CN1748791A - Haemorrhagic E, coli 0157:H7 vaccine for human and livestock prevention and preparing method - Google Patents

Abstract

The present invention belongs to the field of medicine biological technology, and especially one kind of protective haemorrhagic E. coli 0157:H7 vaccine and its preparation process. Type III secreted protein EspA segment is connected to pET-28a(+) carrier to constitute pET-28a(+)-EspA expression vector, and transformed to BL21(DE3) engineering bacillus for IPTG induction to express EspA protein in high efficiency, so as to obtain engineering bacillus BL21-pET-28a(+)-EspA to express target protein. The present invention has simple preparation process, high repeatability and high purity of obtained target protein. Animal experiment shows that the vaccine can induce the immune response effectively and has the advantages of high efficiency, high safety, easy separation and purification, etc.

Description

People and domestic animal prevention enterohemorrhagic Escherichia coli O 157: H7 vaccine and preparation method

Technical field

The present invention relates to the medical biotechnology field; be particularly related to a kind of gene clone technology that utilizes O157:H7 icam gene fragment is connected on the expression vector, advance the prevention enterohemorrhagic Escherichia coli O 157 of engineering bacterium expression destination protein with conversion: H7 vaccine and preparation method and foundation are used to estimate the animal model of described O157 vaccine immunity protectiveness and effectiveness infected B alb/c mice.

Background technology

Enterohemorrhagic Escherichia coli (Enterohemorrhagic Escherichia coli, EHEC) O157:H7 (serotype) once repeatedly all over the world particularly developed country cause outbreak of epidemic widely.Infect and mainly cause diarrhoea, hemorrhagic colitis (hemorrhagic colitis, HC), and the hemolytic uremic syndrome that often occurs together (Hemolytic ruemic syndrome, HUS), thrombotic thrombocytopenic purpura (thrombotic thrombocytopenic purpura, TTP) complication, serious threat human life and health.The approach of this bacterium of human infection mainly is beef, vegetable, fruit and the water source etc. of edible or contact stain.

At present, infection still lacks the effectively preventing method to O157:H7, can only give symptomatic treatment and suitable antibacterial therapy, but studies have shown that antibacterials can impel O157:H7 to discharge the Vero toxin, thereby the danger of the concurrent hemolytic uremic syndrome of patient (HUS) is increased.Therefore research and develop the effective vaccine of O157:H7 to preventing this pathogenic bacterial infection significant.

Adhesion is the basis of bacterial infection.EHEC O157 has adhesin intimin, but limited amount, and by the adhesion due to the III type secretory protein EspA (Esp be E.coli secreted protein abbreviation), perforation, and the transposition of effect protein early than the combining of intimin and Tir, the subunit vaccine for preparing with EspA can be prevented the infection field planting of this bacterium in advance.

Owing to several big virulence factor quantity of the natural generation of O157 is very limited, it is also very difficult to separate these protective antigens of purifying, and cultivates O157 bacterium existence danger greatly in a large number, so adopt the direct separation and purification protective antigen of pathogen feasibility poor.And also there is the danger of back mutation in traditional attenuated live vaccine.

EspA plays a key effect in the adhesion field planting of antibacterial.EspA exists with the polymer form, form the fiber-like tubular structure, be connected to host cell surface, EspB, EspD is secreted into host cell through this passage, and at surface of cell membrane formation aperture, adhesin receptor Tir (translocated intiminreceptor) albumen of transposition inserts host cell through EspA passage and aperture.Intimin albumen and tir protein binding cause the A/E damage.EspA is that surface expression and polymer form exist, and has good immunogenicity, and the quantity that anti-EspA antibody often exists than the antibody of other surface protein is for many; The Natural Exposure of EspA can induce good immunoreation and longer duration that it is become to have good immunogenic anti-EHEC and many kinds of serogroup vaccines of EPEC.

III type secretory protein extensively is present in pathogenic Gram-negative (G-) bacillus, does not see Table to reach in the non-pathogenic bacteria enterobacteria.The molecular evolution of O157:H7 is discovered LEE (locus of enterocyte effacement) the height homology of Escherichia coli EPEC and EHEC.[NevesBC such as Bianca C.Neves, Knutton S, Trabulsi LR, Sperandio V, Kaper JB, Dougan G, Molecular andultrastructural characterisation of EspA from different enteropathogenic Escherichiacoli serotypes.FEMS Microbiol Lett 1998,169:73-80] studied the EspA characterization of molecules and the ultrastructure of ten kinds of different serotypes of EPEC, in whole serotypes, the EspA peptide sequence has 65% concordance at least.Wherein two kinds of serotype comparative analysiss of O127:H6 and O55:H6 find that both EspA peptide sequences are in full accord; And O111:H2 and O128:H2 also have 95% concordance at least.[Marita Noguera-Obenza such as MaritaNoguera-Obenza, Theresa J.Ochoa, Henry F.Gomez.Human Milk Secretory Antibodies against Attaching and Effacing Escherichia coliAntigens Emerg Infect Dis 2003,9 (5)] investigated 123 women's emulsions of MEXICO CITY and Norfolk Virginia city of North America, found to have to have EspA antibody more than 90%.Because EspA is more conservative than other virulence molecule; the EspA variant of the different many types of pathogen of originating has structural similarity; anti-EspA antibody has high rate and cross reaction widely, so the EspA antibody capable provides the protective effect that multiple serotype is extensively intersected.The EspA that shows O127:H6 and O157:H7 by sequence analysis has the adhesion that 85% identical EspA antibody can stop EPEC and the many serotypes of EHEC, does not resemble anti-LPS or intimin antibody only has protective effect to limited enteropathogen.Can provide cross-protection widely with this vaccine that designs with respect to O157LPS.

