or its encoded protein, various forms is that the target antigen therapeutic vaccine is flourish with E6/E7 at present, and kind has: live recombinant vectors vaccine, peptide vaccine, protein vaccine, nucleic acid vaccine and cell vaccine.

Three, HPV therapeutic vaccine

Therapeutic vaccine mainly be with early gene product E6, E7 as target protein, its objective is and induce body to produce specific cell immunoreaction that remove the HPV that has infected, treatment is closed tumor by the precancerous lesion that infection causes.The important E7 albumen that concentrates on of target antigen in the great majority research, this is because E7 obtains high-caliber expression easily and is easy to use determination of immunological methods, and the sequence of E7 is more conservative than E6.HPV E7 is that to keep the cell transformation state necessary.In transformant, be integrated in the human genome, and continuous expression, contain a plurality of B cell epitopes, cd4 cell epi-position, CD8 CTL epi-position, strong with MHC molecule affinity height, antigenicity, the more proteic epi-position in conjunction with the mankind and mouse lymphocyte of E7 is determined.Yet because E7 albumen itself has activity of conversion, directly applying to human body has certain danger, removes the activity of conversion of E7, keeps the prerequisite that its antigenicity becomes vaccine development.Research data proves, changes two key amino acids in the N-terminal PRB binding site of E7 albumen simultaneously, and both 24 Cys and 26 s' Glu can eliminate the function of its PRB in conjunction with active and vitro conversion Rodents cell fully.E7 PROTEIN C end plays an important role to its stability, and the sudden change of its zinc fingers can significantly reduce the proteic stability of E7 and carcinogenecity (Barbosa MS, Lowy DR, Schiller JT.J Virol, 1989; 63 (3): 1404), improved the safety of dna vaccination; Shi etc. have designed the sudden change that HPV16 E7DNA vaccine two zinc refer to the land, have produced the E7 albumen of quick degraded.The E7 dna vaccination of sudden change induces remarkable enhancing E7 specificity CT I, reacts and reacts than anti-tumor in the stronger body of wild type E7 dna vaccination.(Shi W，et al.J Virol，1999，73)]。

Summary of the invention

The object of the present invention is to provide a kind of human nipple virus DNA inserted viral vaccine, this vaccine can significantly be strengthened special cytotoxic T lymphocyte reaction (cytotoxic T lymphocytes, CTL) reply and anti-tumor effect, than other HPVDNA vaccines stronger immunization therapy effect is arranged, and safety and cheapness are easy to transportation, store system easy to control the quality and evaluation, can be used for infecting the related neoplasms that causes, as the immunization therapy of cervical cancer with HPV.

A kind of human nipple virus DNA inserted viral vaccine, its name: HPV that classifies ₁₆E ₇-HSP ₇₀The DNA chimeric, depositary institution: Chinese typical culture collection center, preservation address: China. Wuhan. Wuhan University, preservation time: on August 8th, 2005, deposit number: CCTCC NO:M205087.

Another object of the present invention is to provide the method for preparing human nipple virus DNA inserted vaccine, this method and technology maturation, stable, simple to operate, and repeatability is strong; The vaccine of preparation can produce stronger specificity humoral and cell immune response by the induction of immunity mice.

The invention still further relates to the application of human nipple virus DNA inserted vaccine in the treatment cervical cancer.

In order to realize above-mentioned task, the present invention adopts following technical measures:

Dna vaccination provided by the invention is by biotechnology such as gene clone preparations, relates to conventional technique for gene engineering: the selecting, obtain of genes of interest and carrier; Genes of interest and carrier vitro recombination; Recombinant molecule imports recipient cell; Genes of interest screening, evaluation; Express in the eukaryotic cell; The genetic immunization mice; Humoral immunization detects; Cellular immunization detects, proteic stability analysis; Safety detection etc.Gene vaccine of the present invention (claims dna vaccination again, nucleic acid vaccine) be that coding specific antigen proteic gene order is cloned on the suitable plasmid vector and the nucleic acid expression vector that is prepared into, by intramuscular injection, particle gun injection etc. is gone into its direct inoculation in the body, continuous expression exogenous gene in host, synthetic antigen protein, thus the excitating organism immune system produces specific immune response at exogenous proteins (immunology will such as Xu Daohua, 200420 (3): 46-49).Dna vaccination has the incomparable advantage of other vaccines, offers to antigen presenting cell by exotic antigen, stimulates CD4+ and CD8+T cell to produce effective cytotoxic T lymphocyte and antibody response.Prepare easyly, with low cost simultaneously, be easy to transportation, store, system easy to control the quality and evaluation are exempted and being polluted, and can pass through the number of ways immunity inoculation, and can stably integrate people's gene or keep the antigenic expression of prolongation purpose, enhance immunity memory with free form for a long time.

Dna vaccination can synthesize the antigen protein with real native conformation in cell, through host's self MHC molecular presentation, and the immune system of the activation body of comprehensive and lasting; Stable physical property, and be easy to make up, multiple antigenic DNA can be united structure, low price is particluarly suitable for developing country's extensive use.But the inductive immunological effect of dna vaccination a little less than, must strengthen its immunogenicity by every means, Chen etc. can strengthen presenting of MHC I/ peptide with HSP70 and HPV16E7 gene fusion, improve CD8 ⁺T replys.The E7/HSP70 chimeric gene vaccine can strengthen significantly that the special CTL of E7 replys and anti-tumor effect (Chen Ch, etal.CancerRes, 2000,60 (4): 1035-1042) ^]4 kinds of HPV16 epi-position (CTL cells that the antigen gene fused in tandem is formed in addition, Th cell and B cell epitope) dna vaccination, can make all immunized mices avoid other immune molecules such as the genes such as IL-12 and B7-1 such as attack while combined immunization cytokine of tumor cell, also can significantly strengthen immune effect (the Journal international du cancer of HPV16DNA vaccine, 1999 May 5,81 (3): 428-37).

Domestic therapeutic vaccine research mainly concentrates on the activity of conversion of removing E7 at high-risk HPV 16, keeps its antigenicity (Zhou Xiaoshan etc., Chinese pulmonary carcinoma magazine 2004; 7 (5): 379-382), E6 E7 amalgamation protein vaccine (Zhou Xiaoshan etc., Chinese tumor biotherapy magazine 2005; 12 (1): 19-22); Mosaic type virus-like particle is to contain HPV16L1E7 part epi-position (Bian Jifeng etc., Shandong Medical University's journal, 2000 simultaneously; 38 (2): 113))

The safety of dna vaccination of the present invention

Dna vaccination is seeded in the intravital safety of people and Studies on Immunogenicity is being carried out always.The vaccine of just at first estimating in first clinical research comprises the dna vaccination (Fvs) of intramuscular injection coding immunoglobulin strand variable region, and (antigen of this vaccine is from a lymphoma cell surface immunoglobulin for the treatment of the B cell lymphoma patient, the antigenic plasmid of coding MHC monoploid of intramuscular injection cationic-liposome parcel, be used for treating melanoma, and intramuscular injection HIV viral glycoprotein gp160/rev treats the male asymptomatic patient of HIV.The research of HIVgp160/rev dna vaccination afterwards also extends on the person of normal not infected by HIV.And the plasmid of encoding malaria antigen by intramuscular injection on one's body the healthy volunteer.

