CN100342020C - New method of preparing mammary gland bioreactor with macrofragment DNA - Google Patents

Abstract

The present invention discloses a novel method for preparing a mammary gland bioreactor by large fragment DNA, which comprises the steps: the large fragment DNA containing purpose genes on BAC, YAC and P1 carriers is prepared, wherein the purpose genes on the large fragment DNA are expressed in a goat mammary gland at fixed points; the large fragment DNA is injected in goat zygote by a pronucleus injection method and is transplanted in a surrogate goat body to generate a transgenic goat, and the purpose genes on the large fragment DNA are expressed in the goat mammary gland at the fixed points. The method of the present invention can effectively realizes the point fixation and timing expression of the purpose genes in the mammary gland.

Description

A kind of large fragment DNA prepares the galactophore biological reactor novel method

The present invention relates to genetically engineered field and pharmaceutical field, more specifically, the present invention relates to prepare the preparation method of galactophore biological reactor, especially prepare the method for galactophore biological reactor with large fragment DNA.

The galactophore biological reactor pharmacy is the emerging technology of rising the beginning of the nineties at the end of the eighties.This know-why is to change people's pharmaceutical protein gene over to breast with in the tame carcass, and pharmaceutical protein is expressed in mammary gland of domestic animal, and then extracts albumen in milk.Compare with bacterial expression recombinant protein and mammalian cell expression method, this method has a clear superiority in, for example the albumen of Sheng Chaning not only can be expressed bigger albumen, glycosylation with complexity is modified, produce normal physiologically active, and output is big, production cost is low, thereby this technology broad market prospect.

Since 90 years galactophore biological reactor successively successful expression antitrypsin, Profibrinolysin, thrombin nine, pharmaceutical proteins such as plasma albumin, and squeezed into drug market, nearly 1,000,000,000 dollars of the present annual output value.

But along with the large-scale application of this technology, some technical barriers display gradually.Wherein the most outstanding is the site effect of transgene expression, and promptly transgenosis random integration in genome could be expressed but only be incorporated into activatory chromatin district; Have only like this 10-20% the transgenosis integrator animal just can be in various degree the expression target protein, and expression amount differs significantly, this has just improved the cost of producing transgenic animal greatly, makes this technology industrialization difficulty.

Years of researches have been made in order to overcome effect various countries, site scientist, 5 of discovery milk protein gene ' have region (locus control region with 3 ' control region far-end, abbreviate " LCR " as) or matrix attachment regions (matrix attachment region, abbreviate " MAR " as) [Jew P cell 1992] [Kioussis.D, Curr Opin Genet Develop 1997] [Blackwood, Science 1998], the existence of these sequences can overcome the site effect in the transgene expression.But the LCR sequence of milk-protein is positioned at the scope of tens KB of gene upstream and downstream mostly, and big dna fragmentation is impossible if clone so with plasmid, because clone's ability of plasmid is in 15KB.

With YAC (yeast artificial chromosome), BAC (bacterial artificial chromosome) and the artificially colored body technique of P1 is the development of the large fragment DNA transgenic technology of representative, and the possibility that has solved this difficult problem is provided.These carriers can be cloned the dna fragmentation that reaches hundreds of KB, the regulating and controlling sequence of upstream and downstream far-end tens KB that can a time cloning lactogenesis protein gene.Experiment has shown with the large fragment DNA of BAC, yac vector structure has eliminated the site effect in the transgene expression, and obviously embodied the positive correlation that transgenosis copy number and target protein are expressed, the copy number that transgenosis is integrated is many more, expression amount high more [Keneth, PNAS 1993].These carriers are not only cloned very capable, and in bacterium and yeast in homologous recombination rate height [Xiangdong W, Nature Biotechnology 1997], thereby conveniently to BAC, the transformation of YAC molecule homologous recombination, can in YAC, recombinate and introduce the screening sign, restriction enzyme site etc., and the target protein gene can be changed in the YAC transgene carrier or sudden change YAC in gene, sophisticated molecule clone technology has promoted the application of yac vector in the transgenosis field in the yeast.

In recent years, the large fragment DNA transgenic technology is used more and more widely, to setting up disease model application examples [Keneth PNAS 1993] is arranged all from the functional study of big genomic gene.Gradually should use in middle and later periods nineties large fragment DNA transgenic technology.

Introduce yac vector in the research of galactophore biological reactor 97 years-99 years first time such as Japanese scientist Y.Fujiwara, obtained the whey albumin expression amount up to 2-3ml/ml with YAC DNA (210KB) transgenosis that contains the whey albumin gene in 97 years.Further YAC is carried out homologous recombination in the yeast again in 98 years, and successfully finished the transgenosis of reorganization YAC DNA.The expression amount of target protein tethelin can reach 0.8mg/ml.

The Marie-Georges study group successful Application of France in 1999 the BAC DNA mammary gland of 170KB expressed the sheep whey albumin, expression amount can reach 0.8-1mg/ml.

The successful prompting large fragment DNA transgenosis of Y.Fujiwara and Marie-Georges will be led the technology trend of mammary gland pharmacy field in the application in galactophore biological reactor field.Use this technology and help the further further investigation of gene expression regulation; Disclose the molecule mechanism that the gene assignment of genes gene mapping efficiently expresses; Promote the development of mammary gland pharmaceutical industries.

Yet, still there are some shortcomings in the technology that present large fragment DNA prepares galactophore biological reactor, as because the difficulty of the complicacy of large fragment DNA transgenosis building process and operating process is big, work so also have only two or three laboratories to do this field at present in the world; And can only express some length at 10kb with interior less goal gene; Can only use this technology and produce transgenic mice, also the precedent of this technology production transgenosis large animal not.

Purpose of the present invention just provides and a kind ofly new prepares the method for galactophore biological reactor with large fragment DNA, and this method has following at least one or more advantages:

1. simplified large fragment DNA transgenosis construction process, it is stylized, promoted application in the mammary gland pharmaceutical industry.

2. the chimeric technology of YAC in the yeast is introduced large fragment DNA transgenosis construction process, made the genomic gene of the goal gene that can express length 10kb-200kb, expanded the range of application of large fragment DNA transgenic technology.

3. first Application large fragment DNA transgenic technology prepares transgenosis Rushan sheep.

The invention provides and a kind ofly prepare the method for galactophore biological reactor with large fragment DNA, it comprises step:

The large fragment DNA that contains goal gene on preparation BAC, YAC and the P1 carrier, wherein the goal gene on the large fragment DNA fixes a point to express in goat mammary gland;

With the procaryotic injection method large fragment DNA is injected in the goat zygote,

Be transplanted in the replace-conceive goat body, produce genetically modified goat, the goal gene on the large fragment DNA fixes a point to express in goat mammary gland.