At present, detect the immune performance of O157:H7 vaccine, the animal to this bacterium susceptible commonly used mostly is large animals such as pig, cattle, sheep as infection model.The infected animal model of Jian Liing not only expends hugely in this way, and brings very big inconvenience for zooperal enforcement.

Summary of the invention

Purpose of the present invention provides a kind of prevention enterohemorrhagic Escherichia coli O 157: H7 vaccine and preparation method.The present invention adopts engineered means clonal expression EspA antigen, utilize gene clone technology that O157:H7 icam gene fragment is connected on the expression vector, with the prevention enterohemorrhagic Escherichia coli O 157 that transforms the engineering bacterium expression destination protein: H7 vaccine and preparation method, have efficiently, safely, be convenient to advantage such as separation and purification.

Another object of the present invention provides a kind of vaccine immunity performance detection method.The infected animal model of Balb/c mice is set up in employing, in order to detect the immune performance of vaccine.

Vaccine of the present invention adopt malignant bacteria is prepared the multivalence subunit by its virulence gene of clonal expression or merge the multivalence subunit antigen.The present invention connects III type secretory protein, adhesin, hemolysin, shiga-like toxin (Stx) to make up by the combination of clone's virulence gene or by genetic engineering according to certain ratio merges the multivalence subunit antigen, to obtain the multivalence subunit antigen of variety classes, different component ratio and different amalgamation modes.Wherein preferably these multivalence subunits are made up by clone's virulence gene.Antigen component, preferred III type secretory protein EspA, adhesin adopt engineered means clonal expression EspA antigen.

The anti-EspA antibody of the present invention is more than the quantity of the antibody existence of other surface protein, is to have good immunogenic anti-EHEC and many kinds of serogroup vaccines of EPEC.

The present invention is connected to III type secretory protein EspA fragment on pET-28a (+) carrier, makes up pET28a (+)-EspA expression vector, and its structure is seen embodiment 1.The connected mode that the EspA fragment is connected to pET-28a (+) carrier is: the primer of the EspA gene order of design EHEC O157:H7 EDL933 type strain, the forward primer design adds the CC base at the sequence front end, with the G formation NcoI restriction enzyme site of start codon ATG and back; Downstream primer removes termination codon, doses XhoI restriction enzyme site CTCGAG; Termination codon is used the codon of 6 His amino acid label back of pET28a (+).

Be used to detect the method for the immune performance of vaccine of the present invention, adopt, irritate bacterium then by to the oral streptomycin of mice, filter out persister, and filter out the field planting adapted strain by going down to posterity, and foundation can be stablized the infected animal model of germ-carrying Balb/c mice, and method for building up is seen embodiment 2.Infected mouse model carries disease germs stable, can accurately detect the immune performance of vaccine, and cost is low.

It is major antigen that the present invention adopts EspA, can efficiently express EspA albumen by inducing, and expresses the engineering bacteria of destination protein, have efficiently, safely, be convenient to advantage such as separation and purification.

Description of drawings:

Fig. 1 .PCR amplified production nucleic acid electrophoresis figure

A left side is risen and is with 1 to be nucleic acid (DNA) molecular weight standard (marker), and band 2-5 is a pcr amplified fragment, and the fragment actual size is 584bp, and electrophoretic band is between 500～750, and the amplified fragments size is consistent with the purpose fragment.

Fig. 2. contain pET-28a (+) plasmid map of EspA genetic fragment

The plasmid C-terminal that makes up contains 6 His labels, the espa genetic fragment of black sequence for inserting, and redness is an operon, yellow is a kalamycin resistance gene.

Fig. 3 .EspA peak figure that checks order

The BL21 engineering bacteria of reorganization is served Hai Boya company order-checking, and the result has only the inconsistent (A → G), but do not change amino acids coding of the 111st bit base and EDL933 type strain.

Fig. 4 .IPTG induces the engineering bacterium expression EspA albumen that contains carrier construction

Swimming lane 1 is induced 2h for not cloning the full bacterium contrast of the segmental BL21 of purpose (DE3) through IPTG, compares with inducing the reorganization bacterium, and obviously swimming band does not appear in EspA albumen size place;

Swimming lane 2 is a protein molecular weight standard, from high to low molecular weight be 66.2,43.0,31.0,20.1,14.4,6.2kDa;

Swimming lane 3 does not occur obviously swimming band for the full bacterium contrast before not inducing at EspA albumen size place;

Swimming lane 4-7 induces 4h and 6h concentration the highest for inducing back 1h, 2h, the full bacterium of 4h, 6h through the degeneration rear electrophoresis, and 4h and 6h difference are not obvious.

, consistent after the gene recombinaton with the destination protein molecular weight through inducing the protein expression band that increase is arranged at molecular weight 21kDa place.

Fig. 5. the evaluation electrophoretogram of expression-form

The 1-3 swimming lane is the high speed centrifugation supernatant, and 4 is full bacterium, and 5-8 is a high speed centrifugation precipitation (different applied sample amount), and EspA albumen mainly is present in the precipitation, illustrates with insoluble inclusion body formal representation.

Fig. 6 .EspA albumen n end sequencing result

Peak figure signal is stronger, and the result is MDTSN, and the result who announces with GenBank is consistent.

Fig. 7. two-way agar gel diffusion test detects antibody titer behind the immunizing rabbit

Begin counterclockwise order antibody from the bottom and do dilution in 1: 2,1: 4,1: 8,1: 16,1: 32,1: 64 respectively, observe precipitation line, have only 1: 64 dilution factor precipitation line not occur, antibody titer is 1: 32.