In all clinical trial reports up to now, the tolerance metering that preliminary result of study shows dna vaccination divide 3 times or the situation of intramuscular injection more frequently or subcutaneous irradiation under can accumulate nearly (Le TP more than the 2.5mg, Coonan KM, Vaccine 2000,18:1893-1901.).In a melanomatous research in late period, the antigenic plasmid of the HLA-B7 that will encode injects in the patient tumors, dosage reach respectively 30,100 and the situation of 300ug under, only in patient's tumor, find the CTL cell, and the CTL cell of prosper increase not in the peripheral blood.In another test,, in experimenter's body, observe intensive ctl response dividing three proteic plasmid accumulations of injection coding p.falciparum to reach under the situation of 2.5mg.

There is a large amount of research focus to concentrate on (beam rosy clouds of dawn etc., foreign medical oncology credit volume 2004,31 (9): 658-661) on the problem of dna vaccination and host genome conformability.In fact, dna vaccination allows localized when making up, and the expression genes of interest of short-term, so it does not comprise common integration sequence is as that lack and replicon homologous sequence of human gene or eukaryotic cell source property.For traditional vaccine, monitoring includes only the toxicity of single dose, the toxicity of repeated doses and the toxicity test that depends on target colony.Laboratory evaluation also includes only the experiment of the histopathology and the hemopathology of relative standard.But for dna vaccination, must add research, the research that physiology distributes, the concern that anti-nucleotide antibody produces about integrating.Successful key comprises careful and comprehensive preclinical study and foundation as early as possible and supervisor's communication, to guarantee security of products.

Concrete steps are as follows:

Vaccine construction:

1. the extraction of cancerous tissue DNA

Cancerous tissue is ground to form conventional protease K digesting after the homogenate earlier, after equal-volume phenol, the chloroform extracting, add 50 μ L TE buffer dissolving DNAs ,-20 ℃ frozen standby.

2.HPV16-mE7 obtaining of gene and heat shock protein

Extracting DNA with cancerous tissue is template PCR method amplification HPV-mE7.In 50 μ l reaction systems, add dna profiling 1 μ l, each 50pmol of primer, 10 * PCR buffer, 5 μ l, 2.5mmol/L Mgcl25 μ l, each 100 μ mol/L of dNTPs, 1U Taq archaeal dna polymerase.Primer is:

P1：5’GG GAATTCATGCATGGAGATACACCT3’

EcoRI

P2：5’GG GGATCCTGGTTTCTGAGAAC CGAT3’

BamHI The mutational site

94 ℃ of pre-degeneration, 94 ℃ of degeneration 60 seconds after 300 seconds, 55 ℃ of renaturation 60 seconds, 72 ℃ were extended 60 seconds, totally 30 circulations, last circulates back 72 ℃ and extended 300 seconds.Amplified production detects through 1.5% agarose gel.

After extracting plasmid pKs70 (Suzue K, Young RA.J Immunol 1996156:873-879.) restricted enzyme BamHI, HindIII double digestion in a small amount, low melting point (60 ℃) agarose reclaims HSP70, is used for coupled reaction.

3. target DNA fragment and carrier is connected

Press the amount of carrier and external source fragment 1: 3 (mol ratio), be connected with carrier pcDNA3.1 (v795-20 of Invitrogen company).

4. the preparation of competent cell and conversion

Use cold CaCl ₂Legal system is equipped with competent cell, gets coupled reaction mixture 5 μ l next day and adds competent cell, rotation mixing, 42 ℃ of heat shocks of ice bath rearmounted water-bath in 30 minutes 2 minutes.Cooling back adds 400 μ lLB culture medium, 37 ℃ of 100rpm jogs 45 minutes.Get 50～150 μ l bacterium liquid and be applied on the LB flat board that contains Amp 37 ℃ of overnight incubation.Set up the competence bacteria negative control simultaneously.

5. the screening of recombiant plasmid, evaluation

Recombinant plasmid dna and empty carrier are made double digestion (BamHI/HindIII), (EcoR I/BamHI).1% sepharose electrophoresis is observed visible significantly purpose fragment and carrier segments on the ultraviolet transmission reflection detector, conform to expected result, shows that genes of interest has been inserted among the carrier pcDNA3.1.With recombiant plasmid pcd-HPV ₁₆E7-HSP ₇₀The mutational site and the reading frame of E7 gene determined in order-checking.

Recombiant plasmid pcd-HPV ₁₆E7-HSP ₇₀Make up flow process and see Fig. 1, the structure flow process of control plasmid (contrast dna vaccination) is seen Fig. 2; Enzyme action is identified and is seen Fig. 3,4.Recombiant plasmid pcd-HPV ₁₆E7-HSP ₇₀Mutant nucleotide sequence is shown in SEQ ID NO:1.

The application of human nipple virus DNA inserted vaccine:

1. recombiant plasmid transfecting eukaryotic cells

With recombiant plasmid pcd-HPV ₁₆E7-HSP ₇₀Liposome transfection NIH3T3 cell is collected the NIH3T3 cell about 5 * 10 of transfection behind the 48h ⁶Individual, extract total RNA and carry out reverse transcription PCR, the specific band that can amplify length and be 310bp is the cDNA of HPV16E7m, result such as Fig. 5

2.DNA vaccine immunity animal

The C57BL/6 inbred mouse in age in 4-6 week is divided into 7 groups, 6 every group at random.With 0.25% lignocaine 50ul processing mice, in the same position of tibialis anterior multi-point injection dna vaccination, press 100ug//dosage injection behind the 3d in advance, booster immunizations once are total to twice of booster immunization after two weeks.

3.MTT method detects the mouse spleen lymphocyte specificity multiplication reaction

It is 6 * 10 that the splenocyte suspension is adjusted concentration ⁶/ mL.With the E7 albumen co-cultivation of 100 μ L/ holes and 5 μ L (15 μ g) 5 days, (all establish three multiple holes) in contrast with the lymphocyte that does not add E7 albumen and stimulate, add MTT10 μ L/ hole then, 37 ℃ of incubations 4 hours add acidifying isopropyl alcohol cessation reaction.Microplate reader detects the absorbance at wavelength 570nm place.The lymphopoiesis ability equals experimental group A ₅₇₀Value deducts control group A ₅₇₀Value.The result shows, compares with wild pcd-wE7 group, and chimeric pcd-HPVmE7-HSP70 group can be induced stronger specificity lymphproliferation response (p＜0.05), does not have significant difference (p＞0.05) between pcd-HPVmE7-HSP70 and the sudden change pcd-mE7 group.(table 1)

Table 1MTT method detects immune mouse lymphocyte in-vitro multiplication situation

Group	n	x±s
			PBS PcDNA3.1 pcdDNA-HSP70 pcdDNA-wE7 pcdDNA-mE7 pcd-mE7-HSP70	5 5 6 6 6 6	0.333±0.017 0.517±0.063 0.748±0.056 * 1.868±0.140 * 2.131±0.155 *# 2.203±0.163 *#

Note: ^*Compare P＜0.01 with the PBS group; # and wE7 group compare p＜0.01

Microplate reader detects the absorbance at wavelength 570nm place.The lymphopoiesis ability equals experimental group A ₅₇₀Value deducts control group A ₅₇₀Value.The result shows, compares with wild pcd-wE7 group, and chimeric pcd-HPVmE7-HSP70 group can be induced stronger specificity lymphproliferation response (p＜0.05), does not have significant difference (p＞0.05) between pcd-HPVmE7-HSP70 and the sudden change pcd-mE7 group.

