CN1882685A - A process for producing exogenous protein in the milk of trangenic mammals and a process for purifying proteins therefrom - Google Patents

Abstract

The invention relates to a method of producing a protein of interest, comprising making a non-human transgenic mammal that produces said protein in its milk, obtaining said milk from the non-human transgenic mammal and purifying said protein of interest from the milk. Transgenic bovine animals were generated, which are able to produce human growth hormone in mammary glands. The method involves cloning of a genetic construct encoding hGH gene and beta casein promoter conveniently in an expression vector. It also includes transfection procedures into fetal bovine somatic cells, generally fibroblasts, and the nuclear transfer into enucleated bovine oocytes, generating thus transgenic embryos. The method also includes other procedures to generate transgenic embryos for the further expansion of the transgenic herd, such as the subcloning of transgenic female bovines, the superovulation of transgenic cows and their insemination with semen from a non-transgenic or a transgenic male bovine, and the superovulation of non-transgenic cows and their insemination with semen from a transgenic male bovine. Afterwards, transgenic embryos give rise to transgenic cattle that produce human growth hormone in huge amounts in their milk, from which the hormone is completely purified and analysed to fulfill all the requirements for the manufacture of a pure biopharmaceutical product.

Description

In the milk of transgene mammal, produce the method for foreign protein and from the method for purifying protein wherein

Background technology

Produced protein factor and the hormone that relates to people's health care at large by extraction or by recombinant technology in 10 years in the past by pharmaceutical industry.The genetic constructs that relates to required gene has successfully obtained expression in bacterium, yeast or mammal cell line.Yet, use mammalian cell cultures to obtain complicated protein, as the suitable glycosylation pattern of needs those, relate to expensive method.

Used recombinant DNA technology to come the manufacturer already to go up important biomaterial in the past in 10 years growingly.For this reason, cloned the dna sequence dna of the various medically important human proteins of encoding.These comprise Regular Insulin, plasminogen activator, alpha1-antitrypsin and coagulation factors VIII and IX.At present, even use emerging recombinant DNA technology, also these protein of purifying from blood and tissue usually, this is expensive and time-consuming method, may have to propagate infected material as causing those risk of ADIS and hepatitis.

Although the expressible dna sequence is produced required medically important protein matter and is looked like attractive proposal in bacterium, in fact usually prove that bacterium can not be satisfactory as the host, because foreign protein is unstable and correctly do not processed in bacterial cell.

Recognize this problem, attempted in the mammalian tissues culture, expressing institute's cloned genes and having proved it is feasible strategy in some cases.Yet the batch fermentation of zooblast is expensive and process that need technology.

Therefore there is high yield, the needs of cost effective method to the eucaryon polypeptide that is used to produce biological substance such as correct modification.Not existing the infective material of people in the method will be an advantage.

In order in milk, to obtain a large amount of human proteins, obtain the transgenic animal of required gene such as the possibility of ox and caused industrial very big interest.Several groups in the document have reported and have produced human serum albumin, the success of alpha-1 antitrypsin and some other examples in transgenic cattle or goat.

In mouse or rat, carried out many experiments before, preferably transgene expression has been limited in the mammary gland usually, because use β casein or whey-protein promotor, the mammary gland transcription factor during its response lactation is female.

The heterologous protein expression in milk specially is intended to avoid to the disadvantageous effect of host animal health and easy purification process is provided.

People are devoted to set up the output that several systems improve cell transfecting or selection at present, and select the somatic source of homology fetus to improve survival and the immune state of cloned animal.

On the other hand, for the purpose of agricultural and bio-pharmaceutical, having the huge interest to body-cell neucleus transplanting, mainly is to make breeding of original seed domestic animal and the through engineering approaches of transgenic animal become possibility.Briefly, nuclear transplantation (NT) comprises the stoning of acceptor ovocyte, then donorcells is migrated in the crack of tight juxtaposed ovum week of recipient cytoplasm body, and they are merged.Activate artificial induced development by chemistry or physics.Produce clone's offspring in sheep (Campbell, K.H. etc., Nature 380:64-66 (1996), 1996 by body-cell neucleus transplanting; Wells, D.N. etc., Biol Reprod 57:385-393 (1997); Wilmut, I. etc., Nature385:810-813 (1997)); Goat (Baguisi, A. etc., Nat Biotechnol17:456-461 (1999)) and ox (Cibelli, J.B. etc., Science 280:.1256-1258 (19981); Kato, Y. etc., Science 282:2095-2098 (1998); Wells, D.N. etc., Reprod Fertil Dev 10:369-378 (1998)) in obtained success.

The factor that has the several NT of influence results comprises the method for stoning, fusion, activation and D-A cell cycle synchronism.Obtain the high-level efficiency of acceptor ovocyte stoning, used DNA specificity vital dye to manifest chromatin (Stice, S.L. and Keefer, C.L., Biol Reprod 48:715-719 (1993); Westhusin, M.E. etc., J ReprodFertil 95:475-480 (1992)).The size (Collas, P. etc., AnalBiochem 208:1-9 (1993)) of contacting of the accuracy of cell aligned, donorcells and acceptor ovocyte in the pulsed field and donorcells is depended in donorcells and the fusion of acceptor ovocyte.The speed that the activation that NT rebuilds the embryo has obtained meticulous improvement and developed into blastocyst equals the ovocyte (Liu, L etc., Mol Reprod Dev 49:298-307 (1998)) of in vitro fertilization.

Realized NT embryo's successful growth, use sophisticated ovocyte (Willadsen, S.M., Nature 320:63-65 (1986)), zygote (McGrath, J. and Solter, D., Dev Biol N Y 4:37-55 (1985)) and the embryo (Tsunoda of cleavage stage, Y. etc., JReprod Fertil 96:275-281 (1992)) as the recipient cytoplasm body; Yet this depends on the source of donor nuclei.The consistency of cell cycle between recipient cytoplasm body and the donorcells is an important factor that influences the NT fetal development.Need suitable synchronization to keep rebuilding embryo's ploidy.

The mitotic cell cycle has the following successive phase: duplicate preceding interval (G1), DNA synthetic (S), preceding interval (G2) of mitotic division and mitotic division (M).In the individual cells periodic process, all genomic dnas duplicate once before mitotic division.The interval donor nuclei that migrates in the stoning mature oocyte (II in mid-term) experiences form change several times.After the fusion, but decompose (NEBD) before at the donor nuclei coating, karyomit(e) concentrates (PCC).The activity of these changes/mitotic division ripe by facilitating/reduction division factor (MPF) and mitogen activated protein kinase (MAPK) is induced (Collas, P. and Robl, J.M., Biol Reprod45:455-465 (1991)).Found that in all reduction division and mitotic cell MPF and MAPK are active and the highest in mid-term, these high-contents have also been induced in mammal ovocyte and have been stopped at II in mid-term.Activate by insemination or with Calcium ionophore and to reduce MPF and MAPK and finish reduction division, second polar body emission, sperm nucleus to separate and coagulate and signal that pronucleus forms.

NEBD and PCC to donor chromatinic direct effect depend on cell cycle of donor nuclei when transplanting.Diploid G ₀/ G ₁Nuclear is condensed into the simple stain monomer, but tetraploid G ₂Nuclear is condensed into two chromatids.Yet the nuclear of S phase demonstrates distinctive " pulverizing " outward appearance when transplanting; PCC produces large-scale DNA and destroys.Therefore, can be with G when activating or before activating ₁Or G ₀Nuclear transplantation to the ovocyte of II in mid-term, produce correct ploidy.Second method be with nuclear transplantation to before in the ovocyte of activated S phase, in this situation, can use G ₁, G ₀Or the donorcells of S phase.Because MPF and MAPK are low; Chromatin decondensation, and the experience dna replication dna does not have PCC and NEBD.

In mouse, reported the third synchronization scheme, wherein rebuild the growth that produces offspring alive, used G by the embryo ₂Or mid-term donorcells and ovocyte in mid-terms 2 (Cheong, H.T. etc., the Biol Reprod 48:958-963 (1993) of stoning; Kwon, O.Y. and Kono, T., Proc Natl Acad Sci USA 93:13010-13013 (1996)).Reported from NT and rebuild extruding of polar body the embryo, caused single diploid embryo and diploid polar body (Kwon, O.Y. and Kono, T., Proc Natl Acad Sci USA 93:13010-13013 (1996)).Yet, be not reported in the formation that NT in ox, sheep or the pig enters polar body behind the stoning MII ovocyte, between the prompting species the mechanics control of complete spindle body form and the extruding of polar body in difference.

Proposed the donorcells and the stage in recipient cell cycle for for donorcells nuclear reprogramming degree also be important.Time between transplanting of increase donor nuclei and zygote are transcribed can promote nuclear reprogramming.For this reason, several authors activated ovocyte (Cibelli, J.B. etc., Science 280:1256-1258 (1998)) in several hours after fusion; Wakayama, T. etc., Nature394:369-374 (1998); Wells, D.N. etc., Biol Reprod 60:996-1005 (1999)).Other report has been used order core transplanting (Stice, S.L. and Keefer, C.L., Biol Reprod 48:715-719 (1993)).

The method of not investigating that increases the donor nuclei reprogramming time is by nuclear transplantation before interval II.Break at germinal vesicle after (GVBD), the substance by ovocyte kytoplasm MPF and MAPK increases regulates and control all nuclear events, and it has prevented the reconstruction of nuclear envelope and has entered the S phase until insemination or activate.Therefore, mature oocyte can be to be used for interval or G ₂The crf receptor of donorcells.If activate and before cell fission, induced the S phase, even G ₁Or G ₀Also can be used as donorcells.