Fig. 8. the affinitive layer purification destination protein

The 1-4 swimming lane is an eluting peak, and 5 is empty swimming lane, and 6-10 is that stream is worn the peak, is about 86.5-91.2% with UVP scanning analysis purity of protein behind the purification.

Fig. 9. sepharose electrophoresis detects pcr amplification product

Swimming lane 1,2 is the pcr amplification product (879) of genes of interest intiminC300

Swimming lane 3,4 is the pcr amplification product (270) of genes of interest Stx2B

Swimming lane 5,6 is the pcr amplification product (489) of genes of interest hlyAB

With O157-SM ^R2 full bacterium genomes are template, the pcr amplified fragment band lay respectively at dna molecular amount standard 1000,300, near the indication band of 500bp, estimate that clip size is 879,270,489, amplified fragments with estimate big or small consistent.

Figure 10. nine age in week mice attack bacterium feces O157 and cultivate situation

▲ infect 10 ¹⁰The 9W mice in age of CFU O157,

△ infects 10 ⁹The 9W mice in age of CFU O157

With 10 ¹⁰CFU O157 attacks bacterium, carries disease germs more than sustainable 3 weeks, and adopts 10 ⁹CFU O157 carries disease germs and can reach for 2 weeks.

Figure 11. the Serum Antibody Detection of immune counteracting toxic substances protection experiment mice

From booster immunization, mouse anti EspA antibody titer continues to increase, and geometric mean titer reaches 1: 300000 after 3 weeks, and mixed immunity group antibody titer also significantly increases, and matched group loses rising.

Figure 12. immune counteracting toxic substances protection experiment antibacterial dropping situations figure

Two experimental grouies can detect the drainage of O157 antibacterial in the stool in mice in 3 days, have only one can also detect the O157 drainage after 1 week, and matched group still can detect antibacterial after 3 weeks, illustrate that EspA antigen has significant anti-adhesion ability.

The specific embodiment

The preparation of material

1. enterohemorrhagic Escherichia coli O 157: H7 bacterial strain:

EHEC O157:H7 (numbering 44828) [doctor Ceng Ming of Nat'l Pharmaceutical ﹠ Biological Products Control Institute gives].

EHEC O157:H7 (O157-SM ^R, O157-SM ^R1, O157-SM ^R2) [this chamber preparation is preserved]

2. agents useful for same:

1. LB fluid medium:

Tryptone 10g, yeast extract 5g, NaCl 10g adding distil water adjust pH to 7.4, autoclaving to 1000ml.

2. LB solid medium: the 1.5g agar powder adds in the 100ml LB culture fluid, (15 pounds of 20min) pour plate behind the autoclaving, add antibiotic as need, then temperature is advisable about 60 ℃, pour plate again after the adding, the ampicillin addition is final concentration 50ug/ml, and kanamycin is 30ug/ml.

3. sorbitol-Mai Kangkai (SMAC) culture medium:

Peptone 20g, cholate 5g, NaCl 10g, sorbitol 10g, 0.5% dimethyl diaminophenazine chloride 5ml, agar 18g, except that sorbitol, dimethyl diaminophenazine chloride, all the other heating are water-soluble, and adding NaOH adjustment pH is 7.2.Add sorbitol, dimethyl diaminophenazine chloride again, autoclaving.

4. the DNA electrophoretic buffer (50 * TAE)

Tris 242g, glacial acetic acid 57.1ml, Na ₂EDTA2H ₂O 37.2g adds water to 1000ml and gets final product, and application concentration is 1 * TAE.

5. EB solution

EB stock solution (10mg/ml)

0.2g EB is dissolved in 20ml H ₂Among the O, keep in Dark Place in 4 ℃ behind the mixing.

The EB dyeing liquor

10 μ l EB stock solutions, 100ml 1 * TAE buffer

6. peroral infection bacterium liquid preparation

EHEC O157 is inoculated in the LB culture medium, and (count results is about 4 * 10 to 37 ℃ of shaken cultivation 6h after dull and stereotyped cultivation of doubling dilution inoculation SMAC ⁹CFU/ml), abandon supernatant after centrifugal, with aseptic LB washing 2 times, pressing variable concentrations at last need be with the resuspended thalline of aseptic LB liquid again.

7. PBS buffer (pH7.2)

Na ₂HPO ₄14mmol, NaH ₂PO ₄6mmol, NaCl9g, adding distil water is to 1L

8. NcoI, XhoI DaLian, China Takara company

9. DNAmaker DaLian, China Takara company

10. glue reclaims test kit Omega company

plasmid extraction test kit Omega company

Coomassie brilliant blue R-250 rapid dyeing system (with reference to " fine works molecular biology experiment guide ").

destaining solution: 250ml 95% ethanol and 80ml glacial acetic acid add distilled water to 1000ml.

Inclusion body cleaning mixture and lysate

inclusion body cleaning mixture I 20mmol/L Tris; PH8.0, inclusion body cleaning solution II 20mmol/L Tris; 1.0%Triton X-100; PH8.0, inclusion body cleaning solution II I 20mmol/L Tris; 2mol/L carbamide; PH8.0

solubilization of inclusion bodies liquid

20mmol/L Tris, 8mol/L carbamide, pH8.0

 electrotransfer buffer

Glycine 2.9g, Tris5.8g, SDS0.37g, methanol 200ml adds distilled water to 1000ml

Pvdf membrane transfering buffering liquid (protein sequencing is used)

CAPS2.21g, DTT0.5g, 15% methanol 150ml adds distilled water to 1000ml, uses the NaOH adjustment to pH10.5, and in 4 ℃ of coolings.