4.ELISPOT detect the T lymphocyte quantity of secretion of gamma-IFN

(Enzyme Linked Immunospot ELISPOT) carries out, and in strict accordance with the description operation, the result shows that the HPV16mE7-HSP70 class frequency is significantly higher than HPV16mE7 group and HPV16wE7 group to adopt the enzyme linked immunological spotting method.Illustrate that the HPV16mE7-HSP70 dna vaccination can significantly increase mice body endocrine IFN-γ specific T-cells number (Fig. 6).

5. the lactic dehydrogenase enzyme process detects the CTL kill rate

The immune mouse splenocyte of preparation is mixed with the E7 albumen of 20 μ l, and usefulness contains the RPMI-1640 co-cultivation 4 days of 10% calf serum, carries out cell counting, adjustment cell concentration, action effect cell.Detect with the CTL of the mouse melanin tumor cell cell of expressing the E7 gene after and to use target cell as the dna vaccination immune mouse.The result shows that chimeric pcd-mE7-HSP70 group-specific lethal effect is significantly higher than wild pcd-wE7 and sudden change pcd-mE7 group (p＜0.01).Illustrate that the chimeric DNA vaccine can induce generation at the reaction of the specific CTL of E7, and effect is better than the E7 group of wild separately and sudden change.(Fig. 7)

6. anti-HPV16E7 detection of antibodies

In two weeks after the last immunity, eyeball is got blood.Adopt indirect elisa method to detect the antibody horizontal of anti-HPV16E7 in the serum.The result shows, compares with PBS group and empty carrier group, and pcd-wE7 dna vaccination, pcd-mE7DNA vaccine and pcd-HPV16mE7-HSP70 dna vaccination all can bring out the specific humoral immune reaction of HPV16E7, but inductive degree indifference.(Fig. 8)

7. the integration situation of plasmid DNA on chromosome

Utilize the DNA sequence design primer on the carrier that the integration situation in the muscle cdna group is carried out the inverse PCR amplification, the result shows the inverse PCR product and amplifies, and size is about 5.6Kb, illustrates that plasmid DNA is not incorporated in the chromosome.(Fig. 9)

8.DNA vaccine is to the detection of animal important organ influence

Get the important organ of 2 months mices of dna vaccination immunity: liver, kidney, spleen etc., these internal organs growths of perusal mice are no abnormal.Under the light microscopic, the immune mouse hepatocyte does not have enlargement, cell marshalling, rule; Renal glomerulus structural integrity, renal tubular epithelial do not have obvious swelling; Spleen tissue cell normal (Figure 10).Extract DNA and total RNA of above-mentioned tissue, carry out PCR and RT-PCR amplification, distribute in vivo, understand the dna vaccination injection safety with the monitoring plasmid DNA.The result is presented at absorption and the expression that does not have vaccine DNA in the mice main organs.

9.Western-blot to HPV16 _mThe stability analysis of E7-HSP70 fusion rotein

Results are through protease inhibitor ALLN processing, untreated stably express pcd-HPV16 _mThe NIH3T3 cell of E7-HSP70 fusion gene and untransfected NIH3T3 cell, SDS-PAGE isolated cell total protein after the lysis, isolating total protein from gel power on transfer on the NC film after, the E7 monoclonal antibody specific detects the expression of cell HPV16E7 mutain, the result shows that the E7 albumen of sudden change is obviously low than expression in the cell that adds protease inhibitor in not adding the cell of protease inhibitor, and HPV16 is described _mThe E7-HSP70 fusion rotein has unstability in cell, the E7 protein degradation speed of sudden change increases, and can increase antigen presentation, and immune effect is stronger.(Figure 11)

10.DNA vaccine is to the effect of B16-HPV16E7 tumor treatment

The C57BL/6 mice, female, in age in 6-8 week, 5 every group, be divided into 7 groups.Conventional trypsinization B16/E7 cell, after PBS washed 3 times, cell counting and dilution were 1 * 10 ⁶/ ml, above-mentioned cell inoculation is subcutaneous in the back, right side of C57BL/6 mice, every 0.2ml.After 3 days, mice is respectively organized in the various plasmid DNA immunity of grouping by 2.3 and dose inoculation, every group of right side of mice leg muscle injection, and per 7 days repeat once, totally three times; Other gets the C57BL/6 mice, 15, is divided into 3 groups at random, wherein two groups every inoculation 1 * 10 ⁶The tumor cell 0.2ml of/ml, another winding kind of winding kind PBS vaccine HPV16mE7-HSP70 vaccine after 3 days; Last winding kind B16 tumor cell is used the HPV16mE7-HSP70 vaccine immunity then.Going out the tumor phase of each group of twice observation writes down mice with tumor life cycle and survival rate weekly.

Behind the mouse hypodermic inoculation B16-HPV16E cell, adopt dna vaccination treatment three times, observe the therapeutical effect of vaccine tumor-bearing mice.Found that, pcDNA3.1 group, HSP70 group and PBS group tumor growth are rapid, the HPV16wE7 group, HPV16mE7 group and HPV16mE7-HSP organized tumor inhibition effect in 60 days observation period, HPV16mE7-HSP70 dna vaccination group mouse tumor does not disappear fully, but life cycle significant prolongation, a mice alive with tumour (＞60 days) wherein, all the other each groups are all dead in 56 days, as Fig. 5.Illustrate that dna vaccination can significantly suppress to express the growth of HPV16E7 antigen tumor in vivo, significantly improves incubation period and survival rate that tumor-bearing mice becomes tumor.(following table and Figure 12 .13)

Group	Go out the tumor phase (my god)	Tumor size (mm 3)	Survival time of mice (my god)
				PBS group PcDNA3.1 pcd-HPS70 group pcd-HPV16wE7 group pcd-HPV16mE7 group pcd-HPV16mE7-HSP70 group	18 18 19 24 27 27	2783 2649 2481 1736 1014 1176	35 35 35 44 46 50

The present invention compares with existing, has the following advantages and effect: immunology studies have shown that, the velocity correlation of active height of cellular immunization and antigen molecule degraded, i.e. and degraded is fast more, and the activity of CTL is high more.Labile protein matter with respect to stable protein have the ability that stronger stimulation produces ctl response (Tobery, T.W).The applicant makes the proteic stability decreases of E7 after with E7 PROTEIN C end zinc fingers sudden change sudden change (the 91st Cys), quickens the E7 protein degradation and becomes micromolecule polypeptide, thereby improved the submission efficient of E7 antigenic peptides; The sudden change of zinc fingers simultaneously will reduce the carcinogenecity of E7 gene, increase the safety of dna vaccination.Because the tubercule bacillus heat shock protein 70 folds, assembles, transports and processing submission process as the molecular chaperones participation is antigenic, has carrier molecule effect and adjuvant effect, has significantly strengthened the immunizing potency of dna vaccination.Therefore, will the suddenly change E7 gene and the tubercule bacillus HSP70 gene fusion of C-terminal zinc fingers of applicant is built into pcd-HPV together _16mE7-HSP ₇₀The chimeric DNA vaccine, and with three kinds of recombiant plasmid of pcd-mE7 (saltant), pcd-wE7 (wild type), pcd-HSP70 (heat shock protein 70) relatively, the immune C57BL/6 mice of difference, the immunne response effect of more several groups of vaccine-induced generations, the result shows pcd-HPV _16mE7-HSP ₇₀Can detect specificity HPV16 E7 antibody around the chimeric DNA vaccine immunity group mice the, the 7th all antibody horizontals obviously raise.Chimeric immune group mouse spleen lymphocyte is subjected to E7 albuminous body external stimulus, mtt assay detects stronger specificity lymphopoiesis and reacts, the T lymphocyte quantity that ELISPOT detects secretion of gamma-IFN obviously increases, and the LDH method detects the specific CTL killing activity and significantly strengthened.Behind the immune mouse inoculated tumour cell, obviously prolong life cycle, and tumor growth slows down.Simultaneously with heavy dose of (500ug/ is only) vaccine intramuscular injection immune mouse, observe the tissue slice of important organ such as mice liver,spleen,kidney, the result does not observe pathologic and changes, and RT-PCR does not detect E7 gene expression yet.The inverse PCR result shows that muscular tissue is not found the situation that carrier and host chromosome are integrated.

