CN1990871A - Preparation method of recombinant human plasminogen Kringle 5(hk5) - Google Patents

Abstract

The invention provides a coding sequence of recombined human plasminogen Kringle 5 (hk5) suitable for yeast expression, a high-effective method for preparing hk5, establishment of relevant engineering cell, expression and purification of rhk5. The optimalized human plasminogen Kringle 5 (hk5) gene is quite suitable for yeast expression (especially multi-copy expression) and it is characterized by high expression, high stability and high secretion. The invention is characterized in that it can prepare pure rhk5 with high-effective, simple and low-cost method.

Description

Recombinant human plasminogen Kringle 5 (hk5) production method

Technical field

The present invention relates to the genetically engineered field, particularly relate to the production method of a kind of recombinant human plasminogen hK5 (HumanPlasminogen Kringle 5), and the expression vector and the host strain that are used for this method.

Background technology

Tumour is a class common disease and a frequently-occurring disease, and is very big to the mankind's life and health threat.The whole world has 5,000,000 people to die from tumour every year approximately.In some country, tumour has occupied second of the cause of death, even first.

Malignant cell comprises the cell of cancer and sarcoma being commonly referred to as cancer cells.Cancer cells is the cell transformation from related normal tissue, and it both had been different from normal cell, and histiocytic some inherent feature is to some extent keeping again originating.To most of malignant tumours, be easy to miss the chance of early discovery, in the time of can making clinical diagnosis, cancer cells has often experienced 10-30 multiplication, and cell count reaches 10,000,000,000 even hundred billion, heavy 10-100g, diameter 22-47mm.When arriving 40 multiplications, trillion cancer cells have been developed into, heavily about 1kg, diameter 100mm; And nearly 50,000,000,000,000 cells (5 * 10 of normal adult ¹³), the cancer of this moment is enough to make the host to cause death.

Five during the last ten years, and prevailing in the oncotherapy field is direct strategy, and promptly selected target is a tumour cell itself.External cell toxicity medicament that can the kill tumor cell is used as chemotherapy candidate medicine in the body.Up to now, cancer patient still mainly relies on operation or radiotherapy comes tumor resection or primary tumor is disappeared, and and then carries out chemicotherapy again, to eliminate residual cancer cells in the body.Yet normal cell is also to chemotherapy medicament sensitive, and the heredity of cancer cells is unstable, often is exposed to finally to cause resistance under the chemotherapy.The other method of oncotherapy is an indirect strategies, i.e. angiogenesis inhibitor treatment, and it does not directly destroy tumour, but by limiting the blood supply of tumour, makes tumour prevention tumor growth or it is disappeared.Use this strategy, oncologist's attention just not only is confined to independent tumour cell itself, but overall tumor tissues, especially angiogenesis.Based on this conception of species, people adopt novel method to seek the new type anticancer medicine.

Folkman proposition seventies tumour is one and relates to the tumour cell and the other interactional ecosystem of endotheliocyte intersection that vasculogenesis is converted into big malignant tumour to tumour from little cell cluster, and the transfer of tumour is all very crucial.Form by suppressing new vessel, tumour may produce " hunger " thus and cause death.In 1989, begin for the first time the clinical trial of anti-angiogenic medicaments-IFN-α is used for the treatment of infant's vascular tumor.At present found that Angiostatin, K5, endostatin, vasostatin, VEGF monoclonal antibody etc. can both suppress or block fully the growth of mouse tumor.Many angiogenesis inhibitor reagent, all entered or just carrying out the III clinical trial phase as Marimastat, Primostat, Neovastat, Bay-12-9566m, IFN-α, SU101, retinoids, IM862, and MMPs inhibitor, VEGF/R inhibitor, Endostatin, somatostatin analog, cox 2 inhibitor etc. are also obtained stem-winding result in clinical or fundamental research.

Profibrinolysin contains 5 Kringle structural domains, and its proteolytic fragments shows to have anti-angiogenic outgrowth activity.Fiber plasminogen Kringle 5 (K5) can suppress endotheli ocytosis, and its specific activity angiostatin is (Kringle1～4, angiostatin is stronger).And K5 also suppresses endothelial cell migration.And endothelial cell migration is a very important process in angiogenesis.Find that in the recent period K5 can suppress the retinal vessel hyperplasia, may have the potential treatment diabetic retinopathy (value of diseases such as retinopathy of prematurity and age-related macular degeneration.K5 plays a role by the inducing cell cycle arrest, has the characteristics of the aminoacid sequence of efficient, high cell selective and weak point, therefore has the potential clinical value of treatment vascular proliferative disease.

Compare with traditional antineoplastic chemotherapy medicine, K5 belongs to anti-angiogenic therapy, does not produce resistance.Discover, to the median lethal concentration (ED of BCE cell ₅₀) be about 50-60nM, well below the 140nM of angiostatin.Therefore, as if K5 more can suppress the BCE cell growth that bFGF stimulates than angiostatin.With the correctly folding reorganization mouse K5 of escherichia coli expression, it is similar to the people K5 that the hydrolysis fragment obtains to suppress activity.Aspect endothelial cell migration, reorganization K5 albumen is inhibited equally, and its IC50 is about 500nM.The discovery of K5 can be understood the effect of connection ring district aspect the inhibition endotheli ocytosis of Pgn better.Determination of activity shows that hK5 is inhibition of endothelial cell proliferation and new vessel formation significantly.More stem-winding is that the reorganization hK5 of yeast expression has showed good antineoplastic activity in the mouse body.