The Ponceau S stock solution

Ponceau S, 2g, trichloroacetic acid 30g, sulfosalicylic acid 30g adds 9 parts of distilled waters with 1 part of above-mentioned stock solution and is Ponceau S application liquid.

TTBS

Tris·Cl(PH7.5)100mmol/L，NaCl(w/v)0.9％，Tween-20(v/v)0.1％

TE buffer(pH8.0)

10mmol/L Tris

1mmol/L EDTA

Substrate reactions liquid

4mg DAB is dissolved among the 10ml TTBS, adds 5 μ l 30%H ₂O ₂Mixing.

Freund adjuvant

Freund's complete adjuvant: 1 of paraffin oil (1～6 part)+lanoline (1 part)+inactivated vaccine

Incomplete Freund: paraffin oil (1～6 part)+lanoline (1 part)

3. laboratory animal

(1) in age in BALB/c mouse: 6-8 week, body weight 18-22g is provided by Sichuan University's Experimental Animal Center, the animal quality quality certification number: No. the 24101110th, the moving word of doctor.

(2) rabbit: provide by Chinese people Third Military Medical University Experimental Animal Center.

Embodiment 1

Make up pET28a (+)-EspA expression vector

1. the EspA gene order of Gen Bank acquisition is numbered AE005594, is EHEC O157:H7EDL933 type strain, altogether 579bp.

1 ATGGATACAT CAAATGCAAC ATCCGTTGTT AATGTGAGTGCGAGTTCTTC GACATCGACG

61 ATCTATGACT TAGGTAATAT GTCGAAGGAT GAGGTGGTTAAGCTATTTGA AGAACTCGGT

121 GTTTTTCAGG CTGCGATTCT CATGTTTTCT TATATGTATCAGGCACAAAG TAATCTGTCG

181 ATTGCAAAGT TTGCTGATAT GAATGAGGCA TCTAAAGCGTCAACCACGGC ACAAAAGATG

241 GCTAATCTTG TGGATGCCAA AATTGCTGAT GTTCAGAGTAGCACTGATAA GAATGCGAAA

301 GCCAAACTTC CTCAAGACGT GATTGACTAT ATAAACGATCCACGTAATGA CATAAGTGTA

361 ACTGGTATTC GTGATCTTAG TGGTGATTTA AGCGCTGGTGATCTGCAAAC AGTGAAGGCG

421 GCTATTTCAG CTAAAGCGAA TAACCTGACA ACGGTAGTGAATAATAGCCA GCTCGAAATT

481 CAGCAAATGT CGAATACATT AAATCTCTTA ACGAGTGCACGTTCTGATGT GCAATCTCTA

541 CAATATAGAA CTATTTCAGC AATATCCCTT GGTAAATAA

2. pcr amplification EspA fragment:

1. template preparation

Bacterial strain: EHEC O157:H7 bacterial strain, numbering 42828, source Nat'l Pharmaceutical ﹠ Biological Products Control Institute.

After the bacterial strain that the guarantor plants is activated, be coated with the LB flat board, 4 single bacterium colonies of picking are cultivated 4h in the LB fluid medium, get the centrifugal supernatant discarded of bacterium liquid 5ml, and it is resuspended to add distilled water 1ml, boils 10min in the boiling water, and the centrifugal supernatant of leaving and taking is made pcr template.

2. design primer

EspA base sequence, restriction enzyme site result for retrieval and design of primers principle design primer according to retrieval are as follows:

P1：5′-CCATGGATACATCAAATGCAAC-3′

P2：5′-CTCGAGTTTACCAAGGGATATT-3′

The forward primer design adds the CC base at the sequence front end, constitute the NcoI restriction enzyme site with the G of start codon ATG and back, downstream primer removes termination codon, doses XhoI restriction enzyme site CTCGAG, and termination codon is used the codon of 6 His amino acid label back of pET28a (+).

The PCR reaction system is as follows: cumulative volume 150 μ l

P1:3 μ l, P2:3 μ l, 10 * PCR buffer, 15 μ l, Taq DNAase 3 μ l, dNTP 12 μ l templates: 6 μ l, DDH ₂O:108 μ l

Reaction condition is as follows:

Pre-degeneration: 94 ℃ 5 minutes

Cyclic amplification: 94 ℃ 1 minute; 55 ℃ 1 minute; 72 ℃ 1 minute

Extend: 72 ℃ 10 minutes

The pcr amplification instrument: BioRad company produces

Nucleic acid electrophoresis the results are shown in accompanying drawing 1.

3. reclaim pcr amplification product

Record 1.0% agarose gel that to go up sample 200 μ l.

Pcr amplification product is added on the electrophoresis in the sample hole, stop electrophoresis when indicator migrates to the appropriate location.

Under Burdick lamp, separate and contain the segmental gel of purpose, move into the 1.5mlEP pipe.

Reclaim test kit (DaLian, China Takara company) with gel and reclaim gel, the strict test kit of pressing of operation

Description is carried out.

3. EspA is connected to the pMD18-T carrier and transforms and causes DH5 α engineering bacteria

1. EspA is connected with pMD18-T

By the content of UV spectrophotometer measuring recovery product, by the principle of external source fragment and carrier mole ratio 1: 2～10, design coupled reaction system is as follows:

EspA 1 μ l, pMD18-T 1 μ l, ddH ₂O 3 μ l, ligation solution 5 μ l, 16 ℃ connect 3h.