In one embodiment of the invention, this goal gene coding lactoferrin, and also the big fragment that will contain milk protein gene is directly used in transgenosis.

In one embodiment of the invention, this large fragment DNA is transformed by the method for homologous recombination in the yeast, thereby the both sides that the regulating and controlling sequence of milk protein gene is positioned at goal gene in this large fragment DNA and guide the expression of goal gene.The specific procedure of the method for homologous recombination transformation large fragment DNA comprises step in one primary yeast: transfer each one section 300-1500bp regulating and controlling sequence of milk protein gene upstream and downstream as homology arm with polymerase chain reaction method, insert the goal gene that will express between the two and be built into targeting vector.Preferably, also comprise step: with described targeting vector, carry out recombinating in the yeast, thereby goal gene is inserted under the big fragment regulating and controlling sequence of milk protein gene with macromole YAC, BAC, the P1 clone of the complete encoding sequence that contains milk protein gene big fragment upstream and downstream sequence and gene self.

In a preferred embodiment of the present invention, large fragment DNA can comprise that length is the genome sequence that contains goal gene of 5-200kb and to be positioned at the length that described genome sequence both sides and guide destination gene expression be the regulating and controlling sequence of the milk protein gene of 50-200KB.

As known to those skilled in the art, the regulating and controlling sequence of described milk protein gene refers to 5 of milk protein gene coding region ' and 3 ' sequence, generally include the core sequence that following control milk protein gene is transcribed: as TATA box, GC box, far-end region.

In another embodiment of the present invention, described large fragment DNA prepares with the chimeric method of YAC in the yeast.A kind of concrete program for preparing large fragment DNA with the interior chimeric method of YAC of yeast comprises step:

The expression vector and the expression vector that contains the genome sequence of goal gene of preparation mammary expression ALA;

Transfer each a bit of regulating and controlling sequence (300-1500bp of milk protein gene upstream and downstream with polymerase chain reaction (PCR) method, 500-1000bp preferably), each a bit of sequence (500-1000bp end to end with goal gene, 300-1500bp preferably), with the homologous recombination mode each a bit of regulating and controlling sequence of described milk protein gene upstream and downstream is inserted the upstream and downstream of each one section sequence end to end of described goal gene respectively, form two chimeric vectors;

Chimeric vector and the described expression vector that contains the genome sequence of goal gene carry out homologous recombination, form the goal gene chimeric vector, and each a bit of regulating and controlling sequence of wherein said milk protein gene upstream and downstream is positioned at the both sides of goal gene;

The expression vector of goal gene chimeric vector and mammary expression milk-protein is changed in the same yeast over to both formation chimeric molecules of recombinating, the wherein expression of the genome sequence of the sequence-directed goal gene of the big fragment upstream and downstream of milk protein gene on this chimeric molecule.

In the accompanying drawings,

Fig. 1 has shown the large fragment DNA that contains the HLF goal gene, has wherein marked each restriction enzyme site up.

Fig. 2 has shown the structure of carrier RS-ALA-IL.

Fig. 3 has shown the process that contains IL-11 goal gene large fragment DNA with the preparation of yeast homologous recombination method.

Fig. 4 has shown carrier RS-ALA-IL and has contained homologous recombination between the YAC molecule (Y-ALA) of ALA gene, thereby obtained to contain the YAC molecule (Y-ALA-IL-11) of IL-11 goal gene and ALA regulating and controlling sequence.

Fig. 5 has shown the structure of carrier RS-FIX2.

Fig. 6 has shown the structure of carrier RS-FIX1.

Fig. 7 has shown with carrier RS-ALA-IL and has contained homologous recombination between the YAC molecule (Y-ALA) of ALA gene, thereby obtained to contain the YAC molecule (Y-ALA-IL-11) of IL-11 goal gene and ALA regulating and controlling sequence.

In the present invention, " large fragment DNA " refers to length greater than 50kb, and be preferably greater than 100kb, more preferably big Dna molecular in 150kb.

Be applicable to that animal of the present invention comprises common mammal, in particular for the lactation of animal husbandry and the industry of giving milk Animal, for example ox and sheep. More preferably this animal is sheep, for example: Sha's energy Rushan sheep, bohr sheep, common goat.

Because it is universal that the inventive method has, therefore, be applicable to that the genes of interest of the inventive method is not special Restriction has for example just been selected different albumen among HLF, IL-11, the FIX3 in 3 embodiment of the present invention. As for the approach that obtains genes of interest, a kind of more convenient method is exactly by commercially available various yac clones, Perhaps by the yac clone with the conventional method formation, the method that adopts PCR method and enzyme to cut obtains to contain the purpose base The dna fragmentation of cause, especially genomic fragment.

In the present invention, usually adopt YAC and BAC as transgene carrier and since YAC have average 700kb, BAC has the DNA delivered payload capability about 200KB, thereby can hold people or mammiferous milk protein gene Large fragment upstream and downstream sequence.

More preferably, adopt YAC as transgene carrier. Plasmid vector with the employing of most transgenic animals Compare, make up as transgenosis with YAC DNA, obvious superiority is arranged.

1, can overcome the integration site effect.

When adopting the small fragment transgenosis structure on the plasmid, (only has 20kb because the DNA delivered payload capability of plasmid is limited Within), can only clone short mammary gland and express initiating sequence, transgenosis makes up to be incorporated into and transcribes work like this The property high genome position, just can obtain than high expressed, be at random but integrate, that produces like this turns to base Because of the genes of interest Product Expression amount of animal heterogeneity very just, what have does not express, and the low expression that has only has few Number is than high expressed.

On the contrary, when using the large fragment transgenosis structure transgenosis of yac vector, transfer owing to contain enough upstream and downstream The control sequence, thereby no matter where be incorporated into genome, the sequence of transgenosis own has the local transcriptional activity of formation unit Ability, this has just overcome the integration site effect, the expression of render transgenic animal is stable.

2, improve expression, stability and high efficiency is expressed.

Many examples show, adopt the table of target protein genomic DNA (gDNA) when protein mammary gland is expressed The amount of reaching is apparently higher than the expression of mRNA. But when the plasmid vector transgenosis, for the slightly big albumen of gDNA (more than the 10KB) often can only adopt the mRNA of this gene. In contrast to this, yac vector not only can get To the regulating and controlling sequence of sufficient length, and application YAC is chimeric and homologous recombination technique can be cloned very long target Albumen gDNA is used for mammary gland to express.

