CN1268751C - Purification method of recombinant yeast strain and rhGM-CSF to express human granulocyte-macrophage colony stimulating factor - Google Patents
Purification method of recombinant yeast strain and rhGM-CSF to express human granulocyte-macrophage colony stimulating factor Download PDFInfo
- Publication number
- CN1268751C CN1268751C CN 03137202 CN03137202A CN1268751C CN 1268751 C CN1268751 C CN 1268751C CN 03137202 CN03137202 CN 03137202 CN 03137202 A CN03137202 A CN 03137202A CN 1268751 C CN1268751 C CN 1268751C
- Authority
- CN
- China
- Prior art keywords
- rhgm
- csf
- expression
- glu
- yeast
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention discloses a secretion type expression carrier of a recombinant human granulocyte macrophage-colony stimulating factor (rhGM-CSF), a simple purification method, a host cell converted by the secretion type expression carrier, and a method for the fermentation expression of rhGM-CSF by using the recombinant pichia yeast engineering strain of the expression carrier. In the present invention, a yeast secretion expression system replaces a colibacillus occlusion body expression system; the renaturation of target protein rhGM-CSF does not need; the biologic specific activity can reach 3.4*10<7> unit/ milligram protein; the secretion type expression carrier has low toxic and side effect; therefore, rhGM-CSF prepared by the method has the advantages of high yield, convenient purification technology, low cost and low toxic and side effect of products.
Description
[technical field]
The present invention relates to utilize recombinant DNA technology to produce the field of medical protein matter or polypeptide drugs, more particularly, the present invention relates to the purification process of secretion type expression human granulocyte macrophage colony stimulating factor recombinant vectors, yeast recombinant strain and rhGM-CSF.
[background technology]
At present, the rhGM-CSF of domestic production, mostly be e. coli expression product, exist the main technique shortcoming to be: colibacillary expression system needs renaturation for comprising build in the production process, renaturation yield is low, the highlyest be no more than 40%, wherein 60% is non-renaturation thing, can not remove, thereby specific activity is low (the highlyest has only 1.0 * 10
7Unit/milligram albumen), side effect is big; The expression of saccharomyces cerevisiae engineered yeast strain belongs to the nonconformity type to be expressed, and has unstable expression, the product expression amount is lower and gene such as easily loses at defective.
[summary of the invention]
In order to overcome above-mentioned defective, the objective of the invention is to adopt the yeast secreted expression system to replace inclusion bodies of colibacillus type expression system, target protein rhGM-CSF does not need renaturation, significantly improves its biological specific activity, reduces side effect, reduces production costs.
The construction process of the Yeast recombinant strain of secreting, expressing rhGM-CSF is: the GAP promotor/α-site, factor signal peptide downstream that will clone the rhGM-CSF gene insertion pGAPZ α-A that modifies, Ste13 site (Glu-Ala-Glu-Ala) and atg start codon ATG after deletion Kex2 (Lys-Arg) site are built into the rhGM-CSF secreted expression carrier; Utilize the method for the Pichia EasyComp Transformation Kit of Australian Invitrogen company to make improvements, with the bacterial strain GS115 of rhGM-CSF secreted expression carrier conversion pichia (Pichia pastoris), be built into yeast recombinant strain-rhGM-CSF/pGAPZ α-A/GS115 of secretion type expression rhGM-CSF; Analyze and biological specific activity mensuration by antibiotic-screening, SDS-PAGE, obtain target yeast recombinant strain.
The expression amount of above-mentioned yeast recombinant strain target protein rhGM-CSF accounts for 50% of secretion total protein, and specific activity is 3.4 * 10
7About unit/milligram albumen; Target protein rhGM-CSF has the immunogenicity identical with natural rhGM-CSF.It is to be integrated in the genome form that this engineering strain is accepted foreign gene, this and intestinal bacteria, the outer plasmid expression system of the independent genome of yeast saccharomyces cerevisiae has marked difference, so this engineering strain is than intestinal bacteria, yeast saccharomyces cerevisiae is stable, be difficult for taking place foreign gene and lose phenomenon, with engineering bacteria as the sample template, pass through PCR, its rate of accuracy reached 100% of the positive strain that technical evaluation such as molecular hybridization choose, and the direct expression-secretion of its objective expression product rhGM-CSF is in nutrient solution, therefore the biological activity that detects its expressing quantity and target product is very simple and easy, and this needs renaturation much superior than the coli expression system expression product; In addition, yeast is a kind of simple eukaryote, and it expresses the post-treatment mode class like higher eucaryote, so the gene product of expressing with it not only has the identical biological activity of natural product, and side effect is low, and product cost is low, and suitability is wide.