2. prepare DH5 α competence bacteria (C _aCl ₂Method is with reference to " fine works molecular biology experiment guide ")

3. after connecting plasmid is transformed into DH5 α (the heat shock method is with reference to " fine works molecular biology experiment guide ")

4. Amp ⁺-LB plate screening transforms successful antibacterial

LB negative control flat board is covered with antibacterial, Amp ⁺The dull and stereotyped negative dull and stereotyped aseptic length of being born of-LB; The positive control flat board has indigo plant, white macula colony growth, and picking transforms dull and stereotyped going up and separates good white macula colony inoculation in 7mlAmp ⁺In-LB the culture fluid, 37 ℃ of shaking table overnight incubation.Get 4ml extracting plasmid, identify that with NcoI and XhoI double digestion the enzyme action system is as follows:

Plasmid 5 μ l, NcoI 1 μ l, XhoI 1 μ l, 10 * buffer (K), 1 μ l, BSA 1 μ l, ddH ₂O1 μ l, mixing, 37 ℃ of water-bath 4h, electrophoresis.

The plasmid size conforms to desired value with the clip size of downcutting.

5. order-checking: the antibacterial of above-mentioned conversion success is sent to the order-checking of Beijing three rich Radix Polygalae companies, and sequencing result and Gen Bank sequence relatively have only the 111st bit base by A → G, but coded amino acid does not change.

4.EspA genetic fragment is connected to pET-28a (+) and is transformed in the BL21 expression antibacterial

1. plasmid extraction test kit (DaLian, China Takara company) is adopted in the extraction of EspA-pMD18-T plasmid, and operating procedure is undertaken by the test kit description.

2. pET28a (+) plasmid extracts, and method is the same.

3. use above two plasmids of NcoI and XhoI enzyme action, pET28a (+) carrier that obtains the EspA fragment and open

4. connect EspA and pET28a (+), the construction recombination plasmid structural representation is seen accompanying drawing 2.

5. be transformed into BL21 (DE3) and express (the heat shock method is with reference to " fine works molecular biology experiment guide ") in the antibacterial

6. serve the order-checking of Hai Boya company after enzyme action is identified, it is consistent that result and three wins the order-checking of Radix Polygalae companies, sees accompanying drawing 3.

Obtain pET28a (+)-EspA expression vector with said method.

Embodiment 2

Engineering bacteria BL21-pET28a (+)-EspA of preparation destination protein promptly prevents to use enterohemorrhagic Escherichia coli O 157: the H7 vaccine

1..IPTG induce the evaluation of segmental expression of purpose and expression-form:

1. IPTG induces BL21 (DE3) to express

Recombination engineering BL21-pET28a (+)-EspA carries out Tris-Tricine electrophoresis observation protein expression situation after IPTG induces, the EspA high expressed is seen accompanying drawing 4 compared with the control.

2. behind the broken bacterium of ultrasound wave, carry out speed reducing centrifugal, get precipitation and supernatant respectively and do protein electrophoresis, expression-form shown in the electrophoretogram mainly is that inclusion body is expressed.See accompanying drawing 5.

2. the washing of inclusion body and purification:

1. broken bacterium: high pressure homogenate instrument breaks bacterium

2. inclusion body separates: the method for differential centrifugation.

3. washing: the carbamide-TE buffer with TE+Triton X100 and variable concentrations washs respectively

4. dissolving: with 8M carbamide dissolving inclusion body

5. the dialysis of the TrisCl buffer of dialysis: 20mM removes carbamide

6. carry out protein purification with the method for affinity chromatograph, utilize the foreign protein of pET-28a (+) plasmid expression to have this characteristic of His label, adopt the method for affinity chromatograph to carry out protein purification, the results are shown in accompanying drawing 6.

3.EspA albumen n end determined amino acid sequence:

1. prepare 10% SDS-PAGE gel, 1: 1 mixing of the albumen of 2 * SDS sample-loading buffer and purification boils 5min, sample 20 μ l on every hole, electrophoresis 2h, protein isolate.

2. the de-electrifying swimming buffer that inclines is carefully dismantled the gel interlayer, gently glass plate is separated.

3. in small-sized transfer device, assemble the transfer printing interlayer by following order: frame of plastic, sponge, filter paper, gel, pvdf membrane, filter paper, sponge, frame of plastic.The pvdf membrane assembling is prepended to moistening in 100% methanol.

4. the transfer printing interlayer is inserted transfer device, the most close anodic be film.Be full of device with the CAPS transfering buffering liquid, shift 3h with 50V.

5. carefully take off pvdf membrane, with the 50% methanol dyeing 1min that contains 0.1% coomassie brilliant blue R250, with 50% methanol that contains 10% acetic acid decolour to background clear till.

6. with blade the target protein band is downcut, put into microcentrifugal tube, room temperature is air-dry, send the order-checking N of central laboratory of Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences 5 aminoacid of end.The results are shown in accompanying drawing 6.

4. the preparation of polyclonal serum

1. animal is selected: two of adult rabbits.

2. route of inoculation: subcutaneous injection.

3. inoculation position: extremity axillary fossa, four volas, cervical region.

4. adjuvant uses: be Freund's complete adjuvant, lanoline for the first time: paraffin oil=1: 1, BCG:1 prop up/only (0.2-0.3mg/ props up), are ground to complete emulsifying, become the Water-In-Oil sample.

5. vaccination strategies:

Inoculum concentration, every 2mg antigen; The inoculation volume, every 2ml; Inoculation time is inoculated 4 times altogether, and the first time is 3 weeks at interval, second and third minor tick 10 days.

6. sampling: heart extracting blood.

7. the detection of polyclonal serum antibody titer (two-way agar gel diffusion test)

A) on horizontal table top, 1% agar that melts is fallen on microscope slide every about 4ml of microscope slide.

B) with the card punch punching, aperture 3mm, pitch-row 4mm is quincunx.

C) with antibody to be measured since 1: 2, make doubling dilution successively, in the hole, antigen stock adds interstitial hole, the about 15 μ l in every hole around adding respectively counterclockwise.