Work as G ₂Or the blastomere of M is when the donorcells, and nuclear reprogramming is possible (Cheong, H.T. etc., Biol Reprod 48:958-963 (1993); Kwon, O.Y. and Kono, T., Proc Natl Acad Sci USA 93:13010-13013 (1996); Li, L. etc., Mol Reprod Dev 47:255-264 (1997)).A kind of explanation be as the spissated result permutation of karyomit(e) some factors in the chromatin.In fact, for nuclear transplantation, thought that NEBD and PCC are the morphology signs of nuclear reprogramming.In addition, staining of sperm matter is extremely concentrated during insemination, and the volume of its volume ratio somatic cell nuclear is much smaller, and ovocyte has the proteic ability of the sperm nucleus of removing.In the process that sperm-ovocyte merges, ovocyte karyomit(e) also is concentrated.May be that spissated chromatin conformation has some biological associations.Thereby, transplant this situation of simulation by metaphase nucleus, the acceptor of stoning in mid-term can improve NT result.Yet a few studies person has used this method and has used blastomere as donorcells (Liu, L. is etc., Mol Reprod Dev447:255-264 (1997)) in domestic animal.

An object of the present invention is to characterize existing body-cell neucleus transplanting and it is modified into the reliable and economic technology that is used for producing from the adult donorcells the upward identical ox of heredity meticulously.

Summary of the invention

The present invention relates to the non-human transgenic Mammals, it is characterized in that in its milk, producing recombinant human growth hormone with beyond thought high level.Recombinant human growth hormone can be, but be not limited to human growth hormone.The non-human transgenic Mammals can be, but be not limited to the animal of ox species.

The plasmid that provides target protein to express in Mammals breast cell is provided, wherein expresses the regulation and control that are subjected to the β casein promoter.Target protein can be, but be not limited to human growth hormone.

The invention still further relates to and be manufactured on the mammiferous different methods of non-human transgenic that produces recombinant human growth hormone in its milk.Recombinant human growth hormone can be, but be not limited to human growth hormone.The non-human transgenic Mammals can be, but be not limited to the animal of ox species.

The invention still further relates to the proteic method of productive target, comprise being manufactured in its milk producing described proteic non-human transgenic Mammals, obtain described milk and the described protein of purifying from milk from described non-human transgenic Mammals.Target protein can be, but be not limited to human growth hormone.The non-human transgenic Mammals can be, but be not limited to the animal of ox species.

The invention still further relates to from transgenic mammal milk and to produce and the method for purification of Recombinant tethelin.Recombinant human growth hormone can be, but is not limited to, people's hormone of growing up.The non-human transgenic Mammals can be, but be not limited to the animal of ox species.

Description of drawings

Figure 1A-1B has shown the volume of suckling from the every day that the transgenosis milk cow is collected, this transgenosis milk cow is by merging non-nucleus egg mother cell and obtain with the inoblast of plasmid transfection before, the gene that this plasmid contains the human growth hormone (hGH) of encoding with instruct it to express promotor to mammary cell.

Fig. 2 A-2C has shown the bacterial count of finding from the milk that identical transgenosis milk cow is collected.

Fig. 3 A-3B has shown the biological activity of the hGH that contains in the milk of identical transgenosis milk cow.

Fig. 4 A has shown quality every day of the hGH that produces in the milk of identical transgenosis milk cow.This value and from the every day that the transgenosis milk cow is collected the volume of suckling map together the presentation graphs 4B.

Fig. 5 A has shown the hGH in the serum of identical transgenosis milk cow and the concentration of type-1 insulin like growth factor (IGF-1), with quality every day of the hGH that produces in the milk of identical transgenosis milk cow.Quality every day of the hGH that produces in the milk with hGH concentration in the serum of transgenosis milk cow and transgenosis milk cow is mapped together and is shown among Fig. 5 B.In Fig. 5 C, the hGH of transgenosis milk cow and the temporal characteristics of IGF-1 serum-concentration are mapped together.

Fig. 6 A and 6B have shown the serum-concentration of hGH and type-1 insulin like growth factor (IGF-1) in two transgenosis calves that obtain by the subclone that produces the transgenosis milk cow of hGH in its milk.In Fig. 6 C and 6D, the hGH of each and the temporal characteristics of IGF-1 serum-concentration in these transgenosis calves are mapped together.

Detailed Description Of The Invention

The present invention relates to the non-human transgenic Mammals, it is characterized in that in its milk, producing recombinant human growth hormone with beyond thought high level.This Mammals can be, but be not limited to the animal of ox species.Other species of transgene mammal can be, but be not limited to pig species, sheep species, goat species or rodent species.

Recombinant human growth hormone can be, but be not limited to human growth hormone.This molecule is also referred to as somatotropin, is the protein that is made of 191 amino acid, has the molecular weight of about 22kD.It is necessary for linear growth and its application has obtained setting up well.

The invention still further relates to transgenic animal, it is characterized in that for the fact of animal's mammary gland that produced recombinant human growth hormone self-stimulation that the milk that more contains described hormone produces in its milk.

The invention still further relates to plasmid, this plasmid comprises the gene of the coding target protein that is operably connected to β casein promoter and beta lactamase gene.This target protein can be, but be not limited to human growth hormone.This plasmid can be pR β hGH.

Further in the embodiment, plasmid comprises that in addition neomycin resistance gene is used for the selection of Geneticin resistant cell.The example of plasmid is pRNeo like this.

Further in the embodiment, plasmid comprises the gene of encoding green fluorescent protein such as GFP, and it is under the control of cytomegalovirus (CMV) promotor.The example of plasmid is pRNeoGreen like this.

The invention further relates to plasmid such as above-mentioned those, it is the linearizing by restriction enzyme digestion.Especially, use restriction enzyme ApaLI and excise the beta lactamase gene.

Carrying out the preservation program of above-mentioned plasmid according to budapest treaty.The title of depositary institution and address are DSMZ-Deutsche Sammlung von Mikroorganismen undZellkulturen GmbH (German microbial preservation center), Mas cheroder Weg 1b, 38124Braunschweig, Germany.To provide corresponding preserving number in due course.

The invention further relates to the plasmid that makes up based on the plasmid that contains the Neo resistant gene, wherein inserted the short β casein promoter district of modifying, as pVE β cashGH at the hGH upstream of coding region.Can obtain linear fragment from plasmid pVE β cashGH by excision beta lactamase gene.

The invention further relates to the method that is used for the genetic constructs transfection, be used for the combination of the cation lipid of liposome application.

The method of selecting the neomycin resistance cell in suitable culture medium has also been described, as selecting the method for green fluorescence transgenic cell.Select these cells carefully, make and avoid cell injury.

The invention still further relates to and to stop at G ₀Or the method for the nuclear transplantation of cell cycle different time to the stoning bovine oocyte.

The present invention relates to transgenic embryos is migrated to method in the milk cattle uterus of hormonal stimulation.

According to the present invention, the method for measuring the animal health parameter is disclosed.In order to measure these parameters, both analyze to the serum of animal and milk.

The invention further relates to the mammiferous method of non-human transgenic of making, comprise the gene that obtains coding tethelin, gene clone is advanced in the plasmid, whereby gene be may be operably coupled to and instruct gene expression promoter in mammary cell, form expression plasmid, make plasmid be incorporated in the genome of cell with this expression plasmid transfection somatocyte, form the transgenosis somatocyte, with the mature oocyte stoning, form non-nucleus egg mother cell, a transgenosis somatocyte and non-nucleus egg mother cell are merged the unicellular embryo of formation, the embryo is implanted in the mammiferous uterus of acceptor, and the conceived birth until transgene mammal of monitoring.

The invention further relates to the mammiferous method of non-human transgenic of making, comprise and from female mammal, extract somatocyte, it randomly is inoblast, this Mammals is genetically modified to produce recombinant human growth hormone in its milk, with the mature oocyte stoning, form non-nucleus egg mother cell, a transgenosis somatocyte and non-nucleus egg mother cell are merged the unicellular embryo of formation, the embryo is implanted in the mammiferous uterus of acceptor, and the conceived birth until transgene mammal of monitoring.

The invention further relates to the mammiferous method of non-human transgenic of making, comprise and make the super ovulation of female non-human mammal, this Mammals is genetically modified to produce recombinant human growth hormone in its milk, use the sperm artificial insemination that obtains from male inhuman non-transgenic Mammals to produce the embryo this Mammals, collect the embryo, the embryo is implanted in the mammiferous uterus of acceptor, and the conceived birth until transgene mammal of monitoring.

The invention further relates to the mammiferous method of non-human transgenic of making, comprise and make the super ovulation of female non-human mammal, this Mammals is genetically modified to produce recombinant human growth hormone in its milk, use the sperm artificial insemination that obtains from male non-human mammal to produce the embryo this Mammals, the Mammals that therefrom obtains sperm is genetically modified to produce recombinant human growth hormone, collect the embryo, the embryo is implanted in the mammiferous uterus of acceptor, and the conceived birth until transgene mammal of monitoring.

The invention further relates to the mammiferous method of non-human transgenic of making, comprise and make the super ovulation of female inhuman non-transgenic Mammals, use the sperm artificial insemination that obtains from male non-human mammal to produce the embryo this Mammals, the Mammals that therefrom obtains sperm is genetically modified to produce recombinant human growth hormone, collect the embryo, the embryo is implanted in the mammiferous uterus of acceptor, and the conceived birth until transgene mammal of monitoring.

Recombinant human growth hormone can be, but be not limited to human growth hormone.The non-human transgenic Mammals can be, but be not limited to the animal of ox species.

The invention further relates to the production method of protein, comprise being manufactured on the non-human transgenic Mammals that produces target protein in its milk with beyond thought high yield, obtain milk from this non-human transgenic Mammals, and from milk purification of target albumen.

The invention still further relates to the proteic method of productive target in the non-human transgenic Mammals, this Mammals is to make by the method that may further comprise the steps: the gene that obtains the described target protein of coding, gene clone is advanced in the plasmid, whereby gene be may be operably coupled to and instruct gene expression promoter in mammary cell, form expression plasmid, with expression plasmid transfection somatocyte, it randomly is inoblast, make plasmid be incorporated in the described somatic genome, form the transgenosis somatocyte, with the mature oocyte stoning, form non-nucleus egg mother cell, a transgenosis somatocyte and non-nucleus egg mother cell are merged the unicellular embryo of formation, the embryo is implanted in the mammiferous uterus of acceptor, and the conceived birth until transgene mammal of monitoring.