Experimental results show that this chimeric DNA vaccine safety, effective, can induce stronger humoral immunization of generation and cellullar immunologic response, to expressing the proteic tumor cell of HPV16E7 good lethal effect is arranged, show that this dna vaccination is that a kind of immunogenicity is strong, the tumor therapeutic vaccine that specificity is high.

Description of drawings

Fig. 1 makes up flow chart for reorganization pcd-HPV16E7-HSP70 fusion plasmid (DNA chimeric).

Fig. 2 is recombiant plasmid pcd-mE7, pcd-wE7, pcd-HSP70 (control plasmid) design of graphics.

Fig. 3 is that recombiant plasmid pcd-HPV16E7-HSP70 enzyme action is identified figure

Recombiant plasmid (being the chimeric DNA vaccine) produces the E7 fragment of 310bp and the carrier segments of 7.2kb behind the EcoRI/BamHI double digestion; Through the BamHI/HindIII double digestion, produce 1.8bpHSP70 fragment and 5.7 carrier segments, conform to expected result, show that genes of interest is inserted in the carrier.

Fig. 4 identifies figure for the reorganization control plasmid

Control plasmid pcd-mE7 is through BamHI, EcoRI double digestion; .pcd-wE7 through BamHI, EcoRI double digestion; PcDNA3.1 empty carrier enzyme action rear electrophoresis, clip size is consistent with expected results.

Fig. 5 is that chimeric plasmid DNA expresses (RT-PCR) in eukaryotic cell

With recombiant plasmid pcd-HPV16E7-HSP70 rotaring copolymering NIH 3 T 3 cell, extract cell total rna and carry out reverse transcription PCR, the specific band that can amplify length and be 310bp is the cDNA of HPV16E7m.

Fig. 6 is significantly higher than HPV16mE7 group and HPV16wE7 group for the T lymphocyte frequency HPV16mE7-HSP70 class frequency that ELISPOT detects dna vaccination immune mouse secretion of gamma-IFN.Illustrate that the HPV16mE7-HSP70 dna vaccination can significantly increase mice body endocrine IFN-γ specific T-cells number.

Fig. 7 is that dna vaccination immune mouse splenocyte is to expressing the B16-F0 cell-specific lethal effect of HPV16E7

Pcd-mE7-HSP70 group-specific lethal effect is significantly higher than wild pcd-wE7 and sudden change pcd-mE7 group (p＜0.01).Illustrate that the chimeric DNA vaccine can induce generation at the reaction of the specific CTL of E7, and effect is better than the E7 group of wild separately and sudden change.

Fig. 8 is the HPV16E7 antibody of dna vaccination immune serum

Pcd-wE7 DNA, pcd-mE7 DNA and pcd-HPV16mE7-HSP70 dna vaccination all can bring out the specific humoral immune reaction of HPV16E7, inductive degree indifference.

Fig. 9 DNA integrates experiment

For inverse PCR detects the integration situation of muscular tissue plasmid DNA in muscular tissue.The result shows the inverse PCR product and amplifies, and size is about 5.6Kb, illustrates that plasmid DNA is not incorporated in the chromosome.

Figure 10 detects for animal safety

A murine liver tissue HE dyes (* 200), and b mice nephridial tissue HE dyes (* 200), and the HE of c mouse boosting tissue dyes (* 200).

Under the light microscopic, the immune mouse hepatocyte does not have enlargement, cell marshalling, rule; Renal glomerulus structural integrity, renal tubular epithelial do not have obvious swelling; The spleen tissue cell is normal.

Figure 11 detects fusion rotein stability for Western Blot

Transfectional cell add protease inhibitor (ALLN) 2. transfectional cell do not add the ALLN3 non-transfected cells

The E7 albumen of sudden change is obviously low than expression in the cell that adds protease inhibitor in not adding the cell of protease inhibitor, illustrate that the HPV16mE7-HSP70 fusion rotein has unstability in cell, the E7 protein degradation speed of sudden change increases, and can increase antigen presentation, and immune effect is stronger.

Figure 12 is that tumor growth is rapid behind the control mice inoculated tumour cell, survival period short

Behind the mouse hypodermic inoculation B16-HPV16E cell, adopt dna vaccination treatment three times, found that, pcDNA3.1 group, HSP70 group and PBS group tumor growth are rapid.

Figure 13 is long for chimeric immune mouse tumor growth is suppressed survival period

HPV16mE7-HSP70 dna vaccination group mouse tumor growth is suppressed, life cycle significant prolongation.

The specific embodiment

Below in conjunction with accompanying drawing the present invention is described in further detail:

One, pcr amplification HPV16 E7 gene and heat shock protein gene are segmental obtains and reclaims

In the 0.5mlEppendorf pipe, add 10 * Buffer, 5 μ l successively, 10 * dNTP, 5 μ l (final concentration 200umol/L), Primer 1,2 each 1 μ l (about 30pmol), template DNA 1 μ l (about 0.1ug), ddH ₂O 31 μ l mixings add TaqDNA polymerase 1U, paraffin oil 40 μ l.By following condition circulation 30 times, 94 ℃ of 1min, 55 ℃ of 1min, 72 ℃ of 1min extend 5min at last.Amplified production 1.5% agarose gel electrophoresis detects.The product 310bp dna fragmentation of amplification is reclaimed through low melting point (60 ℃) agarose.

After extracting plasmid pKs70 restricted enzyme BamHI, HindIII double digestion, low melting point (60 ℃) agarose reclaims HSP70, is used for coupled reaction.

Two, coupled reaction system such as following table:

Table 1: coupled reaction system

	Experimental group	Matched group
			Carrier pcD3.1 (-) target DNA T 4Dna ligase 5xBuffer distilled water	3μl(1ug) 8ul HSP70 1ug， E7 0.2ug 1μl(10u) 4μl 4μl	3μl(1ug) 8ul HSP70 1ug， E7 0.2ug - 4μl 5μl

Total reaction volume is 20ul, connects 16 hours in the time of 16 ℃.Reaction finishes, and gets 10ul reactant electrophoresis, and does not add T ₄The matched group of dna ligase is relatively estimated joint efficiency.The 10ul stored frozen gives over to conversion in addition.

Three, use cold CaCl ₂Method prepares competent cell and transformation experiment in a small amount

Well-grown single bacterium colony DH5 α is inoculated in 37 ℃ of overnight incubation in the 2ml culture fluid on the picking LB flat board.Get above-mentioned 100 μ l bacterium liquid next day and be transferred in the 10ml fresh medium, cultivate and be about 0.4 to A600 in about 3 hours.Antibacterial in the centrifugal results bacterium liquid adds the 0.1mol/L CaCl of the ice pre-cooling of 1/5 original bacteria liquid volume ₂The resuspended precipitation of liquid, ice bath solution 10 minutes, precipitum once more adds the 0.1mol/L CaCl of the ice pre-cooling of 1/25 original bacteria liquid volume ₂Liquid is resuspended, and 100ul/ manages packing, 4 ℃ of storages.