D) put into wet box, 37 ℃ of effect 24h, observed result.

E) dye: filter paper is drenched cover on slide, put in 37 ℃ of incubators and spend the night, drench filter and paper after thoroughly drying and take off, slide places 5% amino black dye liquor dyeing 10min, decolours with the methanol solution that contains 50% acetic acid, till background is clear, takes a picture at last.See accompanying drawing 7, visible antibody titer is 1: 32.

Conclusion: BL21 (DE3) engineering bacteria that obtains containing pET28a (+)-EspA expression vector; EspA is people and domestic animal prevention enterohemorrhagic Escherichia coli O 157: the H7 vaccine.

Connect structure with genetic engineering and merge the multivalence subunit antigen, adopt the inventive method, can obtain people and domestic animal prevention enterohemorrhagic Escherichia coli O 157 equally: the H7 vaccine, and can reach same effect.

Embodiment 3

O157:H7 infects the foundation of Balb/c mouse model:

1. the selection of the O157:H7 antibacterial of anti-streptomycin:

A) antibiotic selection

Select for use 8 age in week 20 of Balb/c mices, 4 groups of average marks, 3 groups of experimental grouies, 1 group of matched group is after adapting to for 1 week, experimental group contains streptomycin, the kanamycin of 5g/l, the sterilized water of ampicillin respectively, allow it drink 3 days, matched group gives normal sterilized water, gets the mice fresh excreta after 3 days in the PBS buffer, with the vortex mixer broken mixing that shakes, inoculation LB solid medium is counted cultivation behind the doubling dilution.Observe the removing effect of three kinds of antibiotic to intestinal bacteria.

B) selection of the O157:H7 antibacterial of the anti-streptomycin of high resistance

I, frozen O157:H7 bacterial strain is coated on the LB solid medium, cultivated 24h in 37 ℃.

Ii, the above-mentioned single colony inoculation of picking are in the LB of the streptomycin that contains 10 μ g/ml fluid medium, and 37 ℃ are shaken bottle 150rpm24h and cultivate.Bacterium liquid is coated on the LB solid medium, cultivated 24h in 37 ℃.

Iii, get step 2 gained bacterium colony and identify the LB fluid medium that is inoculated in the streptomycin that contains 20 μ g/ml after errorless with three kinds of O157 diagnostic serums, 37 ℃ are shaken bottle 150rpm24h and cultivate.Bacterium liquid is coated on the LB solid medium, cultivated 24h in 37 ℃.

Iv, get the step 3 gained bacterium colony LB fluid medium that is inoculated in the streptomycin that contains 50 μ g/ml with quadrat method.

V, get the step 4 gained bacterium colony LB fluid medium that is inoculated in the streptomycin that contains 100 μ g/ml with quadrat method.

Vi, get the step 5 gained bacterium colony LB fluid medium that is inoculated in the streptomycin that contains 200 μ g/ml with quadrat method.

Vii, get step 6 gained bacterium colony with three kinds of O157 diagnostic serums identify errorless after, protect kind called after EHEC O157-SMR.

2. the selection of EHEC O157 mouse infection adapted strain

A) with EHEC O157-SM ^RBe inoculated in the LB culture medium, 37 ℃ of shaken cultivation 6h abandon supernatant after centrifugal, again with aseptic LB washing 2 times, at last with the resuspended thalline of aseptic LB liquid.Experiment mice all gives 5g/L streptomycin solution and drinks 3d, and jejunitas 1d then all cuts off the water supply.Again with this bacterium liquid peroral infection Balb/c mice (every the real filling of mice bacterium 1 * 10 ¹⁰CFU), attack the streptomycin solution that all gives 0.5g/L behind the bacterium and drink, observe the mice clinical symptoms and also it is done microbiology and detect.Separate O157 the stool in mice after infecting 3d, with antiserum coagulation, sorbitol fermentation experimental identification errorless after, called after EHEC O157-SM ^R1.

B) with EHEC O157-SM ^R1 dosage peroral infection Balb/c mice is in kind observed the mice clinical symptoms and also it is done microbiology and detect.Separate O157 the stool in mice after infecting 3d, with antiserum coagulation, sorbitol fermentation experimental identification errorless after, called after EHEC O157-SM ^R2.

C) with EHEC O157-SM ^R2 dosage peroral infection Balb/c mices are in kind observed the mice clinical symptoms and also it are done microbiology and detect.

D) EHEC O157-SM ^R2 virulence gene detects:

In order to ensure the bacterium colony that filters out with streptomycin is needed EHEC O157-SM ^R2, according to the distinctive gene order design of this bacterial strain primer, with EHEC O157-SM ^R2 DNA does pcr amplification as template, and the result is positive is required EHEC O157-SM ^R2.

The hlyA that announces with GenBank and the 2241st～2730bp genetic fragment (hlyAB) of hlyB gene nucleotide series (Access Number:U12572), intiminC300 (AccessNumber:NC 002695), Stx2B (Access Number:AE005174) are as the specific gene of O157, according to the design of primers principle, design following primer.

HlyAB: forward primer P1:5 '-acaacacacactcaacaactt-3 '

Downstream primer P2:5 '-actctccgactactgttgctc-3 '

IntiminC300: forward primer P3:5 '-acttcagcacttaatgccagtgcgg-3 '

Downstream primer P4:5 '-ttctacacaaaccgcatagacatttg-3 '

Stx2B: forward primer P5:5 '-atgaagaagatgtttatggcggt-3 '

Downstream primer P6:5 '-tcagtcattattaaactgcacttc-3 '

Primer Primer Premier 5.0 software designs and assay, and synthetic by Shanghai Bo Ya company, and PAGE is pure.