At present both at home and abroad escherichia coli expression hK5 that adopt more, expression product or do not have activity needs complicated change renaturation technology could obtain pure product; Or expression amount is low, is not suitable for industrialization.And the recombinant plasmid (this recombinant plasmid contain a kind of methanol induction promotor) of the present invention by carry multiple copy expression cassette in external structure, the screening polygenic locus is integrated the engineering bacteria of multiple copy expression cassette, and the improvement by zymotechnique, easy purifying process simultaneously obtains high expression level, high yield, has a kind of hK5 production method of industrialization value.

Summary of the invention

Purpose of the present invention just provide a kind of efficient and/or easy/method of production hK5 of safety.

Another object of the present invention provides expression vector, host cell and the correlated series that is used for this method.

In a first aspect of the present invention, a kind of nucleotide sequence of the human plasminogen Kringle 5 of encoding is provided, aminoacid sequence shown in the described nucleotide sequence coded SEQ ID NO:2, and nucleotides sequence shown in plasminogen Kringle 5 coding regions of described nucleotide sequence and the SEQ ID NO:1 is shown (more preferably more than 98%) above homogeny more than 95%.

In another preference, described nucleotide sequence (comprising DNA) is selected from down group:

(a) has the nucleotide sequence shown in the SEQ ID NO:1;

(b) Nucleotide that constitutes by nucleotide sequence shown in the SEQ ID NO:1 and the alpha factor signal peptide encoding sequence that is positioned at the upstream.

In a second aspect of the present invention, provide a kind of expression vector, the nucleotide sequence of the coding human plasminogen Kringle 5 that the present invention is above-mentioned.

In another preference, described expression vector is pPIC9K/8 α-K5.

In another preference, described expression vector carries 2-8 expression cassette of expressing human fiber plasminogen Kringle 5, and has inserted the encoding sequence of human plasminogen hK5 in the BamHI/BglII site of described carrier.

In a third aspect of the present invention, a kind of engineering cell is provided, it is to get by homologous recombination behind the above-mentioned sequence transformed host cell of above-mentioned expression vector or the present invention, and is integrated with human plasminogen Kringle 5 encoding sequences in the karyomit(e).

In another preference, described engineering cell is pichia spp (Pichia Pastoris).

In another preference, be integrated with the encoding sequence of the human plasminogen hK5 of 2-40 copy in the karyomit(e) of described pichia spp cell, and at expressing human Profibrinolysin hK5 under methanol induction.

In another preference, the expression level of the hrK5 of described pichia spp is more than or equal to the 500mg/L fermented liquid, preferably more than or equal to the 800mg/L fermented liquid, more preferably more than or equal to the 1000mg/L fermented liquid.

In a fourth aspect of the present invention, a kind of method of producing human plasminogen Kringle 5 is provided, it may further comprise the steps:

(a) be fit to cultivate above-mentioned engineering cell under the expression condition, thus secreting, expressing human plasminogen Kringle 5, and described engineering cell is a pichia spp;

(b) separation and purification goes out the human plasminogen Kringle 5 of expression.

In another preference, be integrated with human plasminogen Kringle 5 encoding sequences of 2-40 copy in the genome of described pichia spp cell.

In another preference, described pichia spp engineering cell comprises and utilizes methanol type fast and utilize methanol type at a slow speed.

In another preference, the culture condition in the step (a) comprises:

Cultivation is divided into cultivation stage and induction period, and cultivation stage is cultivated bacterial concentration and reached OD ₆₀₀Be 40-200, time inductive phase is 24-120hr, and fermentation and inducing temperature remain on 28-30 ℃, micro-PTM ₁Amount is 1-20ml/L, and the pH value of inductive phase is 3-9, and inductive phase, methanol concentration was controlled at 0.5-5%.

In another preference, when cultivating, also add 0.1-5wt% (more preferably 1-3%) peptone as protective material.

In another preference, the separation condition of step (b) comprising:

(i) fermented sample is removed thalline by centrifugal and/or filtration, obtain fermented supernatant fluid;

(ii), obtain concentrated solution by saltouing and/or ultrafiltration concentrates the fermentation supernatant;

(iii) concentrated solution is carried out chromatography purification, described chromatography purification is selected from: cation-exchange chromatography, anion-exchange chromatography, gel permeation chromatography, hydrophobic chromatography, affinity chromatography and combination thereof, thus obtain the pure product that purity reaches 95-99.9%.