The invention still further relates to the proteic method of productive target in the non-human transgenic Mammals, this Mammals makes by the method that may further comprise the steps: extract somatocyte from female mammal, it randomly is inoblast, this Mammals is genetically modified to produce in its milk, with sophisticated ovocyte stoning, form non-nucleus egg mother cell, a transgenosis somatocyte and non-nucleus egg mother cell are merged the unicellular embryo of formation, the embryo is implanted in the mammiferous uterus of acceptor, and the conceived birth until transgene mammal of monitoring.

The invention still further relates to the proteic method of productive target in the non-human transgenic Mammals, this Mammals makes by the method that may further comprise the steps: make the super ovulation of female non-human mammal, this Mammals is genetically modified to produce described target protein in its milk, use the sperm artificial insemination that obtains from male inhuman non-transgenic Mammals to produce the embryo this Mammals, collect the embryo, the embryo is implanted in the mammiferous uterus of acceptor, and the conceived birth until transgene mammal of monitoring.

The invention still further relates to the proteic method of productive target in the non-human transgenic Mammals, this Mammals makes by the method that may further comprise the steps: make the super ovulation of female non-human mammal, this Mammals is genetically modified to produce described target protein in its milk, use the sperm artificial insemination that obtains from male non-human mammal to produce the embryo this Mammals, the Mammals that therefrom obtains sperm is genetically modified to produce described target protein, collect the embryo, the embryo is implanted in the mammiferous uterus of acceptor, and the conceived birth until transgene mammal of monitoring.

The invention still further relates to the proteic method of productive target in the non-human transgenic Mammals, this Mammals makes by the method that may further comprise the steps: make the super ovulation of female inhuman non-transgenic Mammals, use the sperm artificial insemination that obtains from male non-human mammal to produce the embryo this Mammals, the Mammals that therefrom obtains sperm is genetically modified to produce described target protein, collect the embryo, the embryo is implanted in the mammiferous uterus of acceptor, and the conceived birth until transgene mammal of monitoring.

It is characterized in that the transgene mammal that produces target protein with beyond thought high level in its milk can be, but be not limited to the animal of ox species.Other species of transgene mammal can be, but be not limited to pig species, sheep species, goat species or rodent animal.Target protein can be, but be not limited to human growth hormone.

The invention further relates to the non-human transgenic Mammals that in its milk, produces recombinant human somatropin's ox species, its genome comprises the plasmid of integration, the β casein promoter that described plasmid comprises human growth hormone gene and instructs described gene to express in mammiferous mammary cell.

The invention further relates to beyond thought high level and produce the transgene mammal of hGH, but do not have to show with the desired self-sow of high-caliber like this hGH generation.Because transgenic cattle is subjected to the influence that human growth hormone exists, the expection growth of animal will be above not genetically modified growth velocity, and ill as diabetes, hypertension, the risk of cardiovascular disorder raising and the expansion of body member, comprise liver, spleen, kidney and heart.In theory, high-load like this hGH should make animal not survive.Yet situation is really not so.Mammals as milk cow, contains alarming high-caliber exogenous hormone in its blood, but it is fully healthy and produce significant recombinant protein productivity, constitutes contribution beyond thought and that innovate.

Recombinant human somatropin of the present invention produces with beyond thought high level.The content of the human growth hormone that is produced is higher than about 1.0g/L milk.The content of hGH can be higher than about 2.0g/L milk.The content of the hGH that is produced can also be higher than about 3.0g/L milk.In another embodiment, the content of the hGH that is produced can be higher than about 4.0g/L milk.Still in another embodiment, the hGH content that is produced can be higher than about 5.0g/L milk.Further in the embodiment, the hGH content that is produced can be higher than about 6.0g/L milk.Still in the further embodiment, the hGH content that is produced is the extremely about 7.0g/L milk of about 1.0g/L milk.Further in the embodiment, the hGH content that is produced is the extremely about 6.0g/L milk of about 2.0g/L milk.Still in another embodiment, the hGH content that is produced is the extremely about 5.0g/L milk of about 2.0g/L milk.

In addition, the present invention relates to the method for purification of Recombinant tethelin from the milk of transgene mammal, and the assay method of described hormone.Purification process can comprise chromatogram and enrichment step.Dissimilar chromatograms be can use, ion-exchange chromatography, reverse-phase chromatography, molecular-exclusion chromatography or affinity chromatography comprised.Ion-exchange chromatography can be an anion-exchange chromatography.Affinity chromatography can be an immune affinity chromatographic.In addition, can carry out a plurality of chromatographic steps.

The invention further relates to the method for purification of Recombinant tethelin from the mammiferous milk of non-human transgenic that produces recombinant human growth hormone, comprise mammiferous milk clarification with the non-human transgenic, obtain clarifying milk, and clarifying milk is carried out chromatogram, obtain the recombinant human growth hormone of purifying.

The invention further relates to the method for purification of Recombinant tethelin from the mammiferous milk of non-human transgenic that produces recombinant human growth hormone, comprise mammiferous milk clarification with the non-human transgenic, obtain clarifying milk, and clarifying milk carried out the expanded bed anion-exchange chromatography, obtain the material that anion-exchange chromatography is crossed, the material that anion-exchange chromatography is crossed carries out reverse-phase chromatography, obtain the material that reverse-phase chromatography is crossed, the material that reverse-phase chromatography is crossed carries out anion-exchange chromatography, obtain the material that anion-exchange chromatography is crossed, the material that anion chromatographic was exchanged carries out molecular-exclusion chromatography, obtain the material that molecular-exclusion chromatography is crossed, the material that molecular-exclusion chromatography is crossed concentrates, and obtains spissated material, and spissated material carried out molecular-exclusion chromatography, obtain pure recombinant human growth hormone.

The invention still further relates to the method for purification of Recombinant tethelin from the mammiferous milk of non-human transgenic that produces recombinant human growth hormone, comprise mammiferous milk clarification with the non-human transgenic, obtain clarifying milk, and clarifying milk carried out immune affinity chromatographic, obtain the material that immune affinity chromatographic is crossed, the material that immune affinity chromatographic is crossed carries out reverse-phase chromatography, obtain the material that reverse-phase chromatography is crossed, the raw material that reverse-phase chromatography is crossed carries out anion-exchange chromatography, obtain the material that anion-exchange chromatography is crossed, the material that anion-exchange chromatography is crossed carries out molecular-exclusion chromatography, obtain the material that molecular-exclusion chromatography is crossed, the material that molecular-exclusion chromatography is crossed concentrates, and obtains spissated material, and spissated material carried out molecular-exclusion chromatography, obtain pure recombinant human growth hormone.

The recombinant human growth hormone of above-mentioned purification process can be, but be not limited to human growth hormone.Transgenic animal can be, but be not limited to the Mammals of ox species.

Embodiment

Following examples are explanations of the inventive method and composition, rather than restriction.The various conditions that in the enzyme production of chemical substance and method of purifying protein, run into usually and the conspicuous modification of other suitable those skilled in the art of parameter and improve within the spirit and scope of the present invention.

Embodiment 1

The structure of expression plasmid

We have produced the construct that has most of ox β promotor of casein gene, comprise the short-movie section in 5 '-non-coding β casein gene district, with the encoding sequence fusion of human growth hormone gene.Used β casein district is decreased to about 1.3kbp from 3.8kbp in the different constructs.According to whether comprising intrinsic poly a-signal, the hGH gene comprises about 2 to 2.2kbp.

In the polylinker of the common cloning vector of pUC or pBS type, hold expression cassette.

This promotor is guaranteed the tissue specificity of gene and is grown regulated expression under its control, as the allos hGH in β casein and this situation.

The most representative plasmid is pR β hGH, and it carries total length ox β casein promoter, with the encoding sequence fusion of human growth hormone gene.

Disclosed other construct mainly is derived from primary construct as described, improves the selection of transfectional cell or the integration efficiency that DNA enters the ox cellular genome.

In fs, carry out cotransfection with the plasmid that contains the Geneticin resistant gene and help select, but then, use other construct, in the same vehicle that contains the hGH expression cassette, have the NPT gene that is used for neomycin resistance.The example of plasmid is pRNeo like this.

Acquisition is used for the another kind of plasmid of constitutive expression green fluorescent protein, and it comprises the CMV promotor, the enhanser of plant origin (clover) and from the green fluorescence protein gene of jellyfish A.victoria.The example of plasmid is pRNeoGreen like this.

In addition, produced another kind of plasmid.This is based on, and the plasmid that contains the Neo resistant gene makes up, and wherein inserted the short β casein promoter district of modifying at the hGH upstream of coding region.This plasmid is pVE β cashGH.

Produced other construct, wherein by the ApaLI restriction enzyme digestion except the beta lactamase district, and purifying contains the linear fragment of expressed intact box after agarose gel electrophoresis and gel extraction.

Analyze construct by restriction enzyme and dna sequencing, and they carry out the ability that hGH expresses by fluorescence antibody identification test in cell line of mammary gland in advance.

To describe the preparation of plasmid pVE β cashGH in detail as relating to this part example of genetic constructs.

The preparation of pVE β cashGH

The purpose of this construct provides the minimum in β casein promoter district extends to instruct the hGH gene of downstream immediate fusion, transcribes with the specific adjustable type of its polyA signal in host living beings.

Use pVEX to allow to use neomycin resistance gene by the t k promoter regulation in this plasmid Already in as initial carrier.Eliminate the early stage SV40 promotor that comprises 554bp by limiting with StuI and NdeI, last site is filled up with Klenow, and the oneself connects resulting carrier.

Obtain the short promotor of β casein after the 1.3kbp fragment of pcr amplification from 3.8kbp original gene promoter region, used following oligomer as primer:

PB1 5’TCTACTCGAGGATCATCTATCTGTCCCAAAG(SEQ ID NO：1)

With

PB2 5’CTAGGATCCAATGATCTGATTTTGTGG(SEQ ID NO：2)

This fragment comprises that the standard promotor of 1230bp adds first non-coding exon of the β casein gene of 49bp.

Obtained the hGH gene fragment by round pcr,, used following oligomer as primer based on primary cow genome group hGH clone:

PB4 5’CTAGGATCCATGGCTACAGGTAAGCGCC(SEQ ID NO：3)

With

GHTE 5’ATGCTGTGTCTGGACGTCCT(SEQ ID NO：4)。

The site that BamH I with the Klenow enzyme that β casein promoter fragment is truncate and insertion pVEX fills up.After selecting recombinant clone, we select to be suitable for using the certain party in the unique HindIII site that is positioned at the pVEX downstream always to insert the hGH coding region.