Get coupled reaction mixture 5ul next day and add competent cell, rotation mixing, 42 ℃ of heat shocks of ice bath rearmounted water-bath in 30 minutes 2 minutes.Cooling back adds 400 μ l culture medium, 37 ℃ of 100rpm jogs 45 minutes.Get 50～150 μ l bacterium liquid and be applied on the LB flat board that contains Amp 37 ℃ of overnight incubation.Set up the competence bacteria negative control simultaneously.

Four, the screening of recombiant plasmid, evaluation

In 3ml LB fluid medium (containing Amp), 37 ℃ of joltings are spent the night, then the rapid extraction plasmid with the single bacterium colony that grows on the above-mentioned LB flat board of toothpick picking.

Plasmid DNA is carried out 1.2% sepharose electrophoresis earlier and is made primary dcreening operation, selects the further evaluation of plasmid do that molecular weight is slightly larger than empty carrier.Identify with PCR and double digestion (EcoRI/BamHI, BamHI/HindIII), enzyme action rear electrophoresis.Behind the structure pcd-HSP of above-mentioned steps elder generation recombiant plasmid, again pcd-HSP is gone in the mE7 gene clone and obtain pcd-HPV ₁₆E7-HSP ₇₀Recombiant plasmid.Order-checking is identified.

Five, RT-PCR detects pcd-HPV16mE7-HSP70 in eukaryotic expression

The recombiant plasmid rotaring copolymering NIH 3 T 3 cell, preceding 24 hours of transfection is behind the cell counting, with 1 * 10 ⁵/ mlNIH3T3 cell transferred species is in 6 well culture plates, every hole 3ml.With 1.5 μ g pcd-HPV ₁₆E7-HSP ₇₀Plasmid DNA and 4 μ l Lipofactamine ^TM2000 are diluted to 50 μ l with PBS respectively, again plasmid solution and the gentle mixing of liposome solutions are placed 30min in room temperature.100 μ lDNA/ liposome complexes are dropwise added in the NIH3T3 cell, simultaneously gentle wave and culture plate mixing.37 ℃ of incubations were changed the fresh complete medium of 3ml after 6 hours, continued to cultivate 48 hours.

After above-mentioned cell routine trypsinization, centrifugal collection transfectional cell about 5 * 10 under the room temperature ⁶Individual, add 1mlTrizol and extract cell total rna to specifications, total RNA of extraction adds the DNA enzyme again and handles the remaining DNA of possibility with the distilled water dissolving of no RNA enzyme, surveys A with ultraviolet spectrophotometer then ₂₆₀/ A ₂₈₀After carrying out concentration and purity testing ,-70 ℃ of preservations.

Get above-mentioned total RNA 5 μ g and add 5 * reverse transcriptase buffer, 4 μ l, 10mmol/LdNTPs 2 μ l, 10umol/L primer P ₂Paraffin oil covered after 1 μ l, AMV reverse transcriptase 0.6 μ l (10U/ μ l), RNAsin20U, distilled water supplied volume to 20 μ l.Instantaneous centrifugal after, put 42 ℃ the reaction 1 hour, 5 minutes cessation reactions of 95 ℃ of degeneration are put-20 ℃ of preservations.

Get the above-mentioned cDNA reactant liquor of 10 μ l, add 10 * PCR buffer, 10 μ l, 10mmol/LdNTPs 2 μ l, 10umol/L primer P ₁And P ₂Each 2 μ l, TaqDNA polymerase 1 μ l (20U/ μ l) adds and asepticly twoly boils off ionized water and complement to 100 μ l.Cover with paraffin oil 50 μ l, of short duration centrifugal after, put full-automatic amplification instrument.92 ℃ of pre-degeneration were carried out 30 following circulations after 5 minutes: 92 ℃ 60 seconds, 55 ℃ 60 seconds, 72 ℃ 60 seconds, extend at last 72 ℃ 5 minutes, amplified production is identified with agarose gel electrophoresis.

Six .Western blotting detect HPV16 _mThe stability of E7-HSP70 fusion rotein

1. stably express pcd-HPV16 _mThe acquisition of E7-HSP70 fusion gene cell strain

Contain the DMEM culture medium of 10% calf serum with 2 * 10 with not containing antibiotic ⁵Individual NIH3T3 cell inoculation is in 24 orifice plates, carries out transfection when converging when cell grows to 90% behind the 24hr.Respectively with the HPV16 of 0.8 μ g/ μ l _mE7-HSP70 plasmid DNA 1 μ l or 2 μ lLipofectamine2000 are diluted to 50ul with the DMEM culture medium of serum-free, then the gentle mixing room temperature of two liquid are left standstill 30min.With above-mentioned 100 μ lDNA/ plasmalogen complex/holes simultaneously soft culture plate mixing that rocks in the cell dropwise, the blank group adds the culture medium of 100 μ l.Then with culture plate in 37 ℃, 5%CO ₂After hatching 6hr in the incubator, after the replacing complete medium continues to be cultured to 48 hours, replacing contains the selection culture medium culturing of G418 400 μ g/ml, changes liquid 1 time in per 3 days, selects the cell clone trypsinization of the stable growth back of going down to posterity to continue G418 screening and amplification culture after two weeks.

2. protease inhibitor is to expressing HPV16 _mThe processing of E7-HSP70 fusion gene cell strain

Get the NIH3T3 cell 2 * 10 of aforementioned stable transfection ⁵Individual/hole, be seeded to 24 well culture plates, adding final concentration behind the cultivation 24hr in the part hole is the protease inhibitor ALLN of 20 μ g/ml, after continuing to cultivate 24hr, the trypsinization collecting cell is used for the analysis of expression product again.

3. the Western blot of the SDS-PAGE of expression product separation and expression product analyzes

Get the different cultured cells of above-mentioned collection, the PBS washing, centrifugal, with cell pyrolysis liquid 200 μ l re-suspended cells, ice bath 30 minutes, 12, centrifugal 10 minutes of 000rmp collects supernatant, and-20 ℃ are frozen.Sampling adds equal-volume 2 * SDS sample-loading buffer, boiling water bath 5 minutes before the electrophoresis.Adopt the BIO-RAD electrophresis apparatus to carry out the discontinuous vertical electrophoresis of SDS-PAGE, deposition condition: 5% concentrates glue, and 8V/cm electrophoresis to dyestuff enters separation gel; 12% separation gel, the 15V/cm electrophoresis is to about 1cm place, dyestuff gel bottom.

3.1 the gel behind the SDS-PAGE is covered on the 0.22 μ mNC film, place the electrotransfer instrument, 4 ℃, the 10V electrotransfer spends the night.

After 3.2 the NC film behind the taking-up electrotransfer, Ponceaux are redyed and are confirmed the transfer printing success, ddH ₂O washes film.

3..3NC film is with 5% defatted milk powder-PBS (pH7.4), 37 ℃ of sealings 2 hours.

3.4NC film was hatched under 4 ℃ 6 hours with 1: 500 HPV16E7 sheep anti mouse monoclonal antibody with the confining liquid dilution.

3.5PBS thorough washing NC film 3 times, each 15 minutes.

3.6 the IgG (1: 1000) of NC film and horseradish peroxidase-labeled was hatched 2 hours at 37 ℃.

3.7PBS thorough washing NC film 3 times, each 15 minutes.

3.8 drip the DAB liquid of fresh configuration, develop the color after 1-3 minute, with water rinse NC film cessation reaction, observe and analysis result.