In general, when adopting YAC large fragment DNA transgenosis, the homology base in the expression of gene and the body Because expression is suitable, this in the mammary gland pharmaceuticals industry in mammary gland the target of mass expressing external genes of interest , the YAC transgenosis has good application prospect, and the large fragment DNA expression of plasmid vector is all than in the body Homogenic level is hanged down 1-2 the order of magnitude.

3, can overcome ectopic expression.

The expression of the transgenosis of mammary gland specifically expressing beyond mammary gland is called ectopic expression. Outside expressing in the mammary gland The source gene outcome usually also has the expression of trace at internal organs such as liver, kidneys, this has seriously affected transgenic animals originally The health of body. The regulating and controlling sequence that adopts yac vector to transfer large fragment then can strictly be controlled the group of transgene expression Knit specificity and grow the timing of expressing, thereby overcome ectopic expression.

In sum, employing large fragment DNA transgenosis can improve the success rate in the mammary gland pharmacy procedure greatly, For reducing cost, stabilised quality has far-reaching impetus.

Three kinds of modes are arranged when in the present invention, making up mammary gland expression vector usually:

1, for the genes of interest that contains the lactoprotein regulating and controlling sequence (such as people lactoprotein's gene), can directly prepare and contain The large fragment DNA of people lactoprotein's gene, and with procaryotic injection method production transgenic goat.

The advantage of this mode is: it is simple to make up the transgenosis large fragment DNA, and purpose Product Expression amount height.

2, utilize the homologous recombination method, transform the large fragment DNA of milk protein gene, foreign gene (as the pharmaceutical protein gene of preciousness) is recombined on the large fragment DNA, be located under the upstream and downstream regulating and controlling sequence of mammary gland expressing gene, regulated and control by it.

The advantage of this mode is: it is short to make up the transgenosis large fragment DNA cycle.

3, utilize the chimeric method of YAC, to contain the clone of goal gene and the yac clone of milk protein gene changes in the same yeast, both recombinate and form chimeric YAC molecule, the sequence-directed goal gene htrb gene of the big fragment upstream and downstream of milk protein gene group expression of gene on the wherein chimeric YAC molecule.

The advantage of this mode is: suitability is strong, can express nearly all goal gene with this method.

Below in conjunction with embodiment invention further specified wherein embodiment 1,2 and 3 corresponding respectively three kinds of above-mentioned modes that prepare mammary gland expression vector.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, people such as Sambrook for example, molecular cloning: laboratory manual (New York:Cold SpringHarbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

Embodiment 1: human lactoferrin (HLF) mammary gland transgenosis makes up human lactoferrin (HLF) mammary gland expression vector and makes up

People HLF is a specificity overexpression amount albumen in people's mammary gland, expression amount in human milk can reach 1.4 grams per milliliter milk, so the promotor of its gene itself can instruct the efficient localization and expression of HLF, transferred the yac clone of this gene with PCR for this reason, and carried out rare restriction analysis, determine to contain in this YAC strain initiating sequence and the downstream regulating and controlling sequence of 80kb and 120kb.Being directly used in mammary gland expresses.

One, experiment material

People's gene group CHEF YAC library (Shanghai City No2. University of Medical Sciences blood grinds the Chen Zhu academician of institute and is so kind as to give), pulsed field gel electrophoresis instrument CHEF-II, ultra-fine filter (Millipore UTK00), endonuclease, Taq enzyme and gelase are available from Promega company.

P ³²CTP isotope labeling reagent box is available from Promega company.

Two, building process

1, transfers and verifies the YAC strain that contains people HLF gene with PCR and Southern blotting.

The YAC molecule that contains the HLF gene with the PCR method screening.Wherein the PCR program be 95 ℃ 5 minutes, 94 ℃ 30 seconds, 55 ℃ of 35 circulations in 40 seconds, 72 ℃ were extended 7 minutes.Primer is Primer HLF (primer: HLF:5 ' AAGCCTGTGAATTCCTCAG 3 ' and 5 ' GCTAAGACTACAGCAGGG 3 '), sieve people's gene group YAC library.Obtained containing HLF gene clone yac clone Y-HLF through multi-turns screen.Further Southern trace result shows that this YAC molecule is 410KB.

2, contain the further restriction analysis of yac clone of HLF and the location of HLF gene.

Be equipped with the karyomit(e) enclosed mass that HLF clones with the low melting-point agarose legal system, use restriction enzyme SalI respectively, NotI, NruI, MluI and BssHII are partially digested, change film.The pBR322 plasmid is cut with BamHI and PvuII enzyme, reclaims the YAC molecule left arm sequence of 1.2KB, with α ³²Hybridize with last film behind the P mark, and then obtain this clone's rare restriction enzyme collection of illustrative plates.Based on this, with α ³²The P labeled primer has been determined the middle part of HLF gene at this YAC molecule to PCR product and the hybridization of last film of HLF, and upstream and downstream respectively has the regulating and controlling sequence (Fig. 1) of 100KB and 180KB.

3, the purifying of Y-HLF molecule

1. karyomit(e) enclosed mass preparation

In the AHC substratum of picking YAC mono-clonal inoculation 10ml, 30 ℃ of aerated culture spend the night.Centrifugal 5 minutes of 1500rpm collects yeast, and with condition centrifuge washing twice, total yeast volume is adjusted to 200ul with 10ml 50mM EDTA.The lyticase 20ul that adds 100u, mixing adds 2% low melting-point agarose of the thawing of 37 ℃ of 200ul again, pours into template behind the mixing and makes enclosed mass.Add spheroplast and prepare (50mM EDTA, 3% mercaptoethanol) in the liquid, 37 ℃ are spent the night.Change lysate (50mM EDTA, 100ul/ml proteolytic enzyme k) digestion 24 hours.

2. the purifying of Y-HLF molecule

With the yeast chromosomal enclosed mass that contains the YAC molecule, run pulsed field gel electrophoresis glue and adopt 1% super LMP agarose.After dyed observation, cut the YAC band, 65 degrees centigrade of water-baths 5 minutes, add gelase and its damping fluid of 25 times afterwards, 42 degrees centigrade digested 2 hours.

With blocking molecular weight is that 20000 ultra-fine filter concentrates the YAC molecule, reaches the concentration of 2ug/ml, again with injection damping fluid (Tris-Cl, pH8.0, NaCl 100mM, EDTA 0.025mM), dialysed 4 hours, the YAC molecule of preparation this moment promptly can be used for microinjection and produces transgenic animal.