In another preference, a kind of method of producing recombinant human plasminogen hK5 is provided, the method comprising the steps of:

(i) outside born of the same parents, make up the recombinant plasmid that carries multiple copy expression cassette;

(ii) under the condition that is fit to, the transfection pichia spp, make the encoding sequence of the gene integration multiple copied human plasminogen hK5 of pichia spp cell, and under the condition that is more suitable for, all integrate the encoding sequence of multiple copied human plasminogen hK5 in a plurality of gene locuss of engineering bacteria;

(iii) under the culture condition that is fit to, cultivate the pichia spp engineering cell, the gene integration of this project cell has the Profibrinolysin hK5 encoding sequence of multiple copied, behind the interpolation inductor methyl alcohol, can great expression go out human plasminogen hK5;

(iv) separation and purification goes out the hK5 that expresses in the step (c).

Description of drawings

Fig. 1 is the acquisition synoptic diagram of α of the present invention-K5 fusion gene.Method with PCR among the figure obtains yeast saccharomyces cerevisiae α-factor leader peptide sequences and K5 gene respectively, introduce specific restriction enzyme site (XhoI and EcoRI) simultaneously,, connect with XhoI digestion digestion respectively, to connect liquid is that template increases with a pair of primer PCR, thereby obtains α-K5 fusion gene.

Fig. 2 is the structure synoptic diagram of single copy recombinant plasmid pPIC9K/ α-K5.Adopt EcoRI digestion pPIC9K plasmid and α-K5 fusion gene among the figure, connect, make up the correct recombinant plasmid pPIC9K/ α-K5 of direction of insertion.

Fig. 3 is the hK5 gene copy number that dot hybridization detects high resistance engineering bacteria.Carry out the dot blot experiment with the K5 gene as probe, 1 is the results of hybridization of the engineering bacteria genomic dna of high resistance screening acquisition among the figure, 2 results of hybridization for low resistance engineering bacteria genomic dna, 3 is the results of hybridization of pichia spp host cell GS115 genomic dna, and 4 is the results of hybridization of pPIC9K/8 α-K5 plasmid DNA.The result shows that the positive colony that high resistance screening obtains has higher K5 gene copy number, and pichia spp host cell pichia spp host cell GS115 (negative control) does not then detect the K5 gene.

Fig. 4 is the biological activity assay result of hK5, promptly to the inhibition result (* 100) of Ecv304 Human umbilical vein endothelial cells.Wherein:

A: with the control cells of PBS processing;

B: the cell of handling with the hK5 in 0.2 μ g/ hole;

C: the cell of handling with the hK5 in 5 μ g/ holes;

D: the cell of handling with the hK5 in 20 μ g/ holes.

Fig. 5 is the exercising result of hK5 to Vero, OB, KMB17 cell, wherein:

A. the Vero cell of handling with PBS;

B. the Vero cell of handling with the hK5 in 20 μ g/ holes;

C. the OB cell of handling with OB;

D. the OB cell of handling with the hK5 in 20 μ g/ holes;

E. the KMB17 cell of handling with PBS;

F. the KMB17 cell of handling with the hK5 in 20 μ g/ holes.

Embodiment

Extensive studies finds that the low one of the main reasons of expression amount of human plasminogen Kringle 5 in the existing production technology is that gene order is without optimization to the inventor by going deep into.The inventor is by the optimization design of gene coded sequence, change human plasminogen Kringle 5 encoding sequences (SEQ ID NO:1) after optimizing over to methyl alcohol and utilize type pichia spp (P.pastoris), thereby realized the high-level secretory expression rhK5 of rhK5, finished the present invention on this basis.

In another preference, the inventor has also made up the recombinant plasmid that carries multiple copy expression cassette outside born of the same parents, and this expression vector helps further to improve the hK5 expression product.

In another preference, also, not only improved the hK5 expression amount, and simplified separation purifying technique by optimization for fermentation technology, finished the present invention on this basis.

The invention provides a kind of optimization, the people rhK5 encoding sequence that is particularly suitable in yeast cell, expressing.This sequence is designed according to principles such as pichia spp codon-bias.The encoding sequence of the rhK5 that designs carries out full gene with ordinary method and synthesizes, or carries out point mutation on the cDNA that obtains by PCR method.

Introduce the specificity restriction enzyme site respectively at 5 of optimized gene ' end and 3 ' end, the ordinary method with molecular cloning is cloned into expression vector (as pPIC9, pPIC9K etc.) with optimized gene.Then, transform, be integrated into the P.pastoris host cell chromosome, utilize ordinary method (as G418 resistance or Southern blotting) to select high copy transformant, shake the bottle expression and select the high expression level engineering cell.Engineering cell can be to utilize methanol type (Mut fast ⁺) or utilize methanol type (Mut at a slow speed ^s).

The copy number that is integrated into the rhK5 encoding sequence in the pichia spp karyomit(e) (or genome) is not particularly limited, and can be 1-50 or higher, is generally 2-40, preferably is 3-30.

After obtaining engineering cell, just can be under the condition that is fit to the culturing engineering cell.All substratum that is suitable for the pichia spp growth, expresses all can be used for the present invention.

The hK5 aminoacid sequence is known, shown in SEQ ID NO:2, and 98 amino acid whose protein of the total length of encoding (SEQ ID NO:2).