The pcr amplification of genes of interest

Template preparation: EHEC O157-SM ^R2 incubated overnight bacterium liquid 2ml 10000rpm removed supernatant in centrifugal 5 minutes, added 0.2ml distilled water mixing and boiled 10 minutes, got supernatant after same centrifugal to make template.

The pcr amplification reaction system is as follows:

	HlyAB	IntC300	Stx2B
				Template DNA	1μl	1μl	1μl
P1(25pmol/μl)	1μl	1μl	1μl
				P2(25pmol/μl)	1μl	1μl	1μl
dNTPs(2.5mmol/L each)	4μl	4μl	4μl
				10×PCR buffer	5μl	5μl	5μl
Ex-Taq DNA polymerase	1μl	1μl	1μl
				ddH 2O	37μl	37μl	37μl
total volume	50μl	50μl	50μl

With the reaction system mixing that vibrates, after the centrifugal treating, add 40 μ l paraffin oil.94 ℃ of pre-degeneration 5min, 94 ℃ of degeneration 90s, 60 ℃ of annealing 60s, 72 ℃ are extended 90s, 35 circulations, 72 ℃ are extended 10min fully.Get 5 μ l product after reaction finishes, 1.0% agarose gel electrophoresis detects the PCR effect.The results are shown in accompanying drawing 9

3. EHEC O157:H7 infects the foundation of Balb/c mouse model

A) bacterial strain and attack bacterium liquid preparation

EHEC O157-SM ^R2 are inoculated in the LB culture medium, and (count results is 4 * 10 to 37 ℃ of shaken cultivation 6h after doubling dilution pours into cultivation ⁹CFU/ml), abandon supernatant after centrifugal,,, adjust viable bacteria concentration and be about 1.5 * 10 at last with the resuspended thalline of aseptic LB liquid again with aseptic LB washing 2 times ¹⁰CFU and 1.5 * 10 ⁹The viable bacteria of CFU/ml.

B) animal grouping and processing

3 groups of mice each minutes of 3 kinds of different sizes (5,7,9w age), 2 groups of experimental grouies, 1 group of matched group, 6 every group, all groups all give 5g/L streptomycin solution and drink 3d.Excrement inspection intestinal discharge of bacteria is less than 10 behind the 3d ³CFU/g, jejunitas 1d then all cuts off the water supply.Irritating stomach attacks the streptomycin solution that all gives 0.5g/L behind the bacterium and drinks.

C) attack bacterium method and dosage

Experimental mice per os respectively (contains 1.5 * 10 approximately with raising the bacterium liquid that the stomach pin irritates after the 0.3ml LB liquid scrubbing ¹⁰CFU and 1.5 * 10 ⁹The viable bacteria of CFU/ml), at interval 2 times (every mice is irritated bacterium 1 * 10 to 6h continuous irrigation stomach ¹⁰CFU and 1 * 10 ⁹CFU).The matched group per os is irritated stomach LB fluid medium, the same experimental group of its dosage method.

D) collecting dung and cultivation

Mice is attacked and collected fresh excreta (shaping feces is adopted 10～15) in 1,4,7,10,13,16,19,22 day behind the bacterium in the PBS buffer, the reuse vortex mixer shakes broken, is inoculated in the SMAC flat board and counts cultivation.The colony characteristics of O157 on this culture medium be, the azymic sorbitol, and bacterium colony is transparent, smooth moistening, and to do slide coagulation experiment positive with the O157 diagnostic serum, and feces discharge of bacteria situation is seen accompanying drawing 10.

Embodiment 4

The antigenic immune counteracting toxic substances protection test of EspA

Adopt above-mentioned O157:H7 to infect Balb/c mouse infection animal model.

1. immune animal be 3 age in week the Balb/c mice, divide 3 groups: the subcutaneous immune group of EspA, EspA+Stx2B-intiminC300 group, PBS matched group, 12 every group.

2. subcutaneous immunizing antigen amount: 30 μ g//times; The immunity time: 0,1,2 weeks, totally 3 times; Adjuvant is the complete and Freund of Fu Shi.

3. 6 long-term observation of making antibody titer are stayed for every group in immunity 2,3 all backs, and ELISA detects antibody titer.See Figure 11 of description of drawings.

4. immune back 10 days, irritate the stomach counteracting toxic substances with the full bacterium liquid of O157, dosage is 1 * 10 ⁹CFU/ only, totally twice, each 6 hours at interval, left and took stool in mice, inoculation sorbitol Mai Kangkai culture medium (SMAC), monitoring antibacterial dropping situations respectively at the 3rd, 7,14,21,28 day.

5. result: have only 1 can only detect antibacterial after 1 week of two experimental mice, detect fully after 14 days less than, come off and matched group all detects antibacterial after 3 weeks, still have 5 to detect antibacterial after 4 weeks.Illustrate that the antibody that the EspA antigen immune produces has anti-adhesive field planting effect.See accompanying drawing 12.

Provable according to above experiment, the present invention has set up the animal model of Balb/c mouse infection, and carrying disease germs to reach 21 days, has made up the carrier that efficiently expresses, prepared antigen can effectively bring out the immune response of body, is the good antigen of preparation EHEC O157 vaccine.

After having read above-mentioned teachings of the present invention, those skilled in the art adopt the equivalent form of value that the present invention is made various changes or modifications, and fall within institute of the present invention restricted portion equally.