The purification process of rhGM-CSF is: utilize the high product expression amount, the active Yeast recombinant strain of high product that obtain to ferment, centrifugal collection supernatant liquor adds ammonium sulfate, crosses Phenyl Sepharose column chromatography, collect the target elution peak, cross DEAE Sepharose column chromatography, collect the target elution peak, cross Sephacryl S-200 column chromatography, collect target peak, obtain rhGM-CSF stoste, purity is greater than 95%, and specific activity is greater than 3.4 * 10
7Unit/milligram albumen.
The purification process of rhGM-CSF provided by the invention has improved the proteinic specific activity of GM-CSF, has reduced purification procedures, has reduced production cost, has reduced clinical side effects, uses in industrial production and will obtain good economic benefit.
[description of drawings]
Fig. 1 makes up collection of illustrative plates for the rhGM-CSF Yeast expression carrier.
PGAPZ α-A/rhGM-CSF expression vector molecular size is 3.534kb.Wherein pGAPZ α-A is 3.147kb, and rhGM-CSF is 387bp (comprising terminator codon 3bp); RhGM-CSF is inserted between carrier pGAPZ α-A 747bp (XhoI site) and the 824bp (XbaI site).
PGAPZ α-A carrier structure is:
GAP promoter region: 1-483bp
PGAP primer sites: 455-476bp
α-factor peptide signal sequence: 493-759bp
α-factor primer sites: 696-716bp
Carrier multiple clone site: 760-828bp
Myc antigenic determinant bag: 827-856bp
Poly Histidine bag: 872-889bp
3 '-AOX1 primer sites: 974-994bp
AOX1 Transcription Termination zone: 893-1233bp
TEF1 promoter region: 1234-1644bp
EM7 promotor: 1645-1712bp
Sh ble reads frame: 1713-2087bp (coding zeocin resistance)
CYC1 Transcription Termination zone: 2088-2405bp
ColE1 copy-point (deriving from the pUC carrier): 2416-3089bp
Fig. 2 is the SDS-PAGE electrophoretic analysis figure of each step of purifying of GM-CSF.Be followed successively by swimming lane 1-7 among the figure from left to right, wherein swimming lane 1 is a fermented liquid expression amount collection of illustrative plates; Swimming lane 2 is a Phenyl Sepharose column chromatography purification collection of illustrative plates; Swimming lane 3 is a DEAE Sepharose column chromatography purification collection of illustrative plates; Swimming lane 4,5,7 is a Sephacryl S-200 column chromatography purification collection of illustrative plates; Swimming lane 6 is a molecular weight marker thing collection of illustrative plates.
Fig. 3 is that GM-CSF stoste purity is identified collection of illustrative plates.Be followed successively by swimming lane 1-7 among the figure from left to right, wherein swimming lane 1 is a molecular weight marker thing collection of illustrative plates; Swimming lane 2,4,6 is GM-CSF stoste reduction electrophoretogram; Swimming lane is 3,5,7 for the non-reduced electrophoretogram of GM-CSF.
Fig. 4 is that GM-CSF stoste purity is identified collection of illustrative plates, is followed successively by swimming lane 1-10 among the figure from left to right, and wherein swimming lane 1,2,3,8,9,10 is the non-reduced electrophoretogram of GM-CSF stoste; Swimming lane 4,5,6 is GM-CSF stoste reduction electrophoretogram; Swimming lane 7 is a molecular weight marker thing collection of illustrative plates.