The encoding sequence of hK5 of the present invention is the hK5cDNA sequence according to bibliographical information, is optimized according to yeast genetic code preferences, carries out full gene then and synthesizes.

Be applicable to that carrier of the present invention is expression plasmid pPIC9K/8 α-K5.

Be applicable to that host bacterium of the present invention is P.pastoris.

Usually, 5 ' end at the hK5 encoding sequence is introduced the specificity restriction enzyme site with 3 ' end, merge with correct framework with yeast saccharomyces cerevisiae α-factor leader peptide sequences, be cloned into plasmid pPIC9K then, make up the recombinant plasmid of multiple copy expression cassette, transform pichia spp host bacterium such as P.pastoris GS115, the pressurization screening is inserted multiple copy expression cassette to obtain polygenic locus.Usually the positive strain that filters out makes it to be grown on the culture plate that pressor factor concentration increases progressively.Select the strongest bacterial strain of resistance, be defined as engineering bacteria.Engineering bacteria of the present invention belongs to methanol evoked expression strain.

Behind fermentation expression hK5, the hK5 that expresses is separated.

The rhK5 that expresses is present in training liquid supernatant, and expression level accounts for the fermented liquid supernatant total protein more than 50%, and the purifying complex degree is descended greatly.Usually, fermented sample earlier obtains fermented liquid supernatant in modes such as centrifugal, filtrations, removes thalline.Fermented liquid supernatant can by saltout, method such as ultrafiltration carries out carrying out chromatography purification again behind the preliminary purification, also can directly carry out chromatography purification.

Be applicable to that chromatographic technique of the present invention comprises cation-exchange chromatography, anion-exchange chromatography, gel permeation chromatography, affinity chromatography etc.

(a) gel permeation chromatography: behind the sample ultrafiltration and concentration, can desalt and purifying with gel permeation chromatography.

(b) ion exchange chromatography (cation-exchange chromatography, anion-exchange chromatography):

The buffering system of sample with dilution, ultrafiltration, post precipitation redissolve, means such as saturating rare or gel permeation chromatography change, until with corresponding ion exchange column balance liquid system similarity, and the flat conductivity water with damping fluid of conductivity water flushes closely, directly go up sample, salt concn gradient or pH gradient gradient elution.

(c) affinity chromatography:

Select heparin affinity gel medium, salt gradient or heparin gradient elution.

Through 2-3 step purifying, can obtain the pure product of hK5, the purifying yield is more than 30%, and purity is more than 95%, the about 1.5g/L fermented supernatant fluid of pure product yield.

HGH behind the purifying can make various formulations with ordinary method, as lyophilized injectable powder.Select certain stablizer, also can add protective materials such as tensio-active agent, antioxidant simultaneously, and suitable damping fluid carries out lyophilize.The goods that obtain have that loss of activity is little, moisture content is low, good stability, be easy to characteristics such as prolonged preservation.

RhK5 also can make aqueous injection, sprays, microsphere sustained-release agent, and makes prolonged action preparation etc. through the PEG modification.

In an example of the present invention, in external structure carry the recombinant plasmid of multiple copy expression cassette, make up hK5 engineering bacteria (pichia spp) efficient, stably express simultaneously.Through fermentation culture, methanol induction, hK5 is secreted into fermented liquid supernatant with soluble form; The expression level height accounts for total protein about 70%, and expression amount reaches the 5g/L fermented supernatant fluid.Because expression level is higher, hK5 has natural radioactivity again, has avoided complicated renaturation process, by easy, two step purifying methods fast, promptly obtains the pure product of high-quality hK5, and every liter of fermented liquid can get the pure product 1.5g of hK5, and product purity is more than 95%.

In another example of the present invention, hK5 engineering bacteria (pichia spp) with efficient, the stably express of the above-mentioned construction of recombinant plasmid that carries multiple copy expression cassette, compare with hK5 engineering bacteria (pichia spp) expression amount efficient, stably express of the structure of the construction of recombinant plasmid that contains natural K5 sequence, by comparing, show that under identical expression condition, majorizing sequence helps significantly improving of K5 expression amount.

Stoste adds suitable auxiliary material behind the purifying, makes the powder ampoule agent for injection of hK5.

Pilot scale research shows that product manufacture is stable, and is simple to operate, and the cycle is short, and cost is low, and every liter of fermented supernatant fluid can obtain the pure product 1.5g of hK5, adopts 300 liters of (perhaps 3 100 liters) fermentor tanks, can produce 300g for every batch.Be fit to industrialization production.

The invention has the advantages that:

(1) expression process is simple, and expression vector contains the promotor of methanol induction, by energy efficient secretory expression human plasminogen hK5 behind the methanol induction, helps large-scale production.

(2) expression amount height.

A. according to yeast genetic code preferences the K5 sequence is optimized, improved the expression amount of K5 in yeast.