For this reason, with the hGH fragment also truncate and filled up plasmid HindIII site.Feasible of the clone that selection contains β casein promoter and the appropriate hGH that merges expresses hGH under the control of this promotor.

The size of this plasmid is about 8.5kbp.

Somatic transfection

Then plasmid pR β hGH (having the plasmid of Geneticin resistant gene with another), pRNeo, pRNeoGreen or pVE β cashGH are used for the somatic primary culture of transfection, use calcium phosphate or liposome method.Usually use tire ox inoblast to treat transfection.

Geneticin added select cells transfected in the culture.After 2 to 8 weeks, the cell that Geneticin is had a resistance is suitable for use as donorcells and obtains transgene clone.Selected cell by the pcr analysis transfection contains expression cassette, produces transgenic embryos to guarantee suitable nuclear transplantation.

Embodiment 2

Metaphase nucleus in the stoning of ovocyte and the ripe enucleation oocyte is transplanted

The collection of bovine oocyte and maturation in vitro

From the ovary of slaughterhouse the ovocyte of sucking-off ox and in TCM-199+5%FCS in 39 ℃ of maturations 24 hours.Use CO before use ₂Balance maturation medium at least 2 hours.Made sophisticated ovocyte exposed in 2 minutes at the warm TL-HEPES mesoscale eddies that contains 1mg/ml bull testis Unidasa.

Use cumulus cell to carry out nuclear transplantation

Stoning

Use Narishige hydraulic pressure micromanipulator and Nikon Diaphot microscope with the stoning of ovocyte machinery.The suction pipe with fining away with 20 μ m oblique angles carries out stoning.Use the bisbenzimidine of 5 μ g/ml (Hoechst 33342 before ¹) dyestuff is ovocyte dyeing 20 minutes.The karyomit(e) that is colored by observation under ultraviolet ray is with the stoning in mid-term.Suction back assessment Metaphase Chromosome within suction pipe.Migrate in the ovum week crack transgenosis somatocyte also strictly relative with non-nucleus egg mother cell.

Merge

Manual-alignment in merging the chamber makes that film to be merged is parallel to electrode with transgenosis somatocyte and non-nucleus egg mother cell.Use the embryo operation suction pipe of glass to carry out.

Merge by electric mode

Use the electricimpulse of 180 volts/cm to merge 15 μ s (BTX ElectroCell Manipulator 200) ²And monitor with BTX Optimizer-Graphic Pulse Analyzer.The chamber that is used for the pulse embryo is positioned over the Stainless Steel Wire electrode of two 0.5mm on the microslide of glass and forms by the 0.5mm of being separated by.Fusion, molten born of the same parents and the fracture of monitoring supposition zygote.

The assessment of developmental potency

Estimated the fracture of zygote in back 48 hours and develop into morula or blastocyst in insemination postevaluation in 7 to 9 days.

¹Sigma Chemical Co.，St.Louis，MO，USA

²BTX Inc.，San Diego，Ca，USA

Embodiment 3

Cell and embryo culture

Different donorcells, culture systems and the ovocyte acceptors of test handled the survival rate that purpose is to simplify the method in the Niu Kelong program and improves the embryo in experiment.When the adult inoblast is used as donorcells, used three kinds of culture systems: TCM-199+5%FCS that rebuild the embryo, Menezo+5%FCS (both is contained the VERO cell as coculture) and no coculture still have low O ₂The SOF of concentration.When donorcells is the fetal fibroblast of modifying in upward hereditary and the non-heredity, also the SOF substratum is used to cultivate the embryo of reconstruction.At last, when the fetal fibroblast of modifying in the heredity is used as donorcells, use roscovitine (R) to handle the suitability that the acceptor ovocyte is ended reduction division and optimizing acceptor before.From the ovary of slaughterhouse the sucking-off ovocyte and in TCM-199+5%FCS in 39 ℃ of maturations 24 hours.The group of handling for R, before maturation, in TCM-199+5%FCS with ovocyte and 25 μ M R 39 ℃ of incubations 24 hours.Made sophisticated ovocyte exposed in 3 minutes containing the hyaluronic TL HEPES of 1mg/ml bull testis mesoscale eddies.Assessment mid-term and under ultraviolet ray (＜6 seconds) by observing the ovocyte stoning with Hoechst 33342 (5 μ g/ml).Will from the adult fibroblast of Augus bull and from the fetal fibroblast of the female fetus of 45 the biggest Jersey as donorcells.Use the liposome transfection of the construct that contains neomycin resistance gene.After selecting 10-15 days with Geneticin, by electricimpulse with G ₀/ G ₁The donorcells of phase and non-nucleus egg mother cell merge.After 3 hours, induced activation in 3 hours by in TL-HEPES, hatching 4 minutes and hatching with 2mM 6-DMAP with 5 μ M ionomycins.Then with TL-HEPES washing ovocyte and in the TCM-199+5%FCS+10g/l white protein or in Menezo+2%FCS (both is contained the VERO cell), or at SOF substratum and 5%CO ₂+ 5%O ₂+ 90%N ₂In cultivate altogether.Usually, two blastocysts are transplanted on each acceptor milk cow non-surgery operation ground, and measure conceived at 30-35 days by ultrasonic wave.The record spilting of an egg (48 hours), develop into blastocyst (the 7th to 9 day) and analyze by Chi-square.When in SOF, cultivating the embryo, spilting of an egg rate and to develop into blastocyst higher.Yet, do not observe because the difference of the pregnancy rate in different culture condition or donorcells source.End the ripe developmental potency of not damaging the acceptor ovocyte in 24 hours of reduction division.Therefore, handle the validity of the ovocyte can be used for improving the NT method with roscovitine.Referring to following table 1.

Table 1

Handle	n	The spilting of an egg (%)	Blastocyst (%)	The acceptor of implanting	Conceived (%)
						The fetal fibroblast SOF-R that the fetal fibroblast SOF Zhuan that adult fibroblast TC199+VERO adult fibroblast Menezo+VERO adult fibroblast SOF fetal fibroblast SOF Zhuan dyes dyes	294 324 108 197 646 228	156(53.9) a 236(72.3) bc 81(75.0) bc 122(61.9) ab 476(73.7) bc 191(83.7) c	22(7.5) a 29(8.9) a 24(22.2) b 33(16.7) ab 128(19.8) b 51(22.3) b	13 17 11 16 56 30	5(38.4) 5(29.4) 5(45.4) 5(31.6) 25(44.6) 16(53.5)
Amount to	1797	1262(70.2)	287(15.9)	143	61(44.5)

Having different upward target percentage ratios in the hurdle is discrepant (P＜0.05).

Make the milk cow of implantation normally pass through conceived until spontaneous labor.At last, chirurgic method (Caesarea) can be used for childbirth.During 48 hours, be rich in the colostrum of Ig, use synthetic then, natural afterwards food (all do not contain the compound of animal-origin) to neonatal feeding.

Embodiment 4

The test that transgenosis calf and the recombinant protein that produced are carried out

Among this embodiment, we have presented the complete description that the recombinant protein of specific transgenosis calf and generation thereof is tested, and this transgenosis calf obtains as the result of method described in the embodiment 1 to 3.However, need be clear that to obtaining transgenosis calf method as other result of those methods described in following examples 5 and the 6 and animal that is born has carried out same set of mensuration.

Carry out the PCR reaction by the DNA that purifying from little bovine leukocyte is obtained, the DNA that uses non-transgenic jersey calf has proved to comprise ox β casein promoter and hGH encoding gene in the genome of transgenosis calf cell as negative contrast.The unique DNA fragment that can be used as the homology β casein gene that is different from animal is found them together.

Use the Pharmacia automatic sequencer, the gene order 100% that has confirmed to insert is corresponding to the hGH encoding gene.It comprises intron, secretion signal and terminator.The ox β casein promoter that is controlled at identical hGH genetic expression in our calf is also checked order.The all that element is accurately consistent with the theoretical sequence of its expection, and this theory sequence has produced the clone from the genetic constructs that is used for transformant from this cell.

In case the known exactness that should test the heredity stage, the recombinant protein that we just turn to proof and are produced is desired and all consistent with natural hGH at each physics and chemical characteristics.

For this reason, we have to obtain milk from calf, owing to be in when giving milk the time when animal, the β casein promoter makes recombinant protein express in mammary gland.

Give milk when inducing the transgenosis calf to make it by HORMONE TREATMENT then by full ten months.To that time calf be weighed as 240kg (about 530lbs).

The fs of described processing comprises by subcutaneous route, unites to give oestrogenic hormon (estradiol benzoate, Histeren ^, Instituto Rosenbusch) and progestogen (Zytron acetic ester, Pronal ^, Aton), comprising every kind of medicine of 5 continuous application, dosage is respectively 0.1mg/kg and 0.25mg/kg, per 48 hours (that is, the 1st, 3,5,7 and 9 day, supposing to handle to start from first day).

Second stage comprises by subcutaneous route, give dexamethasone (Decadron, Sidus) and pitocin (Orasthin ^, Hoechst Marion Roussel); With total amount is that the former of 20mg injects (every day be described total amount 1/3rd) in the 18th to 20 day time period, and the latter who used three 50IU at the 21st to 23 day.

Above-mentioned information summary is in table 2:

Table 2

Fate	1	2	3	4	5	6	7	8	9	10	(...)	17	18	19	20	21	22	23
																			Histeren, (mg/kg) Pronal, (mg/kg) dexamethasone, (mg) oxytocin, (IU)	0.10 0.25		0.10 0.25		0.10 0.25		0.10 0.25		0.10 0.25				6.66*	6.66*	6.66*	50	50	50

* give about 1/3rd of total amount (20mg) every day

As expected, finish the back milk cow in processing and begin to produce colostrum, produce the fluidic quality then and become milk gradually.The fluid of collecting is suitably preserved and analyzed up hill and dale.