Fig. 5 is the rhGM-CSF graphic representation: with the OD value is Y-axis, is X-axis with dilution gradient logarithm on the plate, makes the dose-effect relationship figure of standard substance curve and product to be checked, its result: specific activity=3.77 * 10
7U/mg.
Fig. 6 is the rhGM-CSF graphic representation: with the OD value is Y-axis, is X-axis with dilution gradient logarithm on the plate, makes the dose-effect relationship figure of standard substance curve and product to be checked, its result: specific activity=3.81 * 10
7U/mg.
Fig. 7 is the rhGM-CSF graphic representation: with the OD value is Y-axis, is X-axis with dilution gradient logarithm on the plate, makes the dose-effect relationship figure of standard substance curve and product to be checked, its result: specific activity=3.66 * 10
7U/mg.
[embodiment]
Introduce the present invention in detail in the structure of rhGM-CSF recombination yeast engineering strain and the concrete application in the rhGM-CSF purifying process below in conjunction with embodiment.
Embodiment 1
One, the structure of rhGM-CSF Yeast engineering bacteria
(1) material:
1.rhGM-CSF gene
2.pGAPZ α-A, P.pastoris Strain GS115 (his4) are available from Australian Invitrogen company.
(2) method:
1. gene PCR amplification:
(1) design of primers: Ste13 site (Glu-Ala-Glu-A1a) and atg start codon ATG after in 5 ' end primer, deleting Kex2 (Lys-Arg) site.
P1-5 ' G
CTCGAGAAAAGA
ATGGCTCCAGCCCGT3 ' (" ATG " is deleted)
Xho I Lys-Arg (Kex2 site)
P2-5’G
TCTAGATTACTCCTGGACTGGCTC3’
XbaI
(2) thermal cycling: 95 ℃, 5 '; 95 ℃, 30 " → 43 ℃, 30 " → 72 ℃, 40 "; 72 ℃, 10 '; 30 circulations of increasing.
2.PCR amplified production reclaims and the clone:
(1) the rhGM-CSF gene obtains the DNA band of about 400bp behind the amplification electrophoresis;
(2) the PCR product high purity test kit of producing with German Bao Ling Man reclaims target fragment and carries out the T-Vector clone.
3. gene sequencing: the ABI 377A automatic dna sequencer that adopts U.S. PE company to produce carries out dna sequence analysis.
4. yeast secretion type expression vector construction: adopt gene clone technology with the rhGM-CSF gene by the XhoI/Xba I site that XhoI/XbaI inserts GAP promotor/α-factor signal peptide downstream of pGAPZ α-A, be built into the secretor type Yeast expression carrier that contains α-factor signal peptide; Expression vector transforms GS115 (his4): the method for PichiaEasyComp Transformat ion Kit (Cat.No.K1730-01) through making improvements slightly of utilizing Australian Invitrogen company to produce carried out.Concrete operations are as follows: the single bacterium colony of (1) picking pichia (Pchia pastoris) GS115, at 30 ℃, under 300 rev/mins of conditions with YPD+Zeocin100 mg/litre substratum shaking culture to OD600=1.3-1.5; Get in 0.2-0.3 milliliter bacterium liquid to the 20 milliliter same substratum shaking culture and get the 10ml nutrient solution, with centrifugal 5 minutes of 5000 rev/mins, room temperature to OD600=6-8, remove supernatant, resuspended with 10 ml soln I, the centrifugal supernatant that goes, use 2 ml soln I resuspended again, promptly make competent cell; (2) get 50 microlitre competence, add the linearizing rhGM-CSF recombinant expression vector of 5 microlitres, add 1000 ml soln II again, cultivated 1 hour for 30 ℃ behind the mixing, during do every 15 minutes that once vibration is mixed to be handled; (3) 42 ℃ of heat shocks were handled 10 minutes; (4) with culture with centrifugal 15 minutes of 5000 rev/mins, room temperature, remove supernatant, resuspended with 500 ml soln III, the centrifugal supernatant that goes uses 150-200 ml soln III resuspended again, coats YPD+Zeocin100 mg/litre flat board, cultivated 3-5 days for 30 ℃, until producing single bacterium colony.