B. make up the recombinant plasmid of multiple copy expression cassette outward by born of the same parents, one time the homologous recombination incident can realize a plurality of expression cassettes positioning integration on a plurality of chromosomal focis, in conjunction with the transformant of the high copy of pressor factor resistance screening, thereby acquisition has the pichia pastoris engineered strain of the exogenous gene expression box reorganization of the high copy of polygenic locus.

C. the technological condition for fermentation of control key simultaneously continuously ferments to cultivate to make and expresses the expression output that output is much higher than the employing pichia spp of present report.

(3) purifying process is easy, rate of recovery height.Owing to be the secretion soluble protein, not with the inclusion body formal representation, therefore simplified purification procedures, the purifying rate of recovery is improved greatly, make scale operation hK5 become possibility.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, people such as Sambrook for example, molecular cloning experiment guide (New York:ColdSpring Harbor Laboratory Press, 1989); People such as Jan-Christer Janson, Proteinpurification (John Wiley ﹠amp; Sonss, Inc., 1998) described in condition, or the condition of advising according to manufacturer.

Embodiment 1

The structure of hK5 secreting, expressing system

1. the acquisition of α-K5 fusion gene

According to the aminoacid sequence of natural human fiber plasminogen Kringle 5, press principles such as pichia spp codon-bias, purpose of design gene and full gene are synthetic, the dna fragmentation of its sequence shown in SEQ ID NO:1.Insert the EcoRI site of pThioHisA (available from Invitrogen company), make up the plasmid pThioHisA-hK5 that obtains containing the hK5 encoding sequence.With plasmid pThioHisA-hK5 is template, carries out pcr amplification with following primer:

Primer2a：5’-CCG CTCGAGAAAAGAGTTTTGTTGCCAGACGTTG-3’(SEQ ID NO：4)

Primer2b：5’-CG GAATTCCTGCAGTTAGAAAGAAGGAGCAGCACAT-3’(SEQ ID NO：5)

Thereby obtain the K5 gene that merges with correct framework with yeast saccharomyces cerevisiae α-factor leader peptide sequences.

Simultaneously, be template with the plasmid pPIC9K (available from Invitrogen company) that contains yeast saccharomyces cerevisiae α-factor leading peptide encoding sequence, pcr amplification obtains α-factor leader peptide sequences.Used primer is:

Primer2c：5’-CG GAATTCATCCAAACGATGAGATTTC(SEQ ID NO：6)

Primer2d：5’-CCG CTCGAGAGATACCCCTTCTTC-3’(SEQ ID NO：7)

Above-mentioned two kinds of PCR products behind the purifying are digested with restriction enzyme XhoI respectively, two kinds of enzymes are cut product connect.To connect product is that template is carried out pcr amplification, obtains can be used for the fusion gene α-K5 of secreting, expressing.

2. the structure of multiple copy expression cassette expression plasmid

α-K5 fusion gene through the EcoRI single endonuclease digestion, is cloned into the plasmid pPIC9K (see figure 2) that same enzyme is cut, and enzyme is cut evaluation, order-checking.With BamHI+BglII double digestion recombinant plasmid pPIC9K-α-K5, reclaim small segment (1851bp, corresponding α-K5 expression cassette), insert the pPIC9K-α-K5 recombinant plasmid of BamHI single endonuclease digestion, enzyme is cut evaluation, select the forward recon, obtain carrying the recombinant plasmid pPIC9K-2 α-K5 of the 2 copy expression cassettes of arranging in the same way.By that analogy, make up the recombinant plasmid pPIC9K-4 α-K5 that carries 4 copy expression cassettes, make up the plasmid pPIC9K-8 α-K5 that carries 8 copy expression cassettes from pPIC9K-4 α-K5 again from pPIC9K-2 α-K5.

Enzyme is cut evaluation and is shown, it is correct and have a recombinant plasmid pPIC9K-α-K5 of single copy expression cassette to have obtained direction of insertion respectively, carry recombinant plasmid, the pPIC9K-2 α-K5 of the 2 copy expression cassettes of arranging in the same way, carry the recombinant plasmid pPIC9K-4 α-K5 of the 4 copy expression cassettes of arranging in the same way, carry the plasmid pPIC9K-8 α-K5 of 8 copy expression cassettes.

Embodiment 2

The conversion of recombinant plasmid

Recombinant plasmid pPIC9K-α-K5, the pPIC9K-2 α-K5, pPIC9K-4 α-K5, the pPIC9K-8 α-K5 that build are used the SalI linearization for enzyme restriction respectively, dull and stereotyped back 72 hours of the pichia spp GS115 of transformed competence colibacillus routine (available from Invitrogen company) cell coating MD, get maximum colony inoculation to the YPD flat board of the G418 that contains 0.25mg/ml, cultivated 48 hours for 30 ℃, the bacterium colony that will grow on flat board obtains high resistance engineering bacteria with the YPD plate screening of 2.0mg/mlG418 then.Obtain a collection of high resistance engineering strain, expression screening obtains a plurality of strains that efficiently express in test tube.

Test-results: several clones that pPIC9K-α-K5, pPIC9K-2 α-K5, three conversion groups of pPIC9K-4 α-K5 have obtained respectively to grow on the YPD of 0.25mg/mlG418 flat board, pPIC9K-8 α-K5 conversion group has obtained several clones that can grow on the YPD of 2mg/mlG418 flat board.