Sequence table

＜110〉Military Medical Univ No.3, P.L.A

＜120〉people and domestic animal prevention enterohemorrhagic Escherichia coli O 157: H7 vaccine and preparation method

<160>1

<170>Patent In Version 2.1

<210>1

<211>603

<212>DNA

＜213〉enterorrhagia Bacillus coil 0157: H7 (Enterohemorrhagic Escherichia coli O157:H7)

<220>

<221>misc_feature

<222>(44)…(656)

<400>1

CCTCTAGAAA TAATTTTGTT TAACTTTAAG AAGGAGATAT ACCATGGATA CATCAAATGC 60

AACATCCGTT GTTAATGTGA GTGCGAGTTC TTCGACATCG ACGATCTATG ACTTAGGTAA 120

TATGTCGAAG GATGAGGTGG TTAAGCTATT TGAGGAACTC GGTGTTTTTC AGGCTGCGAT 180

TCTCATGTTT TCTTATATGT ATCAGGCACA AAGTAATCTG TCGATTGCAA AGTTTGCTGA 240

TATGAATGAG GCATCTAAAG CGTCAACCAC GGCACAAAAG ATGGCTAATC TTGTGGATGC 300

CAAAATTGCT GATGTTCAGA GTAGCACTGA TAAGAATGCG AAAGCCAAAC TTCCTCAAGA 360

CGTGATTGAC TATATAAACG ATCCACGTAA TGACATAAGT GTAACTGGTA TTCGTGATCT 420

TAGTGGTGAT TTAAGCGCTG GTGATCTGCA AACAGTGAAG GCGGCTATTT CAGCTAAAGC 480

GAATAACCTG ACAACGGTAG TGAATAATAG CCAGCTCGAA ATTCAGCAAA TGTCGAATAC 540

ATTAAATCTC TTAACGAGTG CACGTTCTGA TGTGCAATCT CTACAATATA GAACTATTTC 600

AGCAATATCC CTTGGTAAAC TCGAGCACCA CCACCACCAC CACTGAGATC CGGCTGCTAA 660

Claims (7)

1. enterohemorrhagic Escherichia coli O 157 use in the prevention of people and domestic animal: the H7 vaccine is characterized in that: comprise enterohemorrhagic Escherichia coli (EHEC) O157:H7 and prepare the antigen of multivalence subunit antigen or fusion multivalence subunit by its virulence gene of clonal expression.

2. enterohemorrhagic Escherichia coli O 157 is used in people according to claim 1 and domestic animal prevention: the H7 vaccine is characterized in that: the antigen of the multivalence subunit antigen of described vaccine or fusion multivalence subunit is with specific components and mixed or fusion.

3. people according to claim 1 and 2 and domestic animal prevention enterohemorrhagic Escherichia coli O 157: H7 vaccine, it is characterized in that: the antigen component of described vaccine be in the m type secretory protein one or more and adhesin, hemolysin, shiga-like toxin (Stx) one or more mixture or merge the mixture of multivalence subunit antigen, and add other component on this basis and the mixture that forms.

4. enterohemorrhagic Escherichia coli O 157 use in the prevention of people according to claim 1 and 2 and domestic animal: the H7 vaccine is characterized in that: the antigen of the multivalence subunit of described vaccine or the antigen that merges the multivalence subunit are the genetic engineering recombiant proteins that obtains with particular combinations and connected mode fusion in the genetic engineering level.

5. prepare the prevention of described people of claim 1 and domestic animal and use enterohemorrhagic Escherichia coli O 157: the method for H7 vaccine may further comprise the steps:

(1) primer of the EspA gene order of design EHEC O157:H7 EDL933 type strain;

1) the forward primer design adds the CC base at the sequence front end;

2) G with start codon ATG and back constitutes the NcoI restriction enzyme site;

3) downstream primer removes termination codon, doses XhoI restriction enzyme site CTCGAG;

4) termination codon is used the codon of 6 His amino acid label back of pET28a (+);

(2) amplification of usefulness-PCR method obtains the EspA fragment;

(3) make up pET28a (+) plasmid that contains the EspA gene;

(4) expression vector is transformed in BL21 (DE3) engineering bacteria, isopropyl-b-D-thiogalactoside (IPTG) is induced and can be efficiently expressed EspA albumen, obtains to express engineering bacteria BL21-pET28a (+)-EspA of destination protein;

(5) fermentation BL21-pET28a (+)-EspA recombination engineering, great expression destination protein, purified acquisition purifying antigen;

6. enterohemorrhagic Escherichia coli O 157 is used in people according to claim 1 and domestic animal prevention: the H7 vaccine is characterized in that: described vaccine is suitable for oral and/or the subcutaneous administration approach.

7. one kind is used for the method that test right requires 1 described vaccine immunity performance, it is characterized in that: may further comprise the steps

(1) selects the O157:H7 antibacterial of the anti-streptomycin of high resistance with streptomycin pressure method for screening, obtain EHEC O157-SM ^RBacterium colony;

(2) selection of EHEC O157 mouse infection adapted strain

1) cultivates EHEC O157-SM with the LB fluid medium ^R1 bacterium colony and EHEC O157-SM ^R2 bacterium colonies;

2) primer of the specific gene of design hlyA and hlyB gene nucleotide series O157;

3) with PCR method amplifying target genes;

(3) set up EHEC O157:H7 and infect the Balb/c mouse model

1) uses EHEC O157-SM ^R2 are inoculated in the LB medium preparation attacks bacterium liquid, and animal is attacked bacterium;

2) collect feces with usual method, SMAC is dull and stereotyped to be cultivated, and measures colony characteristics;

(4) get above-mentioned O157:H7 and infect the Balb/c mice, test and anti-adhesive experimental check EspA people and domestic animal prevention enterohemorrhagic Escherichia coli O 157 with immune counteracting toxic substances protection: the immune performance of H7 vaccine.

Images