3. the preparation of transgenic animal

A, microinjection: with the YAC molecule behind the above-mentioned purifying, the method by microinjection imports in the Saanen goat zygote male pronucleus, is transplanted in the acceptor goat uterine tube of synchronization of estrus again, treats its gestation farrowing.It is as follows that goat surpasses test-results such as row, injection, transplanting and farrowing:

B, transgenosis are integrated and detected: the lamb that will be born is soon got its ear tissue extraction DNA, the method of using PCR is (referring to " two, building process 1 ", primer is: HLF:5 ' AAGCCTGTGAATTCCTCAG 3 ' and 5 ' GCTAAGACTACAGCAGGG 3 ') carry out genetically modified integration and detect, the genetically modified integration rate of result is 20% (10/50), and the PCR+Southern test has confirmed the integration of gene.

C, detection of expression: sexually matured transgenic sheep by artificial lactagogue, is used the Western method and detected target protein in its milk.The result shows the expression that human lactoferrin is wherein arranged.

The structure of embodiment 2:Y-ALA-IL-11 transgenosis YAC DNA

In this embodiment, use the method for homologous recombination human interleukin IL-11 gene recombination is gone into to contain among the YAC of the pure albumen of human milk (ALA) gene, thereby be subjected to the promotor of ALA gene and the control (Fig. 3) of downstream regulating and controlling sequence.

One, experiment material:

Y-ALA: be the YAC molecule (Shanghai City No2. University of Medical Sciences blood grinds the Chen Zhu academician of institute and is so kind as to give) that contains the ALA gene, shuttle vectors RS403 (band His 3 screening-genes) is available from Stratagene company.IL-11 genomic gene clone (obtaining) by this sieve storehouse, research centre.

Primer: ALA1:5 ' CCGGAATTCGCCTAGATGCTTTCATACAGG 3 '

5′TCCCCCGGGTTTGGCTACCCCCAAGAACCT?3′

ALA2：5′ATTGGGCCCATCCCAGGGAAATGAAGGAAG?3′

5′CCGCTCGAGAAGGCTCAGAGACAGATAAG?3′。

A-I3：5′GCTCCTGGGCTCAAGTG?3′

5′CTTTAACCCTTCCCTGTCC?3′

A-I4：5′TGACTGTGTATTTTGCATGAC?3′

5′TTCAAGAATTCGGTGATGTC3′

Two, building process (transferring the upstream and downstream homology arm structure of ALA gene)

1, makes up the recombinant vectors PRS-ALA that shuttles back and forth in the yeast.

By PCR reaction, respectively with primer to ALA1 and primer to from the human gene group DNA, the clone people upstream and downstream respectively 700 and ALA-up and the ALA-down fragment of 900bp of ALA gene of ALA2.Identical among PCR round-robin condition and the embodiment 1.

The ALA-up that amplifies and ALA-down fragment are cut and are connected with PRS403 carrier after enzyme is cut after the EcoRI+SmaI enzyme is cut through the ApaI+XhoI enzyme, form the PRS-ALA carrier.

2, people IL-11 gene recombination is gone on the Y-ALA, form and express the IL-11 mammary gland expression vector

To contain the IL-11 gene DNA and cut, collect the IL-11 gene coding region (have whole exons and intron, but do not contain its regulating and controlling sequence) of 6.0kb, be cloned into the corresponding site among the PRS-ALA, be built into RS-ALA-IL (Fig. 2) with BamHI and NotI enzyme.In this carrier the segmental 3 ' end of AlA-up be positioned at the ALA genetic transcription open the beginning 25bp place, downstream, site.ALA-down is segmental 5 ' is positioned on the 4th exon of ALA gene.

Below be ALA-up, the sequencing result of ALA-down and IL-11, wherein runic is an exon, normally is intron.