5. the screening of high expression level Yeast engineering bacterium strain: behind Zeocin antibiotic-screening acquisition positive strain, extract the engineering bacteria genomic dna, the 400bp dna fragmentation of the DiG Labelling and Detection Kit mark rhGM-CSF gene of further making pcr analysis with primer P1/P2 and producing with German Bao Ling company is as hybridization probe, carry out technical evaluation such as Southern blotting and filter out positive strain, again with the rhGM-CSF/pGAPZ α-A/GS115 engineering strain of SDS-PAGE silver dyeing electrophoresis screening high expression level target protein.
The purification process of rhGM-CSF:
1. bacterial classification is preserved
Structure efficiently expresses the rhGM-CSF Yeast engineering bacteria, and (behind the rhGM-CSF/pGAPZ α-A/GS115), preserve bacterial classifications for-80 ℃, perhaps sealing is preserved after the skimmed milk lyophilize.
2. actication of culture
Plate culture medium prescription (%):
Yeast powder 1.0 peptones 2.0 glucose 2.0 agar 2.0
Get a bacterial classification, choose bacterium liquid and draw flat board, cultivated 24 hours for 30 ℃ then
3. primary seed solution
YPD culture medium prescription (%):
Yeast powder 1.0 peptones 2.0 glucose 2.0
In the YPD substratum, add 100mg/Lzeocin, get activation bacterium liquid then, cultivated 12 hours for 30 ℃ by inoculum size 1% inoculation.
4. secondary seed solution
YPD culture medium prescription (%):
Yeast powder 1.0 peptones 2.0 glucose 2.0
By inoculum size 1% inoculation, cultivated 12 hours for 30 ℃.
5. fermentation
Fermentative medium formula (%):
Yeast powder 1.0 peptones 2.0 0.1N potassiumphosphates are towards liquid PH6.0
YNB1.34 vitamin H 4 * 10
-6Glycerine 3.0
YNB wherein, the vitamin H filtration sterilization adds in the fermentor tank during fermentation inoculation, and in the sub-fermentor tank of all the other medium components 121 ℃, sterilization in 20 minutes.
Inoculum size: 8-10%
Culture condition: 30 ℃, PH6.0, DO＞30%, NBS fermentor tank
Incubation time: 72 hours
PH regulates: 5NNaOH regulates PH6.0
Feed supplement: 50% glycerine
5. separation and purification
Centrifugal collection fermented supernatant fluid adds 20% ammonium sulfate by final concentration, and last Phenyl Sepharose post is collected 5% ammonium sulfate elution peak; Stir dialysis through three 25mMTris-HCl damping fluids, each 6h, then, last DEAE Sepharose post is collected 0.4M NaCl elution peak; Then use the ultra-fine filter ultrafiltration and concentration of molecular weight cut-off 3000Dalton, the concentrated solution protein concentration is greater than 5mg/ml (1owry method), cross Sephacryl S-200 column chromatography, collect the target protein peak, obtain purity greater than 95% rhGM-CSF stoste, protein concentration is greater than 500 μ g/ml, and protein recovery is 30%.
The purity detecting method: (1) SDS-PAGE silver dyeing electrophoretic method, applied sample amount 5 μ g have only a colour developing spot; (2) HPUC method has only single chromatographic peak.
Biological activity assay: mtt assay, specific activity is greater than 3.4 * 10
7Unit/milligram albumen.RhGM-CSF is active to be detected
Two, material:
1,1640 liquid: RPMI1640 (GIBCO product) by specification preparation.
2, basic culture solution: 1640 liquid add 10% foetal calf serum.
3, complete culture solution: basic culture solution is added GM-CSF to final concentration 4ng/ml.
4, MTT (Thiazolyl blue): the Fluka product, be mixed with the solution of 5.0mg/ml with phosphate buffered saline buffer, after the filtration sterilization, 4 ℃ keep in Dark Place.