To identifying, show the rhK5 that contains 2-30 copy in these Pichia yeast engineerings in the engineering bacteria that obtains.

Embodiment 3

The acquisition of high expression engineering

The gene probe of the genomic dna of different resistance engineering bacterias among the extracting embodiment 2, and preparation hK5 respectively, dot hybridization (Dot Blot) experiment detects the integration copy number of hK5, the positive colony of screening high copy number.

Test-results:

The high resistance engineering bacteria of pPIC9K-8 α-K5 conversion group has higher copy number of foreign gene (more than 30 copies), thereby obtained to have the engineering bacteria of high copy hK5 gene, and clone's copy number of pPIC9K-α-K5, pPIC9K-2 α-K5, three conversion groups of pPIC9K-4 α-K5 is relatively low.

Different resistance engineering bacterias are made little megger and reached detection: inoculation mono-clonal engineering bacteria is gone in the YPD substratum, and methanol induction is got supernatant and detected after 48 hours, the gene expression dose of more different resistance engineering bacterias.

Test-results:

The engineering bacterium expression amount with high copy hK5 gene that pPIC9K-8 α-K5 conversion group obtains is the highest, and the hK5 protein concentration of secreting to the substratum surpasses the 500mg/L fermented supernatant fluid, compares with the engineering bacterias of other three groups low copies, and expression amount exceeds more than 5 times.This explanation high copy construction strategy of the present invention is successful and necessity, can further realize the high expression level of hK5 by improving copy number.

Embodiment 4

The influence that majorizing sequence is expressed K5

Repeat the step of embodiment 1, difference only is to use the K5 encoding sequence of codon through optimizing in the natural people K5 nucleotide coding sequence alternative embodiment 1, thereby has made up pPIC9K/8 α-K5-N, and this expression vector contains natural people K5 sequence.

The mono-clonal of inoculating pPIC9K-8 α-K5 and pPIC9K-8 α-K5-N respectively carries out little megger and reaches experiment, add methanol induction respectively after, it is centrifugal that two kinds of samples are got the 100ml fermented liquid every 12hr ,-20 ℃ frozen, induces 48hr to finish.Sample detection SDS-PAGE (and scanning), protein content.

Experimental result (seeing the following form) shows that when identical incubation time the expression of pPIC9K-8 α-K5 bacterial strain is apparently higher than pPIC9K-8 α-K5-N bacterial strain.Therefore, by this experiment, pPIC9K-8 α-K5 bacterial strain is adopted in decision.

Bacterial strain	The expression level of different time (mg/L)
						0hr	12hr	24hr	36hr	48hr
	The engineering strain that pPIC9K-8 α-K5 transforms	1	63	134	237						588
The engineering strain that pPIC9K-8 α-K5-N transforms						1	33	67	133	227

Embodiment 5

The influence that different promoters is expressed K5

Made up pGAPA/8 α-K5 with similar method, this expression vector contains composition type expression promoter (the pGAP promotor is GAP).The mono-clonal of inoculating pPIC9K-8 α-K5 and pGAPA/8 α-K5 respectively carries out little megger and reaches experiment, in the bacterium liquid of pPIC9K-8 α-K5, add methanol induction after, it is centrifugal that two kinds of samples are got the 100ml fermented liquid every 12hr ,-20 ℃ frozen, induces 48hr to finish.Sample detection SDS-PAGE (and scanning), protein content.

Experimental result (seeing the following form) shows that when identical incubation time the expression of pPIC9K-8 α-K5 bacterial strain is apparently higher than pGAPA/8 α-K5 bacterial strain.Therefore, by this experiment, pPIC9K-8 α-K5 bacterial strain is adopted in decision.

Bacterial strain	Expression level (the mg/L of different time
						0hr	12hr	24hr	36hr	48hr
	The engineering strain that pPIC9K-8 α-K5 transforms	1	63	134	237						588
The engineering strain that pGAPA/8 α-K5 transforms						12	22	46	112	213

Embodiment 6

Fermentation stage adds the influence of different protein protective agents to expression level

Prepare 3 fermentor tanks.Get mono-clonal, be inoculated in the BMGY primary seed solution, cultivate 17-20hr; , cultivate about 4～8hr in the 1L of 250ml BMGY Erlenmeyer flask in 1: 10 ratio two-stage inoculation, jar ferments in the inoculation, and control pH 5.0,30 ℃ of temperature, DO＞35% treat that dissolved oxygen rising back stream adds 50% glycerine.Treat that glycerine exhausts, use 100% methanol induction after dissolved oxygen rises once more.Be that each 300ml stream of 10% CA, peptone and Tryptone adds jar (a 5L fermentor tank, a fermentation supernatant 3L) again with concentration, keep dissolved oxygen between 35%～70%.Induce after 36 hours and finish, collect the fermentation supernatant.Sample detection SDS-PAGE and protein content.