ALA-up sequence (SEQ ID NO:1)--

GTGCCTGGCCTAGATGCTTTCATACAGGCTTTTCAATTATGCATTTTCCTTAAGTAGGAAGTCTTAAGATCCAAGTTATATCG

GATTGTTGTAGTCTACGTTCCCATATTCTATTCCTATTTCTGAGCCTTCAGTCATGAGCTACCATATTAAAGAACTAAATTCTGG

GCCTTGTTACATGGCTGGATTGGTTGGACAAGTGCCAGCTCTGATCCTGGGACTGTGGCATGTGATGACATACACCCCCT

CTCCACATTCTGCATGTCTCTAGGGGGGAAGGGGGAAGCTCGGTATAGAACCTTTATTGTATTTTCTGATTGCCTCACTTC

TTATATTGCCCCCATGCCCTTCTTTGTTCCTCAAGTAACCAGAGACAGTGCTTCCCAGAACCAACCCTACAAGAAACAAAG

GGCTAAACAAAGCCAAATGGGAAGCAGGATCATGGTTTGAACTCTTTCTGGCCAGAGAACAATACCTGCTATGGACTAGAT

ACTGGGAGAGGGAAAGGAAAAGTAGGGTGAATTATGGAAGGAAGCTGGCAGGCTCAGCGTTTTCTGTCTTGGCATGACCA

GTCTCTCTTCATTCTCTTCCTAGATGTAGGGCTTGGTACCAGAGCCCCTGAGGCTTTCTGCATGAATATAAATAAATGAAAC

Connect the IL-11 gene below the TGAGTGATGCTTCCATTTCAGGTTCTTGGGGGTAGCCAAA-------

ALA5 ' UTR------IL-11 gene (SEQ ID NO:2)-

ATGCCTCCCCTCCCCAGCCGCGGGCCCAGCTGACCCTCGGGGCTCCCCCGGCAGCGGACAGG

GAAGGGTTAAAGGCCCCCGGCTCCCTGCCCCCTGCCCTGGGGAACCCCTGGCCCTGTGGGGA

CATGAACT

GTAAGTTGGTTCATGGGGAGGGTGGAGGGGACAGGGAGGCAGGGAGGAGAGGGACCCACGGCGGGGGTGGGAGCAG

ACCCCGCTGAGTCGCACAGAGAGGGACCCGGAGACAGGCAGCCGGGGAGGAGAGCAGCTTCGGAGACAGGAGGCGG

CGGAGGAGATGGGCAGAGAGAGACACAGACAGGAGCGGATGGAGGCAGCCAATCAGAGGCGCCGCAGGAGGGACGG

GCCAGACAGGGCCCGAGAGGAGCGAGACGCGAGACCGAGCAGGGGCAGGGACGCAGGGACTGGTGCCGGGAGGGA

GGTGACCCCCATCGACCCAGGCCCCAGGGAGCCCGCGGGGACCGGGAGACTCCCTGGGATTCCGGCAGAGAGGCTC

CGGAGGGAAACTGAGGCAGGGTCCGCGGAGAGCGGAGCAAGCCAGGGAGTAGCGACCCCAGCCGGGGGGAGGAGA

GAGACTGGGCGCCGGGGGAAAGCGGGGAGAGCCGGGCAGATGCGGCCGACGGAGGCGCGGACAGACCGACGGCTG

GCGGGCCCGGGGGGCGGGCTGGGGGTGTGCGAGGCGCGGGCGGCCGGGGAGCGCTGATTGGCTGGCGGGTGGCC

GGGTGGGCGGGGCGGCCGGGGTGGGCTGCGGGGAGCGAGCTCCGGACCCCCGCGCCCCCGGCGCCCCCCGCGCC

CCCCGCCGCCAGCTCTCCCGCTCCCGGCGCCCGGCCGGGCCATGGCTCTGCCCCTCTCCGCCCAGGTGCGCTGCGG

CCCGGGCTTCTGCCGCCCACCCGGCGGGCTCCTGGGAGGGCGTCTAAGGGGTCTCCCGTGGGAGAGGTCCGTGTCTC

CCGGACTCCGTCCTGGGCTTTTGGCTCCTTCCCCTGCTCCCAGCCAGCTCGGGCTCCCGCGGCCCGGGGAGGGGGCA

GGTTCTGGCCTGTGCCTCCCCCACCATCCGCGCCCCGGGGCCCAGATTCCGGCGTCCGGGGGCGGACGGGAGACGC

CCGGGCCGCGTCTGCTCCGACGGGCGGGGCAGCCAGAGCCAGGGAGGGAGAGGGAAGCCCGCCTGGCCCTGCGAC

CTGCCCGCGGGCGTTCCACCCTGGGACTTAAGACCTCCAGCTCCATCCTCCCTAAGGCCGGGAGTCCAGGCCCCAGAC

CCTCCTCCCCGAGACCCAGGAGTCCAGACCCCAGGCCTTCCTCCCTCAGACCTAGGAGTCCAGGCCCCCAGCCTCTCC

TCCCTCAGACCCAGGAGGAGTCCAGACCCCAGTTCCTCCTCCCTCAGACCCGGGAGTCCAGCCCAGGCCCTCCTCTCT

CAGACCCGGAGTCCAGCCTGAGCTCTCTGCCTTATCCTGCCCCCAG

GCCTGTGGCCAGATACAGCTGTCGCCCCTGGGCCACCACCTGGCCCCCCTCGAGTTTCCCCAG

ACCCTCGGGCCGAGCTGGACAGCACCGTGCTCCTGACCCGCTCTCTCCTGGCGGACACGCGG

CAGCTGGCTGCACAGCTG

CGGAGAGGAGTCTGCGGGCAGCCACTTGGAGGGGTTCTGGGCTCTCAGGTGGCAGAGTGAGGGAGGGGAAGAGTTG

GGGGCCTGGCGTGGGGGATGGAGGGAGCCCCGAGGCTGGGCAGGGGCCACCTCACAGCTTTTTTCCCTGCCAG

CCCTGCCCACCCTGGCCATGAGTGCAGGGGCACTGGGAGCTCTACAG

GTAAGGGCAAGGGAGTGGGCTGGGGACAAGGTGGGAGGCAGGCAGTGAAGGGGGCGGGGAGGATGAGGGGCACTG

GTCGGGTGTTCTCTGATGTCCCGGCTCTATCCCCAG

GCTGCGAGCGGACCTACTGTCCTACCTGCGGCACGTGCAGTGGCTGCGCCGGGCAGGTGG

CTCTTCCCTGAAGACCCTGGAGCCCGAGCTGGGCACCCTGCAGGCCCGACTGGACCGGCT

GCTGCGCCGGCTGCAGCTCCTG

GTATGTCCTGGCCCCAAGACCTGACACCCCAGACCCCCACCCCTGGCCCCAAAATCCTGTGGCCTGAGTCCTTGAAGCC

TGAGACCCCAGACCCGAGTGCAACAGCCCCGCTCTGAGACCCTGACACCCTAACAGCCCGCTCTGAGACCCTGACACC

GTAACAGCCCCGCTCTGAGACCCTGACCCTAACAGTCCTGCTCTGAGACCCTGACCCTGCAGTCCCAAGATCCTGTGGC

CCTGAGACCCTGAGGCCCTAGACCCCCAAATCCTGCCCAGAAACTTCAAATTCTCACCCAAGACCCTGAGACTCCATCAT

CCATGACCTCAAAGTCCCCAGATCCCAGCCCCTAAGACCCAAGACCCCATCCTGAAGCCCAAAGCCTTGAGAATTCAAAT

CCTCACCTCAAGACTTGGAGACCCTGGCCCCATGACATTGAAAACCATGGACCTGGCCAGGCGTGGTGGCTCACGCCT

GTAATCCCAGCACTTTGGGAGGCCGAGGCAAGTGGATCACCTGAGGTCGGGAGTTCAAGACCAGCCAGACCAACATGG