5, lysate: dimethyl sulfoxide (DMSO) (analytical pure)
6, standard substance: temporary U.S. Schering Plough company macrophage colony stimulating factor of recombinant human granulocyte (Granulocyte Colony-stimulating) substitutes.(labelled amount 50 μ g tire: 0.555 * 10
6μ/ml)
7, TF-1 cell: with 37 ℃ of 5%CO of complete culture solution
2Cultivate under the condition, went down to posterity in 48-72 hour at interval.
Three, method operation: (TF-1 cell proliferative response/MTT colorimetry)
1, the preparation of TF-1 cell suspension:
Get well-grown FT-1 cell, the centrifugal 10min of 1000rpm abandons supernatant, and sedimentation cell is suspended in the basic culture solution after washing 3 times with nutrient solution, and adjusting cell quantity is 4 * 10
5Individual/ml, standby.
2, the preparation of sample:
The dilution of standard substance: standard substance are diluted to 5 * 10 with 1640 liquid
3Doubly, as starting point concentration.
The dilution of product to be checked: product to be checked are diluted to 2 * 10 with 1640 liquid
5Doubly, as starting point concentration.
3, the active detection:
A, on 96 orifice plates from first row A → B to lower concentration preparation standard product and product doubling dilution gradient to be checked, 11 gradients of each sample, each gradient 2 hole.The surplus liquid of 50ml is stayed in every hole, and the 12nd row does the blank group.
B, every hole add cell suspension 50 μ l, put 37 ℃ of 5%CO
2Cultivated 45 hours.
C, every hole add MTT20 μ l, put 37 ℃, 5%CO
2Cultivated 4 hours.
D, abandon supernatant, every hole adds lysate 150 μ l, colorimetric behind the mixing.Set wavelength 492nm, survey its OD value.
Four, the result calculates:
1, being Y-axis with the OD value, is X-axis with dilution gradient logarithm on the plate, makes the dose-effect relationship figure of standard substance curve and product to be checked.
2, pressing each sample curve is this sample value at the dilution gradient logarithm of partly imitating OD value place, represents with letter C.
3, formula
Product to be checked tire=and standard substance tire * and 2
C1-C2* D
1/ D
2
C wherein
1Be standard substance C value
C
2Be product C value to be checked
D
1Be the pre-extension rate of sample to be checked
D
2Be the pre-extension rate of standard substance, the results are shown in accompanying drawing 5,6,7
Nucleotide and/or aminoacid sequence table
＜110〉Hainan Guodong Medicament Inst.
＜120〉purification process of the Yeast recombinant strain of expressing human rHuGM-CSF and rhGM-CSF
<160>2
<210>1
<211>387
<212>DNA
＜213〉human blood leukocyte (human blood white cell)
<220>
<221>CDS
<222>(1)...(387)
<400>1
atggcacctg?cccgttctcc?gagcccgagc?actcagccgt?gggagcatgt?gaatgccatc?60