Colostrum and milk (in order to simplify, colostrum and milk all are called " milk " hereinafter, except when should distinguish time) have been carried out several tests, and it the results are shown among Fig. 1-4.At first, measure the volume of collected milk.The milk productivity (five lactation days) of beginning is about 1,650mL/ days.Give milk the middle of the month at first, carry out twice manual milking every day,, (can note of the contribution of each breast) once in the afternoon final volume once in the morning; And,, carry out milk for three times (in the morning, noon and afternoon) every day because the generation of milk begins to increase from the second month.The volume of every day increases with continuous mode more or less, milks to reach in back three months until head and approaches 10,000mL.In suckling the curve (Figure 1B) of volume every day, can observe details (Figure 1A) about this theme to the date.

Parallel with the measurement of milk volume, milk has been carried out microbiological assay, its result (Fig. 2 A) is shown in the response curve of every ml CFU (colony-forming unit) to the date (Fig. 2 B-2C).

Also assessed (hGH's) biological activity (Fig. 3 A-3B) by the external biological determination of activity in the NB2 cell culture.The biological activity that has proved the reorganization hGH that produces in the milk of heifer is in the normal value of the natural hGH of people in mother's grade of errors.In addition, studied the milk that is obtained, detected wherein main band, corresponding to complete hGH by western blotting.Also found other minor band, as desired in these production systems corresponding to fracture variant and aggregate.

Utilization about biological activity and every day volume information, can use formula 1 to calculate the day output of hGH, wherein mhGH is the hGH quality that produces the every day in milligram; BA, the biological activity of representing with international unit; SA, the specific activity of hGH (3IU/mg); And V, collect the volume of milk every day.Data presentation is in Fig. 4 A.The curve display of hGH quality every day is in Fig. 4 B.In order to set up hGH quality every day and the intuitive correlation between the volume of suckling every day, also latter's mapping is shown among Fig. 4 B.

$m_{\mathrm{hGH}}=\frac{\mathrm{BA}}{\mathrm{SA}\×V}$ (formula 1)

Can observe from this information, in the milk hGH every day quality and the volume of suckling every day along with the growth of milk cow is tending towards increasing (although the former is with bigger ratio), it constitutes the ascendant trend of recombinant hormone productivity (every liter hGH gram number in milk).Can notice that the approximately every liter 2g hGH (head milks) of this productivity when product is colostrum is to the mean vol from every liter of milk 5g hGH of second lactation moon.Therefore, along with the raising of productivity has obtained the human growth hormone of unexpected high yield, along with the fluidic quality becomes milk in successive mode more or less from colostrum.

Although the hGH quality that produces every day is quite significant at present, should be noted that because also not growth fully of milk cow, the quality ascendant trend of the recombinant protein that produce every day should be able to be continuing in the future, until reaching maximum value.

When milk is tested, the serum of milk cow has been carried out the different mensuration of a cover, it the results are shown among Fig. 5 A-5C.At first, carry out the measurement of hGH concentration in the cow serum.Quality every day of result (Fig. 5 A) hGH in milk is made curve in figure, make and to compare two values (Fig. 5 B).

The term of reference of GH is 0.06-5ng/ml in (people) serum.Suppose for ox it is the similar scope of hypothesis, can notice that during except beginning, hGH surpasses the upper limit of described scope fully in the transgenosis cow serum to the entire curve on date.Although should the fact, although must consider aminoacid sequence and 3D-structure for them, hGH and corresponding ox hormone (bGH) be closely similar, and the former although be full functionality, is not active fully in ox.

Therefore, in order to assess owing to these high-load hGH in its serum have carried out the measurement (Fig. 5 A) of IGF-1 (type-1 insulin like growth factor is also referred to as somatomedin C) serum-concentration simultaneously to the potential risk of milk cow health.Tethelin is mainly carried out its function by the IGF-1 that forms in liver.Because IGF-1 mediates the metabolism of many cells in vivo divisions and tethelin, the Indirect evaluation that the IGF-1 assessment is lacked of proper care for suspicious tethelin is valuable diagnostic tool.Therefore, IGF-1 represents the reliable indicator of biological available production hormone.The result of these analyses is shown among Fig. 5 C with the result corresponding to hGH, can observe two values simultaneously.

Therefore in addition, in order to have control group and to set up and comparison, IGF-1 and hGH in the non-transgenic milk cow group serum have been measured corresponding to transgenosis milk cow data.The mean value of measuring for two kinds of protein of non-transgenic group and transgenosis milk cow is shown in the following table 3.

Table 3

	Mean value
			[IGF-1] in the serum	[hGH] in the serum
	Not genetically modified	123.40			0.28
Genetically modified			484.02	656.98

Average serum concentration that it should be noted that hGH in the non-transgenic group is positioned at the hypothetical reference scope, and the mean value of transgenosis milk cow surpasses the upper limit of described scope fully.In addition, the IGF-1 average content that unquestionable is in the transgenic animal serum definitely is higher than corresponding to the non-transgenic milk cow, and it constitutes basic difference.

Therefore, although (known its causes having the disease of serious consequence to the high density of hGH in the transgenosis cow serum in the people, as diabetes, hypertension, the risk of cardiovascular disorder raising and the expansion of body member, comprise liver, spleen, kidney and heart) will make animal not survive in theory, this can not represent significantly to its healthy and maintain a good state obstacle.In its blood, have astonishing high-load exogenous hormone, but its healthy fully milk cow that also produces the recombinant protein of outstanding output constitutes contribution beyond thought and that innovate.

The aspect of another innovation of the present invention is the reorganization hGH that enters in the milk cow blood flow, stimulates mammary gland to produce more milk.This effect is secondhand, that is, and and by the effect of IGF-1.This molecule has improved the blood flow by mammary gland, and the key precursor material that is used for synthetic butterfat, protein and lactose is provided.Therefore, IGF-1 play a part to instruct nutrition by blood flow to mammary cell, their help to produce milk in breast.Therefore, obtained self-excited animal, promoted continuing to increase of milk volume that animal produces, the correspondingly more hGH of secretion in its milk because the reorganization hGH that produces in the milk of transgenosis milk cow stimulates by mammary gland.

Embodiment 5

Obtain the transgenosis calf by subclone

Use the pin of 1.5mm diameter five tissue samples of ear taking-up, the end of pin has been made the oblique angle for before this purpose from the transgenosis calf.With sample freezing laboratory that is transported in containing the substratum based on PBS of microbiotic and anti-mycotic agent.

Then, with tissue sample in containing 10% foetal calf serum and antibiotic MEM substratum at 39 ℃ and 5%CO ₂Incubation is 72 hours under the atmosphere.Finally, take out tissue sample, make dull and stereotyped fibroblastic growth on every side until adhesion.In case reach adhesion, in order to obtain them at G ₀The synchronization of phase was hatched inoblast at least 5 days and is not changed substratum, by assessing with microscopic examination.

Behind the trypsin acting, with single inoblast with merge according to the stoning bovine oocyte of embodiment 2, with the embryo that therefore obtains in the SOF substratum and 5%CO ₂+ 5%O ₂+ 90%N ₂Cultivate stage under the atmosphere until blastocyst.Then, two blastocysts are transplanted on non-surgery operation ground in each acceptor milk cow usually, and measure conceived at 30-35 days by ultrasonic wave.

The milk cow that makes implantation normally from pregnancy until spontaneous labor.Finally, can use chirurgic method (Caesarea) to give a birth.Be rich in the colostrum of Ig at 48 hours to neonatal feeding, use synthetic then, natural afterwards food (they do not contain the compound of animal-origin).

Fig. 6 A and 6B have shown the hGH of two transgenic animal that pass through the acquisition of subclone transgenosis milk cow that carry out simultaneously and the measurement of IGF-1 serum-concentration; and the result of these analyses is plotted on respectively among Fig. 6 C and the 6D, make two values can observing each animal simultaneously.Because at present calf is young, the value of hGH and IGF-1 still be positioned at separately with reference to scope, but expect they will with the same rising of transgenosis milk cow that has therefrom obtained these two clones.

Embodiment 6

By the artificial insemination of superovulated transgenosis milk cow is obtained the transgenosis calf

To openly obtain the interchangeable method of transgenic cattle among this embodiment.This method comprises by the super ovulation of HORMONE TREATMENT render transgenic milk cow; With described milk cow artificial insemination; Collect the embryo who therefore produces; Described embryo is implanted in the replace-conceive milk cow; And the conceived birth of generation until animal.Below presented the description of this method.

Super ovulation

(that is) morning, that day that method begins was by prostaglandin(PG) (D (+)-clorprostenol, the Arsaprost of intramuscular approach with 150 μ g at the 1st day ^, Arsa) deliver medicine to the transgenosis milk cow.Make the 15% proteinic meals (before the 1st day, animal has given 2kg food, contains the protein of same amount) of having an appointment containing of animals received 4kg every day.In the 8th day the morning, intravaginal was put into CIDR (controlled internal drug release) device of Progesterone.In addition, give 50mg Progesterone and estradiol by the intramuscular approach.The abundance of food of nutrition purposes, especially for feeding animals was increased to 6kg/ days, contained the protein of same amount.Then, at the 12nd, 13 and 14 day twice intramuscularly FSH and LH (PLUSET ^, Calier) (once in the morning, another time in the afternoon).Ensuing one day (the 15th day) continued administration by the intramuscular approach and handled double injection PLUSET ^(once in the morning, another time in the afternoon) and the each 150 μ g prostaglandin(PG)s (identical dosage regimen) of double injection.In the 16th day the morning, remove CIDR.The PLUSET that give the whole super onset of ovulation ^Total amount is 350IU.

Insemination

This stage comprises that three times from the sperm of donor jersey bull give (for the first time and for the second time continuously, each morning and afternoon of comfortable the 17th day, for the last time, in the 18th day the morning), obtained sperm and stored frozen to keep the viability of zoosperm before.

Collect the embryo and they are implanted in the replace-conceive milk cow

Pass through (Nutricell with 1L DMPBS in the 26th day the morning ^) two angles of flushing milk cattle uterus collect the embryo.After this at once in each acceptor milk cow non-surgery operation ground transplant two embryos, and measured conceived at 30-35 days by ultrasonic wave.