TGAAACCCTGTCTCTACTAAAAATACAAAATTAGCCAGGCGTGGTGGTGCATGCCTGTAATCCCAGCTACTTGGGAGGCTG

AGGCAGGAGAATCGCTTGAACCTGGGAGGCGGAGGTTGCAGTGAGCCGAGATCGCACCATTACACTCCAGCCTGGGCA

ACAAGAGCAAAACTCCCTCTCTCTCAAAAAAAAAAAAAAAAAAAAAAAAGAAGGAAAAGAAAACCATGGACCTCCAGACC

CTGAGACCCCAGGCCCCAGCCCTGAGATCCTGACATCTTAAAGATCCCAGGCCCTAAGATACAAGACCTTGACCCAAAGC

CAGCCTTGGGACCCTGGCTGTACAAACCCAAGACCTCCAGGACCTAGACCCCGAGCCCTGAGGCCCTATGTCTCACTCC

CAACATCGAAAACCCTGACACCTCAGATCCTGAGCCTGCGCCTGTACGACTCCAAGACCCTCACTTCCAAAGCCAGGCC

CAAAGCCCTGAGACCAGAAGACTTCAAACCCTGGTTCTTGGGCCTAACTCCAAAGACCCTGGATCTCAAATTCCAACTTC

TAGCTCTGAGACTCCAGCCCTCACCCATGAGTTCCTGAACTTGAACCCAGAGACCCCATCTCTAAGACTTCAGCCTTGAG

ATCCAGGGCCTGACCCTAGACTCGAGCCCACAGACCTCAGATACTGTCTGTAAAACCCCAGCTCTGGTGGGGAGCAGTG

GCTCACTCCTGTAATCCCAAGGCAGGGGAGGCCAAGGCAGAAGGACCTCTTGAGGCCATGAGTTTGAGACAGCCTGGG

CAGCATAGCAAGACTCTGTTTCTTAATTATTATTATTATTATTATTTTTTGGAGACAGAGTCTCGCGCTCTGTTGCCCAGGCT

AGAGTGCAATGGTGCCATTTCGGCTTGCTGGAACCTCCGCCTCCTGGGCTCAAGCGATTCTCCTGCCTCAGCCTCCTGA

GTAGCTGGGACTTCAGGTGCACACTGCCACACCCGGATAATTTTTTTGTATTTTAGTAGACACAGGGTTTCACCGTGTTGC

CCAGGCTGGTCACAAACTCCTGAGCTCAGGCCATCCGCCCGCCTCGGCCTCCCAAAGCGCTGGGATAACAGGCGTGAC

GCCGCGCCTGGCTTCTTAATTGTTCTAACAGCAGCGACAACAACAAAAACCCAGCTCTGAGATTCCAGCCCCGGCGACT

CTACAGTCCCAGGCCCGATCCCTCACCTAGAACCGAGATGCCAGCCCTGACTCCACAGACTTCACCCCCAACCCCCAC

ACTCAGCTCTGGAAGCCCGTCCTGACTCCAGCCTCCATTTTCGGAACCCCACAGCCTGAAGAGCTCCCGGCCTAAACAC

TTCACCCCACGCGCCACAGTCCCCCTGTGAATATGCAGCCCCGATTCAGCTGCAGCTCCACAGCACCCCTGCCCTGCAC

CCCCGCTGCACCCCCTACCTGTGACTCACCTCTCTCCTCTCCCCACAG

ATGTCCCGCCTGGCCCTGCCCCAGCCACCCCCGGACCCGCCGGCGCCCCCGCTGGCGCCCCC

CTCCTCAGCCTGGGGGGGCATCAGGGCCGCCCACGCCATCCTGGGGGGGCTGCACCTGACAC

TTGACTGGGCCGTGAGGGGACTGCTGCTGCTGAAGACTCGGCTGTGACCCGGGGCCCAAAGC

CACCACCGTCCTTCCAAAGCCAGATCTTATTTATTTATTTATTTCAGTACTGGGGGCGAAACAGCC

AGGTGATCCCCCCGCCATTATCTCCCCCTAGTTAGAGACAGTCCTTCCGTGAGGCCTGGGGGGC

ATCTGTGCCTTATTTATACTTATTTATTTCAGGAGCAGGGGTGGGAGGCAGGTGGACTCCTGGGT

CCCCGAGGAGGAGGGGACTGGGGTCCCGGATTCTTGGGTCTCCAAGAAGTCTGTCCACAGACT

TCTGCCCTGGCTCTTCCCCATCTAGGCCTGGGCAGGAACATATATTATTTATTTAAGCAATTACTTT

TCATGTTGGGGTGGGGACGGAGGGGAAAGGGAAGCCTGGGTTTTTGTACAAAAATGTGAGAAA

CCTTTGTGAGACAGAGAACAGGGAATTAAATGTGTCATACATATCCACTTGAGGGCGATTTGTCT

GAGAGCTGGGGCTGGATGCTTGGGTAACTGGGGCAGGGCAGGTGGAGGGGAGACCTCCATTC

AGGTGGAGGTCCCGAGTGGGCGGGGCAGCGACTGGGAGATGGGTCGGTCACCCAGACAGCTC

TGTGGAGGCAGGGTCTGAGCCTTGCCTGGGGCCCCGCACTGCATAGGGCCGTTTGTTTGTTTTT

TGAGATGGAGTCTCGCTCTGTTGCCTAGGCTGGAGTGCAGTGAGGCAATCTAAGGTCACTGCAA

CCTCCACCTCCCGGGTTCAAGCAATTCTCCTGCCTCAGCCTCCCGATTAGCTGGGATCACAGGT

GTGCACCACCATGCCCAGCTAATTATTTATTTCTTTTGTATTTTTAGTAGAGACAGGGTTTCACCAT

GTTGGCCAGGCTGGTTTCGAACTCCTGACCTCAGGTGATCCTCCTGCCTCGGCCTCCCAAAGTG

CTGGGATTACAGGTGTGAGCCACCACACCTGACCCATAGGTCTTCAATAAATATTTAATGGAAGG

TTCCACAAGTCACCCTGTGATCAACAGTACCCGTATGGGACAAAGCTGCAAGGTCAAGATGGTT

CATTATGGCTGTGTTCACCATAGCAAACTGGAAACAATCTAGATATCCAACAGTGAGGGTTAAGC

AACATGGTGCATCTGTGGATAGAACGCCACCCAGCCGCCCGGAGCAGGGACTGTCATTCAGGG

AGGCTAAGGAGAGAGGCTTGCTTGGGATATAGAAAGATATCCTGACATTGGCCAGGCATGGTGG

CTCACGCCTGTAATCCTGGCACTTTGGGAGGACGAAGCGAGTGGATCACTGAAGTCCAAGAGT

TTGAGACCGGCCTGCGAGACATGGCAAAACCCTGTCTCAAAAAAGAAAGAATGATGTCCTGAC

ATGAAACAGCAGGCTACAAAAACCACTGCATGCTGTGATCCCAATTTTGTGTTTTTCTTTCTATATAT

GGATTAAAACAAAAATCCTAAAGGGAAATACGCCAAAATGTTGACAATGACTGTCTCCAGGTCA

AAGGAGAGAGGTGGGATTGTGGGTGACTTTTAATGTGTATGATTGTCTGTATTTTACAGAATTTCT

GCCATGACTGTGTATTTTGCATGACACATTTTAAAAATAATAAACACTATTTTTAGAATAAC

AGAATATCAGCCTCCTCCTCTCCAAAAATAAGCCCTCAGGAGGGGACAAAGTTGACCGCTGATTGAGCCTGTCAGGGCT

Meet ALA-down below the GTGCAC------------

ALA-down(SEQ?ID?NO：3)