caggaggccc?ggcgtctcct?gaacctgagt?agagacactg?ctgctgagat?gaatgaaaca?120
gtagaagtca?tctcagagat?gtttgacctc?caggagccga?cctgcctaca?gacccgcctg?180
gagctgtaca?agcagggcct?gcggggcagc?ctcaccaagc?tcaagggccc?cttgaccatg?240
atggccagcc?actacaagca?gcactgccct?ccaaccccgg?aaacttcctg?tgcaacccag?300
attatcacct?ttgaaagttt?caaagagaac?ctgaaggact?ttctgcttgt?catccccttt?360
gactgctggg?agccagtcca?ggagtaa?387
Met?Ala?Pro?Ala?Arg?Ser?Pro?Ser?Pro?Ser?Thr?Gln?Pro?Trp?Glu?His
1 5 10 15
Val?Asn?Ala?Ile?Gln?Glu?Ala?Arg?Arg?Leu?Leu?Asn?Leu?Ser?Arg?Asp
20 25 30
Thr?Ala?Ala?Glu?Met?Asn?Glu?Thr?Val?Glu?Val?Ile?Ser?Glu?Met?Phe
35 40 45
Asp?Leu?Gln?Glu?Pro?Thr?Cys?Leu?Gln?Thr?Arg?Leu?Glu?Leu?Tyr?Lys
50 55 60
Gln?Gly?Leu?Arg?Gly?Ser?Leu?Thr?Lys?Leu?Lys?Gly?Pro?Leu?Thr?Met
65 70 75 80
Met?Ala?Ser?His?Tyr?Lys?Gln?His?Cys?Pro?Pro?Thr?Pro?Glu?Thr?Ser
85 90 95
Cys?Ala?Thr?Gln?Ile?Ile?Thr?Phe?Glu?Ser?Phe?Lys?Glu?Asn?Leu?Lys
100 105 110
Asp?Phe?Leu?Leu?Val?Ile?Pro?Phe?Asp?Cys?Trp?Glu?Pro?Val?Gln?Glu
115 120 125 128
<210>2
<211>128
<212>PRT
＜213〉human blood leukocyte (human blood white cell)
<400>2
Met?Ala?Pro?Ala?Arg?Ser?Pro?Ser?Pro?Ser?Thr?Gln?Pro?Trp?Glu?His
1 5 10 15
Val?Asn?Ala?Ile?Gln?Glu?Ala?Arg?Arg?Leu?Leu?Asn?Leu?Ser?Arg?Asp
20 25 30
Thr?Ala?Ala?Glu?Met?Asn?Glu?Thr?Val?Glu?Val?Ile?Ser?Glu?Met?Phe
35 40 45
Asp?Leu?Gln?Glu?Pro?Thr?Cys?Leu?Gln?Thr?Arg?Leu?Glu?Leu?Tyr?Lys
50 55 60
Gln?Gly?Leu?Arg?Gly?Ser?Leu?Thr?Lys?Leu?Lys?Gly?Pro?Leu?Thr?Met
65 70 75 80
Met?Ala?Ser?His?Tyr?Lys?Gln?His?Cys?Pro?Pro?Thr?Pro?Glu?Thr?Ser
85 90 95
Cys?Ala?Thr?Gln?Ile?Ile?Thr?Phe?Glu?Ser?Phe?Lys?Glu?Asn?Leu?Lys
100 105 110
Asp?Phe?Leu?Leu?Val?Ile?Pro?Phe?Asp?Cys?Trp?Glu?Pro?Val?Gln?Glu
115 120 125 128
Claims (5)
1, a kind of secreted expression carrier of express recombinant human granulocyte macrophage colony stimulating factor, it is characterized in that, this carrier contains: the rhGM-CSF sequence of reorganization, it is inserted into GAP promotor/α-factor signal peptide downstream site Xhoi/Xbai of pGAPZ α-A, delete Kex2 site Glu-Ala-Glu-Ala encoding sequence and atg start codon ATG afterwards simultaneously, be built into the rhGM-CSF secreted expression carrier.
2, a primary yeast recombinant bacterial strain is characterized in that being transformed the positive expression bacterial strain that GS115 obtains by the described expression vector of claim 1.
3, yeast recombinant bacterial strain according to claim 2 is characterized in that described positive expression bacterial strain is rhGM-CSF/pGAPZ α-A/GS115, a kind of secretor type rhGM-CSF yeast recombinant strain.
4, the production method of a kind of rhGM-CSF, the described yeast recombinant bacterial strain of the claim 3 that it is characterized in that fermenting is collected its secretory product.