The milk cow that makes implantation normally from pregnancy until spontaneous labor.Can use chirurgic method (Caesarea) to give a birth at last.Be rich in the colostrum of Ig at 48 hours to neonatal feeding, use synthetic then, natural afterwards food (they do not contain the compound of animal-origin).

Because mendel's law is followed in biological offspring's generation, be genetically modified as half of the animal of result's birth of aforesaid method, half in these is male, and second half is female.Therefore, exist to obtain the high probability of transgenosis male (initial animal), in order to enlarge the transgenosis drove, the mother that its sperm can be used to set up jersey transgenosis sperm plants storehouse (MasterBank), is used for the insemination of superovulated transgenosis/non-transgenic milk cow.

Embodiment 7

Purification of Recombinant hGH from milk

In case the biological activity of the reorganization hGH that produces in the result of confirmation approximate molecular weight, western blotting and the milk of calf is correct, just carry out purge process completely, because when making biopharmaceutical product, have possible pollutent in described product, requisite is target protein is purified to homogeneity.This process may further comprise the steps: finally remain in the intrafascicular better solubleness of reorganization hGH (clarification) of casein glue by the skimming of centrifugal acquisition milk and with the supernatant liquor dilution that obtains to reach; And make this solution by expanded bed anion-exchange column (the interchangeable scheme of this step is to use immune affinity column, referring to following embodiment 8); Make resulting solution accept reversed-phase HPLC (C4) step; Then the fraction that is rich in reorganization hGH is carried out anion-exchange chromatography.

With the material desalination of purifying, concentrate and accept molecular-exclusion chromatography.In order to obtain pure reorganization hGH, separate by molecular weight.

The method of purification of human growth hormone (hGH) may further comprise the steps from milk, be followed successively by: (a) clarification (b) expanded bed anion-exchange chromatography, (c) reverse-phase chromatography, (d) anion-exchange chromatography, (e) molecular-exclusion chromatography (desalination) (f) concentrates and (g) molecular-exclusion chromatography.

Clarification

In order to obtain 0.5% solution, fresh milk is mixed with the tween 80 of capacity.After adding tween 80, the Tris-HCl that adds 2M obtains 7.3 ± 0.1 pH.Then, with product homogenizing 30 minutes, centrifugal under 14000g for the separating out fat layer then.Afterwards, with resulting solution with the dilution of 0.5% tween 80 until the conductivity of being less than or equal to 1500S/cm., then product is also preserved easily by the membrane filtration in 0.8 μ m hole pH regulator to 7.3 ± 0.1 with 2M Tris-HCl.

The expanded bed anion-exchange chromatography

According to following parameter, use anionresin matrix that the material that previous step obtained is carried out chromatogram:

1. equipment

A. pillar:

1) diameter: 5cm

2) height of bed: 30cm (bed of compacting)

3) matrix:

a)Streamline Q XL(Amersham)

B) volume: 600ml

2. solution and damping fluid:

A.0.5N NaOH

B.20% ethanol

C. buffer A: 20mM Tris.HCl, pH7.3

D. buffer B: 500mM Tris.HCl, pH7.3

E. damping fluid C:20mM Tris.HCl, 150mM NaCl, pH7.3

F. damping fluid D:20mM Tris.HCl, 500mM NaCl, pH7.3

3. treat the stratographic material

A. clarifying milk

B. sample condition:

1) volume: 25 ± 5L

2) conductivity :≤1500S/cm

3)pH：7.3±0.1

For the balance pillar, make 1.5 times of column volumes (" vc ") pure water (900mL) by pillar, flow velocity is 115 ± 5cm/ hour (downstream).Then, make following solution or damping fluid with amount described in detail below in order by pillar, flow velocity be 230 ± 30cm/ hour (up stream): 3.0vc (1,0.5N NaOH 800ml); 3.0vc (1, pure water 800ml); 1.0vc buffer B (600ml); At last, and 3.0vc (1, buffer A 800ml).

In case pillar has obtained balance, load and treat the stratographic material.Describedly be loaded in 12 ± 3 ℃ and carry out down and with 230 ± 30cm/ hour flow velocity.After this, with 115 ± 15cm/ hour flow velocity with under identical temperature, carry out wash-out.At first, the buffer A that makes q.s is by pillar (up stream), and next makes solution described in detail below and damping fluid with the buffer A of following order by pillar (downstream): 1.5vc (900ml); 2.0vc (1, damping fluid C 200ml); At last, and 2.0vc (1, damping fluid D 200ml).

In case finish this step,, make following solution or damping fluid pass through the pure water of pillar: 1.5vc (900ml) in order with amount described in detail below in order to clean pillar; 1.5vc 0.5N NaOH (900ml); 2.0vc (1, pure water 200ml); 1.0vc buffer B (600ml); 1.5vc pure water (900ml); At last, 20% ethanol of 1.5vc (900ml).

Measure the total protein (by the Bradford method) and the target protein (passing through RIA) of the selected hGH of containing fraction, and be stored in 2-8 ℃.

Reverse-phase chromatography

According to following parameter the material that previous step obtained is carried out chromatogram:

1. equipment

A. pillar:

1) diameter: 4cm

2) height of bed: 48cm

3) matrix:

a.BakerBond Wide-Pore Butyl(C4)15μm prep LC Packing(Baker)

B. volume: 600ml

2. solution and damping fluid:

A. mobile phase 1 (MP1): 30mM NaHCO ₃, pH7.2: pure water: acetonitrile (35: 55: 10)

B. mobile phase 2 (MP2): 30mM NaHCO ₃, pH7.2: pure water: acetonitrile (20: 10: 70)

C.50% methyl alcohol

3. treat the stratographic material

A. the aggregate of the selected fraction that obtains from previous step

B. sample condition:

1) volume: 30 ± 15L

2)pH：7.3±0.3

For the balance pillar, make following solution or damping fluid pass through pillar in order with amount described in detail below, flow velocity was less than or equal to 478cm/ hour: 0.3vc (180ml) 50% methyl alcohol; After this, use the gradient of 50% methyl alcohol-MP2, begin until reaching in 0: 100 ratio of solution described in the cumulative volume of 1.0vc (600ml) from 100: 0 ratio of described solution; In case the gradient of finishing makes the MP2 of 1.0vc (600ml) pass through pillar; After this, the gradient of utilization MP2-MP1 begins until reaching in 0: 100 ratio of solution described in the cumulative volume of 1.0vc (600ml) from 100: 0 ratio of described solution; At last, (1, MP1 200ml) passes through pillar to make 2.0vc.

In case pillar has obtained balance, make and treat the membrane filtration of stratographic material by 0.45 μ m hole, after this load immediately.Describedly be loaded in 20 ± 5 ℃ and be less than or equal under 238cm/ hour the flow velocity and carry out.After this, under 478 ± 78cm/ hour flow velocity and identical temperature, carry out wash-out, make solution described in detail below and damping fluid pass through pillar: the MP1 of 1.0vc (600ml) with following order; The gradient of MP1-MP2, from 65: 35 ratio of described solution begin until reach 18.0vc (9,45: 55 ratio of solution described in cumulative volume 000ml); 1.0vc (600ml) MP1-MP2 of 45: 55 ratios; At last, and 2.0vc (1, MP2 200ml).

In case finish this step, in order to clean pillar, the gradient of utilization MP2-50% methyl alcohol begins until reaching in 0: 100 ratio of solution described in the cumulative volume of 1.0vc (600ml) from 100: 0 ratio of described solution; At last, (1,50% methyl alcohol 200ml) passes through pillar to make 2.0vc.

Measure the resulting fraction of this chromatogram by SDS-PAGE, uniformity is 20% and for the hGH of oxidation, according to the result, selects.After this, measure the selected total protein (by the Bradford method) that contains the hGH fraction, and be stored in 2-8 ℃.

Anion-exchange chromatography

Use anionresin matrix that the material that previous step obtained is carried out chromatogram, as follows:

1. equipment

A. pillar:

1) diameter: 5cm

2) height of bed: 25cm

3) matrix:

a.Source 30Q(Pharmacia)

B. volume: 500ml

2. solution and damping fluid:

A.20% ethanol

B. solution K:0.5N NaOH, 3M NaCl

C. solution L:50mM Tris, pH7.50

D. solution M:0.1N HCl, 3M NaCl

E. mobile phase 3 (MP3): solution L: acetonitrile (70: 30)

F. mobile phase 4 (MP4): 50mM Tris, 0.1M NaCl, pH7.50: acetonitrile (70: 30)

3. treat the stratographic material

A. the selected fraction that obtains from previous step

B. sample condition

1) volume: 4.5 ± 1L

2)pH：7.2±0.2

For balance and cleaning pillar, make following solution or damping fluid pass through pillar in order with amount described in detail below, flow velocity was less than or equal to 183 ± 20cm/ hour: 1.0vc (500ml) pure water; 1.0vc solution K (500ml); 1.0vc solution L (500ml); At last, the MP3 of 1.0vc (500mL).

In case pillar has obtained balance, load and treat the stratographic material.Describedly be loaded in 20 ± 5 ℃ and be less than or equal under 183cm/ hour the flow velocity and carry out.After this, under 183 ± 20cm/ hour flow velocity and identical temperature, carry out wash-out, make solution described in detail below and damping fluid pass through pillar: the MP3 of 1.0vc (500ml) with following order; The gradient of MP3-MP4 begins until reaching in 25: 75 ratio of solution described in the cumulative volume of 5.0vc (2500ml) from 15: 85 ratio of described solution; At last, make the MP 4 of 2.0vc (1000ml) pass through pillar.