ATCCCAGGGAAATGAAGGAAGTCCCTACCCAGGGTTAGACATTACCACATTGGTCCTTTCATATAGAAAGACAACAGGCAC

AAGCCTTGAGTTTAGAGAACCCACTGGATCCAGGGGTTAGGGGAACTCAGTGCCTTTCTGGGTAATACTTGTCAGCTGTC

TCAATCCTTTCCCTGTAACTCCTGCCAGA

GTTCCTGGATGATGACATTACTGATGACATAATGTGTGCCAAGAAGATCCTGGATATTAAAGGAAT

TGACTACTG

TACTGGTGAATCCTTATTCTATTTTCTATTTCCCCATCCTCCTTCTCCTTACCCCATTAGCCCAGCACCCCTTTCCTCTTACC

CTATCTCTTGGTCATTTAATCTAGAATACAGTGTCTGAAACAAAGCTTACCTAGAGACTCAGGTTTCTGTTATTAAGCCTCTC

TCGCTCCGCTCCTTGGTAGCAATTTTCCTAATAAGGGGTTGCCTAATGGAGGGCTCAGACCCAGGCCTCCTTTCACTTAG

ACTTGGACATCTAATTCCACTTGTTTAGTTCTATGCCCTAAAGCAAGCTGTTGGTAACATTGCATCTCTTTTTTAACCCTACA

ATTTTCTTGGATATTTTTTATGGACTGTATTCCACTTGATGGCTTGTGTCGCTTGACATCAGGCCAGGAATGTCTTTCTGTAA

TTCTCGTCCACGCTCTTCCACTTCAGCCCTCCTGGGAATGAATGTAAAGATTCAGTCAGCTAACTCACCTTGTCCCCCTTC

TCCATTATCAG

GTTGGCCCATAAAGCCCTCTGCACTGAGAAGCTGGAACAGTGGCTTTGTGAGAAGTTGTGAGTG

TCTGCTGTCCTTGGCACCCCTGCCCACTCCACACTCCTGGAATACCTCTTCCCTAATGCCACCTC

AGTTTGTTTCTTTCTGTTCCCCCAAAGCTTATCTGTC

3. the YAC molecule (Y-ALA) that contains the ALA gene is carried out the transfaunation master

The Y-ALA molecule is present among the host AB1380 and since AB1380 in genetic marker few, be unfavorable for homologous recombination, thus with this YAC molecular transfer in YPD925 host bacterium, help next step gene recombination.The YPD925 yeast strains can with-His or-the nutrition mark of Leu screens recombination.

Incubated overnight YPD925 thalline and the yeast strains that contains Y-ALA, respectively collected the mixed centrifugal (2500rpm of 1ml bacterium liquid in second day, 2min), resuspended with the YPD that 1ml is fresh, cultivated 6-8 hour for 30 degrees centigrade, the back is drawn the 0.2ml culture and is coated with screening dull and stereotyped (Ura contains cycloheximide 3ug/ml), cultivates to occur bacterium colony in 3 days.This moment, the YAC molecule was transferred among the yeast strains YPD925.

4 go into the IL-11 gene recombination in the Y-ALA molecule, make up reorganization YAC ALA-IL.

Incubated overnight, Y-ALA bacterial strain 100ml, when culture OD value reaches 0.5 left and right sides, centrifugal collection, water is resuspended, and is centrifugal, transforms the Y-ALA bacterial strain with the RS-ALA-IL carrier by the LiAC method, thereby allows recombinate between RS-ALA-IL and the Y-ALA (Fig. 4).Screen His+, the transformant of Ura+ and Trp+.Further A-I3 and A-I4 are identified, can pull out 700 and the 1000bp product respectively, be the sub-YAC-ALA-IL of homologous recombination (or being called Y-ALA-IL-11) with primer.

The purifying of 5 reorganization YAC

The purifying of reorganization YAC is with embodiment 1.The YAC molecule of preparation promptly can be used for microinjection and produces transgenic animal.

A, microinjection: with the YAC molecule behind the above-mentioned purifying, the method by microinjection imports in the Saanen goat zygote male pronucleus, is transplanted in the acceptor goat uterine tube of synchronization of estrus again, treats its gestation farrowing.It is as follows that goat surpasses test-results such as row, injection, transplanting and farrowing:

B, transgenosis are integrated and detected: the lamb that will be born is soon got its ear tissue extraction DNA, the method (identical with the PCR method in the present embodiment " two, building process 1 ") of using PCR is carried out genetically modified integration and is detected, the genetically modified integration rate of result is 20% 10/50), the PCR+Southern test has confirmed the integration of gene.

C, detection of expression: sexually matured transgenic sheep by artificial lactagogue, is used the Western method and detected target protein in its milk.The result has confirmed the expression of IL-11.

Embodiment 3

One, experiment material

Y-ALA, Y-FIX (yac clone that contains thrombin 9 genes) (Shanghai City No2. University of Medical Sciences blood grinds the Chen Zhu academician of institute and is so kind as to give), RS403, RS-401 (available from Stratagene company), AB1610 yeast (bacterial strain commonly used).

Primer: ALA1:5 ' CCGGAATTCGCCTAGATGCTTTCATACAGG 3 '

5′TCCCCCGGGTTTGGCTACCCCCAAGAACCT?3′

ALA2：5′ATTGGGCCCATCCCAGGGAAATGAAGGAAG?3′

5′CCGCTCGAGAAGGCTCAGAGACAGATAAG?3′

FIX1 5′CAAAGGTTATGCAGCGC?3′

5′AGCTGACATCATGTCTGGAG?3′

FIX2 5′GTCATAATTTCAGAACCCACG?3′

5′TGAATTAACCTTGGAAATCC?3′

F-A1 5′TGGACATTATTTCCCAGAAG?3′

5′TTTGGCTACCCCCAAGAACCT?3′

F-A2 5′ATCCCAGGGAAATGAAGGAAG?3′

5′GGTAAAATATGAAATTCTCCC?3′

Two, building process

1, transfers the upstream and downstream regulating and controlling sequence fragment of ALA gene.

By PCR reaction, respectively with primer to ALA1 and primer to ALA2 from the human gene group DNA, amplify people ALA gene upstream and downstream each 700 and the fragment of 900bp.The PCR loop parameter is with embodiment 1.

2, transfer head, the cauda section of thrombin 9 genes.

By the PCR reaction, with primer FIX1 and primer are amplified each 1KB end to end of people FIX gene and the fragment of 1.2KB to FIX2 from the human gene group DNA respectively.The PCR loop parameter is with embodiment 1.