Experimental result:

The fermentor tank numbering	Experiment condition	Expression level (%)
			1	CA	35.3
2	Peptone	65.1
			3	Tryptone	48.6
4	Do not add any protein protective agent	30.5

Embodiment 7

The different peptone amounts of fermentation stage are to the influence of expression level

Get mono-clonal, be inoculated in the BMGY primary seed solution, cultivate 17-20hr; , cultivate about 4～8hr in the 1L of 250ml BMGY Erlenmeyer flask in 1: 10 ratio two-stage inoculation, jar ferments in the inoculation, and control pH 5.0,30 ℃ of temperature, DO＞35% treat that dissolved oxygen rising back stream adds 50% glycerine.Treat that glycerine exhausts, use 100% methanol induction after dissolved oxygen rises once more.The peptone stream of getting different volumes 10% simultaneously adds 5L fermentor tank (fermentation supernatant 3L), keeps dissolved oxygen between 35%～70%.Induce after 36 hours and finish, collect the fermentation supernatant.Sample detection SDS-PAGE and protein content.

Experimental result:

The fermentor tank numbering	Peptone add-on (ml)	Peptone final concentration (%)	Expression level (%)
				1	30	0.1	53.1
2	150	0.5	59.2
				3	300	1	65.8
4	600	2	68.3
				5	900	3	64.2
6	1200	4	60.2
				7	1500	5	58.7

Test-results shows that the optimum concn of peptone is 1%-3%.

Embodiment 8

The purifying of hK5

1. fermented liquid is carried out ultrafiltration and concentration, the buffer system of fermented liquid is replaced with phosphate solution PB.

2. ultrafiltration and concentration and exchange buffering liquid: use the Millipore ultra-fine filter, the ultra-filtration membrane molecular weight that dams is 1KD, leaves and takes concentrated solution (effect is to remove small molecular weight impurity and salt) during ultrafiltration.Fermented liquid supernatant ultrafiltration to volume is left to add PB about 500ml, continues ultrafiltration; This program repeatedly flushes closely until the conductivity water of the gentle PB damping fluid of the conductivity water of sample.

3. chromatography 1 (anion-exchange chromatography):

Chromatography media: DEAE Sepharose FF

Damping fluid: solution A: PB

Solution B: PB+1M NaCl

Last sample: with sample on the hK5 solution of ultrafiltration and concentration.

Clean: clean chromatography column with the solution A of 6CV after going up sample.

Gradient: clean the back and solution B is risen to 100% from 0% with 10CV.

Collect: collect hK5 sample peak.

4. chromatography 2 (hydrophobic chromatography):

Chromatography media: phenyl Sepharose FF

Damping fluid: solution A: PB+1M NaCl

Solution B: PB

Last sample: with sample on the sample peak of chromatography 1.

Clean: clean chromatography column with the solution A of 6CV after going up sample.

Gradient: clean the back and solution B is risen to 100% from 0% with 10CV.

Collect: collect hK5 sample peak.

5. chromatography 3 (sieve chromatography):

Chromatography media: Sephadex 75

Damping fluid: PB

Last sample: the sample master branch that chromatography 1 is collected.

Sample is through this three steps purifying, i.e. after ultrafiltration, anion-exchange chromatography, the sieve chromatography, purity is increased to more than 95%.

Embodiment 9

The biological activity assay of hK5

The Ecv304 Human umbilical vein endothelial cells of the routine of taking the logarithm vegetative period is with 1.6 * 10 ⁵Cell/ml inoculates 100 μ l in 96 orifice plates, and culture condition adds 10% new-born calf serum for the M199 substratum, and 37 ℃, 5%CO ₂Behind about 24h, change old substratum, add the reorganization EhK5 or the YhK5 of different concns simultaneously, 37 ℃ of 5%CO with the M199 substratum that contains 5% new-born calf serum ₂Cultivated 48 hours, and added 20ulMTT (5mg/ml), reacted 4 hours, add the 150ulDMSO cracking, the 570nm colorimetric.The result shows: recombinant protein hK5 can obviously suppress the propagation of Human umbilical vein endothelial cells Ecv304, shows as cell rounding, comes off, cytolemma dissolving, necrocytosis (seeing accompanying drawing 5), suppresses effect and is typical dose-dependently.To non-endotheliocyte, as KMB17 (human embryonic lung diploid fibroblast strain), Vero (cercopithecus aethiops renal epithelial cell), OB (osteoblast in neonatal calvaria cultures), the reorganization hK5 of two kinds of system expressions does not all show any inhibition activity (seeing accompanying drawing 6).

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence table

＜110〉Shanghai Xinshengyuan Medicine Research Co., Ltd.