Seven, HPV16 _mThe detection of E7-HSP70DNA vaccine safety

1. detecting dna vaccination influences the animal important organ

Get 8 of C57BL/6 mices, set up experimental group and blank group.Get above-mentioned dna solution with the 1ml syringe, and on injection needle, put a little plastic tube, syringe needle is only exposed about 3mm, with the degree of depth unanimity that guarantees that the per injection syringe needle penetrates.During injection syringe needle is vertically penetrated quadriceps femoris, slowly inject 100 μ lDNA solution and kept syringe needle 10 seconds, injection is preceding with 1% lignocaine 0.2ml muscle anesthetized mice, when property of medicine outbreak, mouse muscle is injected after being in complete relaxed state, totally three times once in a week.Perusal mice growing state, immune mouse is put to death mice after 2 months, get Mouse Liver, spleen, nephridial tissue, and 10% neutral formalin fixedly spends the night, paraffin embedding, conventional organization is learned HE dyeing, and the tissues observed pathology change under the light microscopic.

2 detect the expression of this dna vaccination at each internal organs

2.1 get the internal organs such as Liver and kidney spleen of fresh execution mice, and adding DNA extract (10mmol/l Tris-Cl, 10mmol/l EDTA, 300mmol/l NaCl, 2%SDS) homogenate is to loseing piece of tissue; Add the 10mg/ml E.C. 3.4.21.64 to final concentration 200 μ g/ml, 50 ℃ of insulations were also rocked in 3 hours frequently; Add isopyknic balance phenol, the vibration mixing, 12, centrifugal 10 minutes of 000g; Add equal-volume chloroform/isoamyl alcohol extracting twice, 12, centrifugal 10 minutes of 000g; Supernatant adds the dehydrated alcohol of 2.5 times of volume ice pre-cooling, and the sodium acetate of 0.1 volume was placed 2 hours for-20 ℃, and 12, centrifugal 10 minutes of 000g, deposit D NA; 70% washing with alcohol precipitation, natural air drying; Molten DNA is deposited in the TE buffer, and-20 ℃ of preservations are standby.

2.2 the extraction of total tissue RNA is undertaken by Trizol total RNA extraction reagent description.

2.3 the RT-PCR of E7mRNA increases among the pcr amplification of E7 gene and the total RNA in the tissue DNA reaction condition and reaction cycle parameter are seen before.

3. HPV16E7 gene and and the detection of mRNA and E7 gene myocyte genome conformity in the mice quadriceps femoris

3.1 get the muscular tissue of fresh execution mice plasmid injection site, extract DNA and total RNA of muscular tissue respectively by list of references and reagent description, E7mRNA among E7 gene in PCR and the RT-PCR tissue and the total RNA, reaction condition and reaction cycle parameter are seen before.

3.2 inverse PCR detects plasmid DNA integration situation in the muscle cell genome

(1) inverse PCR primer design

According to the DNA sequence of retroviral vector pLXSN, whether the two ends of E7 gene order in pL (HPV16E7) SN are designed a pair of primer and are carried out inverse PCR and integrate with cell chromosome to measure the vaccine dna molecular.Sequence is as follows:

5`primer(1515-1537)：5`-GGGTGTGGAAAGTCCCCAGGCTC-3`

3`primer(1420-1398)：5`-GGTCGAACGAGGAGGTTCAAGGG-3`

(2) inverse PCR amplified plasmid dna molecule

Muscular tissue DNA with extraction is a template, utilizes the big segmental Taq enzyme of amplification of TaKaRa company to carry out pcr amplification, and reaction system and condition are as follows:

TaKaRa ExTaq(5U/μl) 0.25μl

10×ExTaq Buffer 5μl

MgCl ₂(25mM) 4μl

DNTP Mixture (each 2.5mM) 4 μ l

Template DNA 0.2 μ g

Primer 1 (20 μ M) 1 μ l

Primer 2 (20 μ M) 1 μ l

Sterile purified water replenishes volume to 50 μ l

94℃	8 minutes
			94℃ 60℃ 72℃	1 minute 1.5 minutes 6 minutes	30 circulations
72℃	10 minutes

Eight, grouping of animal and immunity

35 of C57BL/6 mices, female, in age in 6-8 week, be divided into 6 groups at random.Be grouped as follows:

PBS organizes 100 μ l//times

PcDNA3.1 100 μ g//times

Pcd-HSP70 organizes 100 μ g//times

Pcd-HPV16wE7 organizes 100 μ g//times

Pcd-HPV16mE7 organizes 100 μ g//times

Pcd-HPV16mE7-HSP70 organizes 100 μ g//times

Nine, the detection of cell and humoral immune reaction

After the 1 mice last immunity the 8th day, mice ball artery is got blood, after the cervical vertebra dislocation is put to death, the sterilization in 10 minutes of 70% soak with ethanol, the aseptic then abdominal cavity of cutting off, take out mouse spleen, place the little plate of the RPMI-1640 culture medium that fills serum-free, grind to form cell suspension with steel wire, through 200 order nylon net filters, centrifugal 10 minutes of filtrate room temperature 1000rpm, abandon supernatant, precipitation adds the Tris-NH4Cl 5ml of pH7.2, and capillary pipette piping and druming mixing is put in 37 ℃ of water-baths 8 minutes with splitting erythrocyte.1000rpm is centrifugal 10 minutes under the room temperature, and washs once with the RPMI-1640 culture medium of serum-free.Sedimentation cell suspends with the RPMI-1640 culture fluid of 10%NBS, behind the standardize solution counting, transfers cell concentration to 1 * 10 ⁶/ ml.

2.HPV16E7 the detection of specific T-cells

Adopt the enzyme linked immunological spotting method (Enzyme Linked Immunospot ELISPOT) carries out, and in strict accordance with the description operation, required reagent is placed equilibrium at room temperature, capture antibody concentrated solution and diluent 1 still place 2-8 ℃ standby, program is as follows:

2.1 in the used hole of test lath, add 200 μ l aseptic culture mediums, under room temperature, hatched 20 minutes, with the blance test hole.

2.2 sucking-off culture medium from test hole, every hole add 100 μ l (105) mouse boosting cell or various contrast (positive control: the mice IFN-γ of reorganization immediately; Negative control: irritation cell not; Background contrast: aseptic culture medium; Capture antibody contrast: with the capture antibody of phosphate buffer dilution.) each test establishes a multiple hole.

2.3 at 37 ℃, 5%CO saturated humidity incubator was hatched 24 hours for cell and stimulus object (reorganization HPV16E7 albumen, this chamber purification and preservation).(note: kinetocyte not between incubation period.)

2.4 liquid in the sucking-off culture hole with cleaning mixture 250-300 μ l thorough washing culture hole, 4 times, after last washing finishes, dries liquid, and blots residual liquid with clean absorbent paper as far as possible.

2.5 the capture antibody that adds 100 μ l dilution is to each experimental port, 2-8 ℃ of overnight incubation, repeating step 4.

2.6 each experimental port adds the Streptavidin-AP of 100 μ l dilution, hatches under the room temperature 2 hours.

2.7 repeating step 4.

2.8 each experimental port adds 100 μ lBCIP/NBI colour developing liquid, room temperature, lucifuge were hatched 1 hour.

2.9, use the deionized water wash experimental port to the colour developing liquid that falls in the culture hole, eliminate liquid in the hole, 37 ℃ left standstill 15-30 minute.

2.10 observe and add up the specificity circular spot that forms under anatomic microscope, quantitative approach: speckle forms cell number/every hole and adds cell number.