3, make up recombinant vectors

The ALA upstream fragment of 700bp in the step 1 cut with the thrombin 9 gene head sections of 1KB through EcoRV and NotI enzyme cut, insert in the corresponding site of RS403, form carrier RS-FIX1 (Fig. 5) through EcoRV and XhoI enzyme.

The ALA downstream fragment (cutting through EcoRV and NotI enzyme) of 900bp in the step 1 and the thrombin 9 gene rears (cutting through EcoRV and XhoI enzyme) of 1.2kb are inserted in the corresponding site of RS401, formed RS-FIX2 (Fig. 6).

4, recombination to construct reorganization Y-rFIX in the yeast

Simultaneously RS-FIX1 and RS-FIX 2 usefulness LiAC methods are transformed the YPD925 yeast strains that contains Y-ALA, sieve is got the reorganization YAC molecule (Fig. 7) of Leu+ and His+ characteristic.Further with primer to F-A1 and F-A2 screening homologous recombination, the PCR reaction obtain 750 and the 850bp band be recon Y-rFIX.

5, the chimeric reorganization of YAC takes place in Y-ALA and reorganization Y-FIX molecule

Extract the Y-ALA molecule, protoplasm body transforms and imports AB1610, this bacterium of incubated overnight and contain the AB1380 bacterial strain of Y-rFIX, second day, it was mixed centrifugal respectively to get 1ml, and cultivated 4-8 hour for 30 degrees centigrade with the fresh YPD nutrient solution of 1ml the back, be coated with the dull and stereotyped (Leu of screening,-Trp ,-Ura), grow the clone after 3 days.The clone further cultivated 3 days on the sporulation substratum, washed thalline with 1ml water, handled with the excusing from death ripple, obtain spore liquid, further be applied to screening culture medium, sieve is got Trp+, Ura+, Leu+, His-, the yeast strains of TK-, this strain are Y-ALA-FIX reorganization YAC strain.

Electrophoresis result shows: Y-ALA-FIX reorganization YAC strain length is 230KB, and is longer than Y-ALA sample.

6. press embodiment 1 similar method, extract the YAC molecule of reorganization, be used for microinjection.

A, microinjection: with the YAC molecule behind the above-mentioned purifying, the method by microinjection imports in the Saanen goat zygote male pronucleus, is transplanted in the acceptor goat uterine tube of synchronization of estrus again, treats its gestation farrowing.It is as follows that goat surpasses test-results such as row, injection, transplanting and farrowing:

B, transgenosis are integrated and detected: the lamb that will be born is soon got its ear tissue extraction DNA, the method (identical with PGR method in the present embodiment " two, building process 1 ") of using PCR is carried out genetically modified integration and is detected, the genetically modified integration rate of result is 20% (10/50), and the PCR+Southern test has confirmed the integration of gene.

C, detection of expression: sexually matured transgenic sheep by artificial lactagogue, is used the Western method and detected target protein in its milk.The result has confirmed the expression of the FIX factor.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Claims (10)

1, a kind ofly prepare the method for galactophore biological reactor, it is characterized in that it comprises step with large fragment DNA:

The large fragment DNA that contains goal gene on preparation bacterial artificial chromosome BAC, yeast artificial chromosome YAC and the P1 carrier, wherein the goal gene on the large fragment DNA fixes a point to express in goat mammary gland, and has the regulating and controlling sequence of milk protein gene in the both sides of described goal gene;

With the procaryotic injection method large fragment DNA is injected in the goat zygote,

Be transplanted in the replace-conceive goat body, produce genetically modified goat, the goal gene on the large fragment DNA fixes a point to express in goat mammary gland.

2, method according to claim 1 is characterized in that, this goal gene coding lactoferrin.

3, method according to claim 1, it is characterized in that, this large fragment DNA is transformed by the method for homologous recombination in the yeast, thereby the both sides that the regulating and controlling sequence of milk protein gene is positioned at goal gene in this large fragment DNA and guide the expression of goal gene.

4, method according to claim 3 is characterized in that, when transforming large fragment DNA with the method for homologous recombination in the yeast, comprises step:

Transfer each one section 300-1500bp regulating and controlling sequence of milk protein gene upstream and downstream as homology arm with polymerase chain reaction method, insert the goal gene that to express between the two and be built into targeting vector.

5, method as claimed in claim 4 is characterized in that, also comprises step:

With described targeting vector, carry out recombinating in the yeast, thereby goal gene is inserted under the big fragment regulating and controlling sequence of milk protein gene with macromole YAC, BAC, the P1 clone of the complete encoding sequence that contains milk protein gene big fragment upstream and downstream sequence and gene self.

6, method according to claim 1, it is characterized in that, this large fragment DNA comprises that length is the genome sequence that contains goal gene of 5-200kb and to be positioned at the length that described genome sequence both sides and guide destination gene expression be the regulating and controlling sequence of the milk protein gene of 50-200KB.

7, method according to claim 6, it is characterized in that, the regulating and controlling sequence of described milk protein gene comprises 5 of milk protein gene coding region ' and 3 ' sequence, comprises the core sequence that following control milk protein gene is transcribed on it: TATA box, GC box, far-end region.

8, method according to claim 6 is characterized in that, described large fragment DNA prepares with the chimeric method of YAC in the yeast.

9, method as claimed in claim 8 is characterized in that, comprises step when preparing large fragment DNA with the chimeric method of YAC in the yeast:

The expression vector and the expression vector that contains the genome sequence of goal gene of preparation mammary expression whey albumin ALA;

Transfer each a bit of 300-1500bp sequence end to end of each a bit of 300-1500bp regulating and controlling sequence of milk protein gene upstream and downstream and goal gene with polymerase chain reaction method, with the homologous recombination mode each a bit of regulating and controlling sequence of described milk protein gene upstream and downstream is inserted the upstream and downstream of each one section sequence end to end of described goal gene respectively, form two chimeric vectors;

Chimeric vector and the described expression vector that contains the genome sequence of goal gene carry out homologous recombination, form the goal gene chimeric vector, and each a bit of regulating and controlling sequence of wherein said milk protein gene upstream and downstream is positioned at the both sides of goal gene;

The expression vector of goal gene chimeric vector and mammary expression milk-protein is changed in the same yeast over to both formation chimeric molecules of recombinating, the wherein expression of the genome sequence of the sequence-directed goal gene of the big fragment upstream and downstream of milk protein gene on this chimeric molecule.

10, the method for claim 1 is characterized in that, this goal gene coding is selected from down the albumen of group: human lactoferrin, interleukin-11, thrombin 9, and this goat is selected from down group: Sha's energy Rushan sheep, bohr sheep, common goat.

Images