In case finish this step, in order to clean pillar, following solution or damping fluid are passed through pillar in order with amount described in detail below: the gradient of MP4-pure water begins until reaching in 0: 100 ratio of solution described in the cumulative volume of 0.5vc (250ml) from 100: 0 ratio of described solution; 0.5vc pure water (250ml); The gradient of pure water-solution K begins to reach 0: 100 ratio of solution the cumulative volume of 0.5vc (250ml) until described from 100: 0 ratio of described solution; 1.0vc solution K (500ml); The gradient of solution K-pure water begins until reaching in 0: 100 ratio of solution described in the cumulative volume of 0.5vc (250ml) from 100: 0 ratio of described solution; 0.5vc pure water (250ml); The gradient of pure water-solution M begins until reaching in 0: 100 ratio of solution described in the cumulative volume of 0.5vc (250ml) from 100: 0 ratio of described solution; 1.0vc solution M (500ml); The gradient of solution M-pure water begins until reaching in 0: 100 ratio of solution described in the cumulative volume of 0.5vc (250ml) from 100: 0 ratio of described solution; 1.0vc pure water (500ml); The gradient of pure water-solution L begins until reaching in 0: 100 ratio of solution described in the cumulative volume of 0.5vc (250ml) from 100: 0 ratio of described solution; 0.5vc solution L (250ml); The gradient of solution L-pure water begins until reaching in 0: 100 ratio of solution described in the cumulative volume of 0.5vc (250ml) from 100: 0 ratio of described solution; At last, the pure water of 1.5vc (750ml).

Measure the selected total protein (by the Bradford method) that contains the hGH fraction, and be stored in 2-8 ℃.

Molecular-exclusion chromatography

Use size-exclusion matrix that the material that previous step obtained is carried out chromatogram, as follows:

1. equipment

A. pillar:

1) diameter: 5cm

2) height of bed: 25cm

3) matrix:

a.Cellufine GH25(Millipore)

B. volume: 500ml

2. solution and damping fluid:

A.0.5N NaOH

B.20% ethanol

C. damping fluid C:150mM NaH ₂PO ₄, pH7.2

D. damping fluid G:320mM glycine, 10mM NaH ₂PO ₄, 0.1% tween 80, pH6.9

3. treat the stratographic material

A. the selected fraction that obtains from previous step

B. sample condition:

1) volume: 0.5 ± 0.2L

2)pH：7.5±0.5

For balance and cleaning pillar, make following solution or damping fluid pass through pillar in order with amount described in detail below, flow velocity was less than or equal to 180cm/ hour: the pure water of 1.0vc (500ml); 1.0vc 0.5N NaOH (500mL); 0.5vc the damping fluid C of pure water 0.5vc (250ml) (250ml); At last, the damping fluid G of 2.0vc (1000ml).

In case pillar has obtained balance, load and treat the stratographic material.Carry out under the described flow velocity that is loaded in 20 ± 5 ℃ and 183 ± 20cm/ hour.After this, under identical flow velocity and temperature, carry out wash-out, and the damping fluid G that makes 1.0vc (500ml) moves the required number of times that carries out by pillar.

In case finish this step,, make following solution or damping fluid pass through the pure water of pillar: 0.5vc (250ml) in order with amount described in detail below in order to clean pillar; 1.0vc 0.5N NaOH (500ml); 0.5vc pure water (250ml); 0.5vc damping fluid C (250ml); 0.5vc pure water (250ml); At last, 20% ethanol of 1.5vc (750ml).

Measure the selected total protein (by the Bradford method) that contains the hGH fraction, and be stored in 2-8 ℃.

Concentrate

Condition according to the following stated concentrates resulting fraction among the last embodiment:

1. equipment:

A. peristaltic pump: Watson Marlow-Cat.No.302S

B. pipeline: Watson Marlow-Cat.No.902.0080.016

C. thickener: Prep Scale Millipore-Cat.No.CDU F006LC

2. solution and damping fluid:

A.0.28% sodium lauryl sulphate (SDS)

B.0.06% Triton

C.0.125N NaOH

D. damping fluid G:320mM glycine, the NaH of 10mM ₂PO ₄, 0.1% tween 80, pH6.9

3. pending material

A. the selected fraction that obtains from last embodiment

B. sample condition:

1) volume: 1.0 ± 0.5L

2) conductivity: 1200 ± 100 μ S/cm

3)pH：6.9±0.1

At first clean, cleaning and balance equipment, and make the solution of following order and damping fluid flow through equipment: the 0.125N NaOH of 2L; The pure water of 10L; At last, the damping fluid G of 2L.The equipment that is ready to then concentrates selected fraction for use in according to usual method.The program that concentrates is until the protein concentration that reaches 15mg/ml (recording by the Bradford method).

Make the membrane filtration of selected fraction, measure total protein (by the Bradford method), and be stored in 4 ℃ by 0.22 μ m hole.

The conductivity and the pH of selected fraction are respectively 1,100-1,300 μ S/cm and 6.9 ± 0.1.

Molecular-exclusion chromatography

Use size-exclusion matrix that the resulting material of previous step is carried out chromatogram, as follows:

1. equipment:

A. pillar:

1) diameter: 5cm

2) height of bed: 92cm

3) matrix:

a.Sephacryl S-200High Resolution(Amersham Pharmacia)

B. volume: 1,800ml

2. solution and damping fluid:

A.0.5N NaOH

B.20% ethanol

C. damping fluid H:320mM glycine, 2.2mM NaH ₂PO ₄, 1.8mM Na ₂HPO ₄, pH7.30

3. treat the stratographic material

A. selected from previous step, spissated fraction

B. sample condition:

1) volume: 40 ± 20ml

2) conductivity: 1,200 ± 100 μ S/cm

3)pH：7.3±0.1

For balance and cleaning pillar, make following solution or damping fluid pass through pillar in order with amount described in detail below, flow velocity is lower than 46cm/ hour: 1.0vc (1, pure water 800ml); 1.0vc (1,0.5N NaOH 800ml); At last, and 2.0vc (3, damping fluid H 600ml).

In case pillar has obtained balance, load and treat the stratographic material.Carry out under the described flow velocity that is loaded in 20 ± 5 ℃ and 46 ± 15cm/ hour.After this, under identical flow velocity and temperature, carry out wash-out, and (1, damping fluid H 800ml) moves the required number of times that carries out by pillar to make 1.0vc.

In case finish this step, in order to clean pillar, make following solution or damping fluid with amount described in detail below pass through in order pillar: 1.0vc (1, pure water 800ml); And 1.5vc (2,20% ethanol 700ml).

The film sterile filtration of the fraction that will contain pure hGH by 0.22 μ m hole is measured total protein, and is stored in-20 ℃ to aseptic, the former Plastic Bottle that reduces phlegm and internal heat.

Embodiment 8

The interchangeable method of purifying hGH from milk

Described purification process before substituting, the reorganization hGH in order to be contained in the purifying milk can use interchangeable scheme.Main difference between the replaceable method that is presented among method described in the embodiment 7 and this embodiment is that the former second step comprises the expanded bed anion-exchange chromatography, and latter's corresponding step needs immune affinity chromatographic.The clarification steps of two kinds of methods is difference slightly also.Because the rest part of two purification scheme is identical, below two steps of replaceable method are only described.

Clarification

In order to obtain 0.5% solution, fresh milk is mixed with the tween 80 of capacity.After adding tween 80, the Tris that adds 1M obtains 7.3 ± 0.3 pH.After this, with product homogenizing 30 minutes, centrifugal under 14000g for the separating out fat layer then.Afterwards, (0.5% tween 80 pH7.3) with 20 times of resulting solution dilutions, is also preserved product by the membrane filtration in 0.45 μ m hole then easily for 50mM Tris.HCl, 500mM NaCl with damping fluid S.

Immune affinity chromatographic

Use immune affine interaction matrix (Affigel 10 EsterAgarose, BioRad makes, covalently bound anti--GH monoclonal antibody, BioSidus manufacturing) that the material that previous step obtained is carried out chromatogram according to following parameter:

1. equipment:

A. pillar:

1) diameter: 30cm

2) height of bed: 15cm

3) matrix:

A) Affigel 10Ester Agarose (BioRad), covalently bound anti--GH monoclonal antibody (Bio Sidus)

B) volume: 10L

2. solution and damping fluid:

A. buffer A: 20mM Tris.HCl, 500mM NaCl, pH7.2

B. buffer B: 100mM citric acid, pH3.0

C. damping fluid C:150mM NaH ₂PO ₄, pH7.2

D. damping fluid D:50mM Tris.HCl, 500mM NaCl, 500mM guanidine .HCl, pH7.2

E. damping fluid E:50mM Tris.HCl, 500mM NaCl, pH7.2,0.2% sodiumazide, 0.1g/L gentamicin

3. treat the stratographic material

A. clarifying milk

B. sample condition:

1) volume: 30-50L

2) conductivity: 45 ± 15mS/cm

3)pH：7.3±0.3

For balance and cleaning pillar, if in nearest seven days, do not use, make following solution or damping fluid pass through pillar in order with amount described in detail below, flow velocity is lower than 51cm/ hour: 1.0 column volumes (" vc ") buffer A (10L); 2.0vc damping fluid D (20L); 2.0vc buffer A (20L); 1.0vc buffer B (10L); 2.0vc damping fluid C (20L); At last, the buffer A of 1.0vc (10L).

On the other hand, if used pillar in nearest seven days, make following solution or damping fluid pass through pillar in order with amount described in detail below, flow velocity is lower than 51cm/ hour: the damping fluid C of 1.0vc (10L); At last, the buffer A of 2.0vc (20L).

In case pillar obtains balance, load and treat the stratographic material.Describedly be loaded in 5 ± 3 ℃ and be lower than under 51cm/ hour the flow velocity and carry out.After this, under 42 ± 9cm/ hour flow velocity and identical temperature, carry out wash-out.Solution described in detail below and damping fluid are passed through pillar with following order: the buffer A of 2.0vc (20L); And the buffer B of 1.5vc (15L).

In case finish this step,, make following solution or damping fluid pass through the damping fluid D of pillar: 2.0vc (20L) in order with amount described in detail below in order to clean pillar; 2.0vc buffer A (20L); At last, the damping fluid E of 2.0vc (20L).

Measure the total protein (by the Bradford method) and the target protein (passing through RIA) of the selected hGH of containing fraction, and be stored in 4 ℃.

Embodiment 9

The quality control of pure reorganization hGH

Two crowdes of pure reorganization hGH are carried out a series of mensuration confirm that this product and natural hGH do not have difference.Such method comprises, but be not limited to, biological activity, peptide mapping, the mensuration of complete amino acid sequence, the isoelectrofocusing (IEF) of (rat that hypophysectomizes) in SDS/PAGE, western blotting, external (cell nb 2) and the body, and anti-phase and size exclusion HPLC analysis.For reorganization and natural hGH, the result that all that is obtained in measuring is identical, and it has proved pure reorganization hGH fully corresponding to natural hGH, therefore is applicable to the manufacturing biopharmaceutical product.