＜120〉recombinant human plasminogen Kringle 5 (hK5) production method

<130>054416

<160>7

<170>PatentIn version 3.3

<210>1

<211>297

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉encoding sequence of hK5

<400>1

gttttgttgc cagacgttga aactccatct gaagaagatt gtatgttcgg taatggtaag 60

ggttatagag gtaagagagc tactactgtt actggtactc cttgtcaaga ctgggctgct 120

caagaaccac acagacactc tatcttcact cctgaaacta acccacgtgc tggtttagaa 180

aagaactact gtcgtaaccc tgacggtgac gttggtggtc catggtgtta cactactaac 240

cctagaaagt tgtacgacta ctgtgacgtt ccacaatgtg ctgctccttc tttctaa 297

<210>2

<211>98

<212>PRT

＜213〉homo sapiens

<400>2

Val Leu Leu Pro Asp Val Glu Thr Pro Ser Glu Glu Asp Cys Met Phe

1 5 10 15

Gly Asn Gly Lys Gly Tyr Arg Gly Lys Arg Ala Thr Thr Val Thr Gly

20 25 30

Thr Pro Cys Gln Asp Trp Ala Ala Gln Glu Pro His Arg His Ser Ile

35 40 45

Phe Thr Pro Glu Thr Asn Pro Arg Ala Gly Leu Glu Lys Asn Tyr Cys

50 55 60

Arg Asn Pro Asp Gly Asp Val Gly Gly Pro Trp Cys Tyr Thr Thr Asn

65 70 75 80

Pro Arg Lys Leu Tyr Asp Tyr Cys Asp Val Pro Gln Cys Ala Ala Pro

85 90 95

Ser Phe

<210>3

<211>300

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉encoding sequence of signal peptide

<400>3

atgagatttc cttcaatttt tactgcagtt ttattcgcag catcctccgc attagctgct 60

ccagtcaaca ctacaacaga agatgaaacg gcacaaattc cggctgaagc tgtcatcggt 120

tactcagatt tagaagggga tttcgatgtt gctgttttgc cattttccaa cagcacaaat 180

aacgggttat tgtttataaa tactactatt gccagcattg ctgctaaaga agaaggggta 240

tctctcgaga aaagagaggc tgaagcttac gtagaattcc ctagggcggc cgcgaattaa 300

<210>4

<211>34

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>4

ccgctcgaga aaagagtttt gttgccagac gttg 34

<210>5

<211>36

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>5

cggaattcct gcagttagaa agaaggagca gcacat 36

<210>6

<211>27

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>6

cggaattcat ccaaacgatg agatttc 27

<210>7

<211>24

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>7

ccgctcgaga gatacccctt cttc 24

Claims (10)

1. nucleotide sequence of human plasminogen Kringle 5 of encoding, it is characterized in that, aminoacid sequence shown in the described nucleotide sequence coded SEQ ID NO:2, and nucleotides sequence is shown 95% above homogeny shown in plasminogen Kringle 5 coding regions of described nucleotide sequence and the SEQ ID NO:1.

2. nucleotide sequence as claimed in claim 1 is characterized in that, is selected from down group:

(a) has the nucleotide sequence shown in the SEQ ID NO:1;

(b) Nucleotide that constitutes by nucleotide sequence shown in the SEQ ID NO:1 and the alpha factor signal peptide encoding sequence that is positioned at the upstream.

3. an expression vector is characterized in that, it contains the described nucleotide sequence of claim 1.

4. an engineering cell is characterized in that, it by described expression vector of claim 3 or the described sequence transformed host cell of claim 1 after homologous recombination get, and be integrated with human plasminogen Kringle 5 encoding sequences in the karyomit(e).

5. engineering cell as claimed in claim 4 is characterized in that, it is pichia spp (PichiaPastoris).

6. a method of producing human plasminogen Kringle 5 is characterized in that, may further comprise the steps:

(a) be fit to cultivate engineering cell as claimed in claim 4 under the expression condition, thus secreting, expressing human plasminogen Kringle 5, and described engineering cell is a pichia spp;

(b) separation and purification goes out the human plasminogen Kringle 5 of expression.

7. method as claimed in claim 6 is characterized in that, is integrated with human plasminogen Kringle 5 encoding sequences of 2-40 copy in the genome of described pichia spp cell.

8. method as claimed in claim 6 is characterized in that, described pichia spp engineering cell comprises and utilizes methanol type fast and utilize methanol type at a slow speed.

9. method as claimed in claim 6 is characterized in that, the culture condition in the step (a) comprises:

Cultivation is divided into cultivation stage and induction period, and cultivation stage is cultivated bacterial concentration and reached OD ₆₀₀Be 40-200, time inductive phase is 24-120hr, and fermentation and inducing temperature remain on 28-30 ℃, micro-PTM ₁Amount is 1-20ml/L, and the pH value of inductive phase is 3-9, and inductive phase, methanol concentration was controlled at 0.5-5%.

10. method as claimed in claim 6 is characterized in that, the separation condition of step (b) comprising:

(i) fermented sample is removed thalline by centrifugal and/or filtration, obtain fermented supernatant fluid;

(ii), obtain concentrated solution by saltouing and/or ultrafiltration concentrates the fermentation supernatant;

(iii) concentrated solution is carried out chromatography purification, described chromatography purification is selected from: cation-exchange chromatography, anion-exchange chromatography, gel permeation chromatography, hydrophobic chromatography, affinity chromatography and combination thereof, thus obtain the pure product that purity reaches 95-99.9%.

Images