3. cell toxicity test

Detect the CTL activity of immune mouse with the lactic dehydrogenase enzyme process.

3.1 the preparation of mouse spleen lymphocyte

The cervical vertebra dislocation method was put to death after immune mouse was plucked the eyeball blood-letting, the sterilization of 70% soak with ethanol.Mice is dissected by the sterile working, and left abdomen is got spleen, adds a spot of Hank ' s liquid, grinds on 100 order steel meshes and disperses splenocyte, uses the resuspended splenocyte of 3ml Hank ' s liquid, and 2000rpm centrifugal sedimentation cell is used 0.83%NH ₄15 minutes hypotonic splitting erythrocyte of Cl water-bath; After the washing of Hank ' s liquid, cell precipitation is resuspended with 1640 culture medium that contain 2 μ g/mlConA10% calf serums, places 6 porocyte culture plates, and 37 ℃, 5%CO ₂Cultivate under the condition.

3.2 effector lymphocyte's preparation

The immune mouse splenocyte of preparation is mixed with the E7 albumen of 20 μ l, and usefulness contains the RPMI-1640 co-cultivation 4 days of 10% calf serum, carries out cell counting, adjustment cell concentration, action effect cell.

3.3 the preparation of target cell

The CTL of B16-HPV16E7 cell after as the dna vaccination immune mouse detects and uses target cell.

3.4 the lactic dehydrogenase enzyme process detects the CTL kill rate ^[15]

In 96 well culture plates, set up combination, parallel 3 holes, every hole as following table.37 ℃, 5%CO ₂Cultivate 8hr under the condition, wherein maximum spontaneous release aperture of target cell and correcting fluid background hole added 10 μ l10 * Lysis lysate in 45 minutes in advance.Every hole is got 50 μ l supernatants and is added behind substrate buffer 250 μ l, the nadide 50 μ l mixings 37 ℃ of water-baths 15 minutes, add 2,4 dinitro benzene hydrazine solutions, 250 μ l, 15 minutes back end hydrogenation sodium hydroxide solution of 37 ℃ of water-baths of mixing cessation reaction, room temperature was placed 3 minutes, and 440nm measures and respectively manages absorbance.By formula calculate the CTL kill rate

The lactic dehydrogenase enzyme process detects CTL kill rate reaction system

	Imitate the target ratio	The effector lymphocyte	Target cell	Culture fluid	10×Lysis
							(E∶T Ratio)	(1×10 7)	(1×10 5)	5％ FCS1640
PBS，pHSP， pcDNA， pcDNA-wE7 pcDNA-mE7 pcDNA-mE7+pHSP pcDNA-mE7-pHSP	100∶1	100μl	100μl	0μl
						50∶1	50μl	100μl	50μl
	25∶1	25μl	100μl	75μl
						The effector lymphocyte is from discharging	100∶1	100μl	100μl	0μl
50∶1	50μl	100μl	50μl
					25∶1		25μl	100μl	75μl

Target cell is from discharging	100∶1	100μl	0	100μl
						50∶1	50μl	0	150μl
	25∶1	25μl	0	175μl
						Target cell is maximum from discharging		0	100μl	100μl
The culture fluid background		0	100μl	100μl	10μl
						The correcting fluid background		0	0	200μl
		0	0	200μl	10μl

Experimental port A value, effector lymphocyte will deduct culture medium background A value from release aperture A value and the spontaneous release aperture of target cell during calculating, and the maximum release aperture A of target cell value will deduct correcting fluid background A value.

4. splenocyte secretion of gamma-IFN, the mensuration of IL-4 level

4.1 the preparation of spleen cell cultures supernatant

After the dislocation of mice cervical vertebra is put to death, the sterilization in 10 minutes of 70% soak with ethanol, mouse spleen is taken out in the aseptic then abdominal cavity of cutting off, place the little plate of the RPMI-1640 culture medium that fills serum-free, grind to form cell suspension with steel wire, through 200 order nylon net filters, centrifugal 10 minutes of filtrate room temperature 1000rpm, abandon supernatant, precipitation adds the Tris-NH4Cl 5ml of pH7.2, and capillary pipette piping and druming mixing is put in 37 ℃ of water-baths 8 minutes with splitting erythrocyte.1000rpm is centrifugal 10 minutes under the room temperature, and washs once with the RPMI-1640 culture medium of serum-free.Sedimentation cell suspends with the RPMI-1640 culture fluid of 10%NBS, behind the standardize solution counting, transfers cell concentration to 5 * 10 ⁶/ ml.Cell suspension adds to 96 porocyte culture plates, and every hole adds 100 μ l, is added with the 10 μ g/mlConAs of 100 μ l/ holes with the cell culture fluid configuration that contains 10%NBS in the plate in advance, and every plate all is provided with blank and negative control, and every duplicate samples is established 3 multiple holes.Put 37 ℃.Cultivate in the 5%CO2 saturated humidity incubator after 72 hours, centrifugal 10 minutes of 2000rpm collects supernatant, put-20 ℃ frozen to be measured.

4.2 the detection of IFN-γ in the spleen cell cultures supernatant

Adopt the ELISA method to carry out, in strict accordance with the description operation, program is as follows:

A. take out from balance to the sealing bag of room temperature required lath (with anti-mice IFN-γ monoclonal antibody bag by), other lath is put back to 4 ℃ after sealing.

B. stay a blank well to make blank, (concentration is respectively 2000,1000,500,250,125,62.5pg/ml) adds in the respective aperture with testing sample 100 μ l/ holes with variable concentrations IFN-γ standard substance respectively.Every duplicate samples or every kind of concentration standard product are all done multiple hole, seal reacting hole with shrouding glue, hatch 120 minutes in the room temperature (20-25 ℃).

C. wash plate 5 times by hand: get rid of liquid in the most hole, add cleaning mixture 350 μ l/ holes, leave standstill 3-and get rid of most liquid after second, in thick folded absorbent paper, pat dry.

D. except that blank well, add detection agent working solution (Avidin of biotinylation anti-mice IFN-gamma antibodies and HRP labelling) 100 μ l/ holes, seal plate hole, room temperature (20-25 ℃) was hatched 60 minutes.

E. after washing plate 5 times, add substrate A, each 50 μ l/ hole of B, lucifuge, room temperature was placed 10-30 minute.

F. reacting hole shows redness, adds stop buffer 50 μ l/ holes, returns to zero with blank well in 5 minutes behind the mixing, measures the 450nm A of place value on enzyme-linked immunosorbent assay instrument.

G. the result judges: with standard substance concentration is abscissa, and the A value is made vertical coordinate drawing standard curve, finds the concentration of corresponding IFN-γ by the A value of testing sample.

4.3 the detection of IL-4 in the spleen cell cultures supernatant

Adopt the ELISA method to carry out, in strict accordance with the description operation, program is as follows:

A. take out from balance to the sealing bag of room temperature required lath (with anti-mice IL-4 monoclonal antibody bag by), other lath is put back to 4 ℃ after sealing.

B. stay a blank well to make blank, (concentration is respectively 2000,1000,500,250,125,62.5pg/ml) adds in the respective aperture with testing sample 100 μ l/ holes with variable concentrations IL-4 standard substance respectively.Every duplicate samples or every kind of concentration standard product are all done multiple hole, seal reacting hole with shrouding glue, hatch 120 minutes in the room temperature (20-25 ℃).

C. wash plate 5 times by hand: get rid of liquid in the most hole, add cleaning mixture 350 μ l/ holes, leave standstill 3-and get rid of most liquid after second, in thick folded absorbent paper, pat dry.