5, the purification process of a kind of rhGM-GSF, it is characterized in that utilizing the yeast recombinant strain inoculation fermentation of claim 3, separation and purification rhGM-CSF from fermented liquid again: centrifugal collection fermented supernatant fluid, add ammonium sulfate, cross Phenyl Sepharose column chromatography, collect the target elution peak, cross DEAE Sepharose column chromatography, collect the target elution peak, cross Sephacryl S-200 column chromatography, collect target peak, obtain rhGM-CSF stoste.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 03137202 CN1268751C (en) | 2003-05-26 | 2003-05-26 | Purification method of recombinant yeast strain and rhGM-CSF to express human granulocyte-macrophage colony stimulating factor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 03137202 CN1268751C (en) | 2003-05-26 | 2003-05-26 | Purification method of recombinant yeast strain and rhGM-CSF to express human granulocyte-macrophage colony stimulating factor |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1487086A CN1487086A (en) | 2004-04-07 |
| CN1268751C true CN1268751C (en) | 2006-08-09 |
Family
ID=34154785
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 03137202 Expired - Fee Related CN1268751C (en) | 2003-05-26 | 2003-05-26 | Purification method of recombinant yeast strain and rhGM-CSF to express human granulocyte-macrophage colony stimulating factor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1268751C (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100363500C (en) * | 2004-07-07 | 2008-01-23 | 深圳新鹏生物工程有限公司 | Preparation method of recombination human granular cell colony stimulating factor |
| CN101501209B (en) * | 2006-06-21 | 2013-06-05 | 百奥勤有限公司 | A method of producing biologically active polypeptide having insulinotropic activity |
| CN102277374B (en) * | 2011-07-27 | 2013-04-17 | 浙江诺倍威生物技术有限公司 | Preparation and application of genetic engineering subunit vaccine for infectious bursal disease |
| CN107188951A (en) * | 2017-05-16 | 2017-09-22 | 浙江海隆生物科技有限公司 | The preparation method of pig GM csf proteins and its parenteral solution and application |
-
2003
- 2003-05-26 CN CN 03137202 patent/CN1268751C/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN1487086A (en) | 2004-04-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105358694B (en) | Yeast promoter from pichia pastoris yeast | |
| CN86107108A (en) | Selected and pointed decoration of yeast gene group | |
| CN108265056A (en) | A kind of recombination 1 allergoid albumen of dermatophagoides pteronyssinus and its preparation method and application | |
| CN1974601A (en) | New-type Fc fusion protein and its production process | |
| CN1793375A (en) | Yeast expressing system of recombined human nerve growth factor and process for preparing recombined human nerve grouth factor | |
| CN1990871A (en) | Preparation method of recombinant human plasminogen Kringle 5(hk5) | |
| CN1766107A (en) | Recombinant human keratinized cell growth factor production method | |
| CN1268751C (en) | Purification method of recombinant yeast strain and rhGM-CSF to express human granulocyte-macrophage colony stimulating factor | |
| CN1914317A (en) | Transformed saccharomyces cerevisiae and method for mass-production of LK8 protein using the same | |
| CN1746302A (en) | Production of Non-N glycosylated protein from yeast | |
| CN1766098A (en) | A kind of mannase and encoding gene thereof and application | |
| CN1105727C (en) | Process for preparing recombined human serum albumin | |
| CN1500808A (en) | Recombination of human soluble TRAIL protein, the preparing method and the application in preparing antineoplastic medicine | |
| CN1873006A (en) | Method for producing recombined human proinsulin | |
| CN1916024A (en) | Constructing mutant sequence of high relative quick alphd-2b interferon, expression plasmid of yeast, strain filtration, and purification method | |
| CN1684978A (en) | Glycosylated human granulocyte colony-stimulating factor (G-CSF) isoform | |
| CN1289665C (en) | Recombined aspergillus oryzae tannase and its expression and purification | |
| CN1924001A (en) | Method of producing human heat shock protein 70 from methyl nutritious yeast | |
| CN101037692A (en) | Method for expressing human insulin by using plant seed oil body | |
| CN108265057B (en) | A kind of 2 allergoid albumen of recombination dermatophagoides pteronyssinus and its preparation method and application | |
| CN101067138A (en) | Gene engineering process of preparing human hair papilla cell protein HSPC016 and its expression vector and engineering bacterium | |
| CN1274834C (en) | Man's serum albumin with man's parathormone (1-34) fusion protein and its application | |
| CN100340656C (en) | High-efficiency expression in Pichia yeast, fermentation and purification of human gamma-interferon | |
| CN1280417C (en) | Human tyrosinase expression carrier and its use | |
| CN1110559C (en) | Gene regulating aureobasidin sensitivity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| DD01 | Delivery of document by public notice |
Addressee: Yang Meng Document name: Notification to Pay the Fees |
|
| DD01 | Delivery of document by public notice |
Addressee: Yang Meng Document name: Notification of Termination of Patent Right |
|
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20060809 Termination date: 20100526 |