D. except that blank well, add detection agent working solution (Avidin of biotinylation anti-mice IL-4 antibody and HRP labelling) 100 μ l/ holes, seal plate hole, room temperature (20-25 ℃) was hatched 60 minutes.

E. after washing plate 5 times, add substrate A, each 50 μ l/ hole of B, lucifuge, room temperature was placed 10-30 minute.

F. reacting hole shows redness, adds stop buffer 50 μ l/ holes, returns to zero with blank well in 5 minutes behind the mixing, measures the 450nm A of place value on enzyme-linked immunosorbent assay instrument.

G. the result judges: with standard substance concentration is abscissa, and the A value is made vertical coordinate drawing standard curve, finds the concentration of corresponding IL-4 by the A value of testing sample.

5. anti-HPV16E7 detection of antibodies

Adopt the ELISA method, program is as follows: 1. mice whole blood 37 left standstill 30 minutes, and 4 placed 2 hours.2.2000g centrifugal 15 minutes, sucking-off serum.With the E7 fusion rotein of purification with the coating buffer dilution after, by elisa plate, 4 ℃ are spent the night with the amount bag of every hole 1ug/ μ l.4. get rid of in the most hole behind the liquid, fully wash plate three times with cleaning mixture.5. every hole adds the 0.1% bovine serum albumin sealing elisa plate of 200 μ l, hatches 2h for 37 ℃.6. use cleaning mixture thorough washing three times, empty liquid in the hole.7. animal serum is suitably diluted (1: 10) and hatch 1h at 37 ℃, PBS washing 3 times with elisa plate.8. the HRP labelling that adds dilution in 1: 1000 gets sheep anti-mouse igg, hatches 1h for 37 ℃, and PBS gives a baby a bath on the third day after its birth inferior.9. add colour developing liquid colour developing 5-10 minute, the stop buffer color development stopping.The 450nm wavelength is surveyed each hole OD value down.

Ten, dna vaccination is to the effect of B16-HPV16E7 tumor treatment

The C57BL/6 mice, female, in age in 6-8 week, 5 every group, be divided into 7 groups.Conventional trypsinization B16/E7 cell, after PBS washed 3 times, cell counting and dilution were 1 * 10 ⁶/ ml, above-mentioned cell inoculation is subcutaneous in the back, right side of C57BL/6 mice, every 0.2ml.After 3 days, mice is respectively organized in the various plasmid DNA immunity of grouping by 2.3 and dose inoculation, every group of right side of mice leg muscle injection, and per 7 days repeat once, totally three times; Other gets the C57BL/6 mice, 15, is divided into 3 groups at random, wherein two groups every inoculation 1 * 10 ⁶The tumor cell 0.2ml of/ml, another winding kind of winding kind PBS vaccine HPV16mE7-HSP70 vaccine after 3 days; Last winding kind B16 tumor cell is used the HPV16mE7-HSP70 vaccine immunity then.Going out the tumor phase of each group of twice observation writes down mice with tumor life cycle and survival rate weekly.

11, date processing: all data are handled with the SPSS statistical software, and ELISPOT, cytokine levels and antibody horizontal adopt the t check; With the life cycle of Fisher`s exact check analysis different grouping.P thinks that less than 0.05 significant difference is arranged.

SEQUENCE LISTING

＜110〉Wuhan University

＜120〉human nipple virus DNA inserted vaccine and preparation method and application

＜130〉human nipple virus DNA inserted vaccine and preparation method and application

<160>1

<170>PatentIn version 3.1

<210>1

<211>480

<212>DNA

＜213〉synthetic

<400>1

tacattgcat gaatatatgt tagatttgca accagagaca actgatctct actgttatga 60

gcaattaaat gacagctcag aggaggagga tgaaatagat ggtccagctg gacaagcaga 120

accggacaga gcccattaca atattgtaac cttttgttgc aagtgtgact ctacgcttcg 180

gttgtgcgta caaagcacac acgtagacat tcgtactttg gaagacctgt taatgggcac 240

actaggaatt gtgtgcccca tcggttctca gaaaccagga tccatggctc gtgcggtcgg 300

gatcgacctc gggaccacca actccgtcgt ctcggttctg gaaggtggcg acccggtcgt 360

cgtcgccaac tccgagggct ccaggaccac cccgtcaatt gtcgcgttcg cccgcaacgg 420

tgaggtgctg gtcggccagc ccgccaagaa ccaggcggtg accaacgtcg atcgcaccgt 480

Claims (5)

1, a kind of human nipple virus DNA inserted vaccine is characterized in that: its classification called after HPV ₁₆E ₇-HSP ₇₀The DNA chimeric is preserved in Chinese typical culture collection center, and deposit number is M205087.

2, a kind of dna fragmentation, it has the nucleotide sequence shown in the SEQ ID NO:1.

3, a kind of preparation method that is used to realize the described a kind of human nipple virus DNA inserted vaccine of claim 1, it comprises the following steps:

The extraction of A, cancerous tissue DNA: cancerous tissue is ground to form conventional protease K digesting after the homogenate earlier, after equal-volume phenol, the chloroform extracting, add 50 μ L TE buffer dissolving DNAs ,-20 ℃ frozen standby;

Obtaining of B, HPV16-mE7 gene and heat shock protein: extracting DNA with cancerous tissue is template PCR method amplification HPV-mE7, in 50 μ l reaction systems, add dna profiling 1 μ l, each 50pmol of primer, 10 * PCR buffer, 5 μ l, 2.5mmol/L Mgcl25 μ l, each 100 μ mol/L of dNTPs, 1U Taq archaeal dna polymerase, primer is:

P1：5’GG GAATTCATGCATGGAGATACACCT3’

EcoRI

P2：5’GG GGATCCTGGTTTCTGAGAACCGAT3’

BamHI The mutational site

94 ℃ of pre-degeneration, 94 ℃ of degeneration 60 seconds after 300 seconds, 55 ℃ of renaturation 60 seconds, 72 ℃ were extended 60 seconds, totally 30 circulations, last circulates back 72 ℃ and extended 300 seconds, and amplified production detects through 1.5% agarose gel, behind extraction plasmid pKs70 restricted enzyme BamHI, the HindIII double digestion, 60 ℃ of fusing point agaroses reclaim HSP70, are used for coupled reaction;

C, target DNA fragment are connected with carrier: press the amount of carrier and 1: 3/ mol ratio of external source fragment, pcDNA3.1 is connected with carrier;

The preparation of D, competent cell and conversion: use cold CaCl ₂Legal system is equipped with competent cell, get coupled reaction mixture 5 μ l next day and add competent cell, the rotation mixing, 42 ℃ of heat shocks of ice bath rearmounted water-bath in 30 minutes 2 minutes, the cooling back adds 400 μ lLB culture medium, and 37 ℃ of 100rpm shook 45 minutes, got 50～150 μ l bacterium liquid and were applied on the LB flat board that contains Amp, 37 ℃ of overnight incubation are set up the competence bacteria negative control simultaneously;

The screening of E, recombiant plasmid, evaluation: recombinant plasmid dna and empty carrier are made double digestion, 1% sepharose electrophoresis, observe visible significantly purpose fragment and carrier segments on the ultraviolet transmission reflection detector, conform to expected result, show that genes of interest has been inserted in the carrier, the recombiant plasmid order-checking is determined the mutational site and the reading frame of E7 gene.

4, the application of the described a kind of human papillomavirus HPV DNA chimeric of claim 1 in the treatment cervical cancer.

Images