Describe the present invention now fully, those skilled in the art will appreciate that the scope that under condition, preparation and other parameter of wide and equal scope, to carry out identical invention and can not influence the present invention or its any embodiment.All be incorporated herein by reference with its integral body at this in these all patents quoted and publication.

Sequence table

<110>Sterrenbeld Biotechnologie North

Melo，Carlos Alberto

Baranao，Lino

Carbonetto，Cesar

＜120〉in transgenic mammal milk, produce the method for foreign protein and from the method for purifying protein wherein

<130>1909.010PC02

<160>4

<170>PatentIn version 3.2

<210>1

<211>31

<212>DNA

＜213〉artificial

<220>

＜223〉primer PB1

<400>1

tctactcgag gatcatctat ctgtcccaaa g 31

<210>2

<211>27

<212>DNA

＜213〉artificial

<220>

＜223〉primer PB2

<400>2

ctaggatcca atgatctgat tttgtgg 27

<210>3

<211>28

<212>DNA

＜213〉artificial

<220>

＜223〉primer PB4

<400>3

ctaggatcca tggctacagg taagcgcc 28

<210>4

<211>20

<212>DNA

＜213〉artificial

<220>

＜223〉primer GHTE

<400>4

atgctgtgtc tggacgtcct 20

Claims (48)

1. production method of protein comprises:

A) be manufactured on the non-human transgenic Mammals that produces target protein in its milk;

B) obtain described milk from described non-human transgenic Mammals; With

C) the described target protein of purifying from described milk.

2. according to the process of claim 1 wherein that described non-human transgenic Mammals makes by the following method, this method comprises:

A) gene of acquisition coding target protein;

B) with described gene clone to plasmid, described gene be may be operably coupled to instruct described gene expression promoter in mammary cell whereby, form expression plasmid;

C) with described expression plasmid transfection somatocyte, make described plasmid be incorporated in the described somatic genome, obtain the transgenosis somatocyte;

D) with the mature oocyte stoning, obtain non-nucleus egg mother cell;

E) a described transgenosis somatocyte and described non-nucleus egg mother cell are merged, obtain unicellular embryo;

F) described embryo is implanted in the mammiferous uterus of acceptor; With

G) the conceived birth of monitoring until transgene mammal.

3. the method for claim 2, wherein said promotor is the β casein promoter, and wherein said target protein is a human growth hormone.

4. the method for claim 3, wherein expression plasmid is pR β hGH.

5. the method for claim 4, wherein said expression plasmid further comprises neomycin resistance gene.

6. the method for claim 5, wherein said expression plasmid is pRNeo.

7. the method for claim 2, wherein said Mammals is the ox that produces the recombinant human somatropin in its milk, its genome comprises the plasmid of integration, the β casein promoter that wherein said plasmid comprises human growth hormone gene and instructs described gene to express in described mammiferous mammary cell.

8. the method for claim 7, wherein said plasmid is pR β hGH.

9. the method for claim 8, wherein said plasmid further comprises neomycin resistance gene.

10. the method for claim 9, wherein said plasmid is pRNeo.

11. the method for claim 2, wherein said somatocyte is an inoblast.

12. the method for claim 2 wherein obtains described transgenosis somatocyte through separating from the transgenosis that produces described target protein its milk is female.

13. the method for claim 12, wherein said transgenosis somatocyte is an inoblast.

14. according to the process of claim 1 wherein that described non-human transgenic Mammals makes by the following method, this method comprises:

A) make the super ovulation of the female non-human mammal of transgenosis that in its milk, produces described target protein;

B) described Mammals and the sperm artificial insemination that obtains from male inhuman non-transgenic Mammals are produced the embryo;

C) collect described embryo;

D) described embryo is implanted in the mammiferous uterus of acceptor; With

E) the conceived birth of monitoring until transgene mammal.

15. according to the process of claim 1 wherein that described non-human transgenic Mammals makes by the following method, this method comprises:

A) make the super ovulation of the female non-human mammal of transgenosis that in its milk, produces described target protein;

B) described Mammals and the sperm artificial insemination that obtains from the male non-human mammal of the transgenosis that produces described target protein are produced the embryo;

C) collect described embryo;

D) described embryo is implanted in the mammiferous uterus of acceptor; With

E) the conceived birth of monitoring until transgene mammal.

16. according to the process of claim 1 wherein that described non-human transgenic Mammals makes by the following method, this method comprises:

A) make the super ovulation of female inhuman non-transgenic Mammals;

B) described Mammals and the sperm artificial insemination that obtains from the male non-human mammal of the transgenosis that produces described target protein are produced the embryo;

C) collect described embryo;

D) described embryo is implanted in the mammiferous uterus of acceptor; With

E) the conceived birth of monitoring until transgene mammal.

17. claim 2,12,14,15 or 16 each methods, wherein said Mammals belongs to ox species, pig species, sheep species, goat species or rodent species.

18. the method for claim 17, wherein said Mammals belongs to the ox species.

19. claim 2,12,14,15 or 16 each methods, wherein said target protein is a Mammals tethelin.

20. the method for claim 19, wherein said Mammals tethelin are human growth hormone, Trobest, Porcine somatotropin, sheep tethelin, goat growth hormone or rodent tethelin.

21. the method for claim 20, wherein said Mammals tethelin is human growth hormone.

22. the method for claim 21, wherein said Mammals produces human growth hormone with the level that is higher than about 1.0g hGH/L milk.

23. the method for claim 22, wherein said Mammals produces human growth hormone with the level that is higher than about 2.0g hGH/L milk.

24. the method for claim 23, wherein said Mammals produces human growth hormone with the level that is higher than about 3.0g hGH/L milk.

25. the method for claim 24, wherein said Mammals produces human growth hormone with the level that is higher than about 4.0g hGH/L milk.

26. the method for claim 25, wherein said Mammals produces human growth hormone with the level that is higher than about 5.0g hGH/L milk.

27. the method for claim 26, wherein said Mammals produces human growth hormone with the level that is higher than about 6.0g hGH/L milk.

28. the method for claim 19, the generation of the described Mammals tethelin of wherein said Mammals have stimulated described Mammals to produce the milk that more comprises described Mammals tethelin.

29. claim 2,12,14,15 or 16 each methods, the gene (be connected in and instruct described gene expression promoter in mammary cell) of the described target protein of wherein in described mammiferous somatocyte and sexual cell, having found to encode.

30. the method for purification of Recombinant tethelin from the mammiferous milk of non-human transgenic that produces recombinant human growth hormone comprises:

A) with the mammiferous milk clarification of non-human transgenic, obtain clarifying milk; With

B) described clarifying milk is carried out chromatogram, obtain the recombinant human growth hormone of purifying.

31. the method for claim 30, wherein said chromatogram are ion-exchange chromatography, reverse-phase chromatography, molecular-exclusion chromatography or affinity chromatography.

32. the method for claim 31 is wherein implemented a plurality of chromatographic steps.

33. the method for claim 31, wherein said ion-exchange chromatography is an anion-exchange chromatography.

34. the method for claim 31, wherein affinity chromatography is an immune chromatograph.

35. the method for claim 31 further comprises enrichment step.

36. the method for purification of Recombinant tethelin from the mammiferous milk of non-human transgenic that produces recombinant human growth hormone comprises:

A) with the mammiferous milk clarification of non-human transgenic, obtain clarifying milk; With

B) described clarifying milk is carried out the expanded bed anion-exchange chromatography, obtain the material that anion-exchange chromatography is crossed;

C) material that described anion chromatographic is crossed carries out reverse-phase chromatography, obtains the material that reverse-phase chromatography is crossed;

D) material that described reverse-phase chromatography is crossed carries out anion-exchange chromatography, obtains the material that anion-exchange chromatography is crossed;

E) material that described anion-exchange chromatography is crossed carries out molecular-exclusion chromatography, obtains the material that molecular-exclusion chromatography is crossed;

F) material that described molecular-exclusion chromatography is crossed concentrates, and obtains spissated material; With

G) described spissated material is carried out molecular-exclusion chromatography, obtain pure recombinant human growth hormone.

37. the method for purification of Recombinant tethelin from the mammiferous milk of non-human transgenic that produces recombinant human growth hormone comprises:

A) will clarify from the milk that transgene mammal obtains, obtain clarifying milk; With

B) described clarifying milk is carried out immune affinity chromatographic, obtain the material that immune affinity chromatographic is crossed;

C) material that described immune affinity chromatographic is crossed carries out reverse-phase chromatography, obtains the material that reverse-phase chromatography is crossed;

D) material that described reverse-phase chromatography is crossed carries out anion-exchange chromatography, obtains the material that anion-exchange chromatography is crossed;

E) material that described anion-exchange chromatography is crossed carries out molecular-exclusion chromatography, obtains the material that molecular-exclusion chromatography is crossed;

F) material that described molecular-exclusion chromatography is crossed concentrates, and obtains spissated material; With

G) described spissated material is carried out molecular-exclusion chromatography, obtain pure recombinant human growth hormone.

38. the method for claim 36 or 37, wherein said tethelin are Mammals tethelin.

39. the method for claim 38, wherein said Mammals tethelin are human growth hormone, Trobest, Porcine somatotropin, sheep tethelin, goat growth hormone or rodent tethelin.

40. the method for claim 39, wherein said Mammals tethelin is human growth hormone.

41. the method for claim 40, wherein said Mammals produces human growth hormone with the level that is higher than about 1.0g hGH/L milk.

42. the method for claim 41, wherein said Mammals produces human growth hormone with the level that is higher than about 2.0g hGH/L milk.

43. the method for claim 42, wherein said Mammals produces human growth hormone with the level that is higher than about 3.0g hGH/L milk.

44. the method for claim 43, wherein said Mammals produces human growth hormone with the level that is higher than about 4.0g hGH/L milk.

45. the method for claim 44, wherein said Mammals produces human growth hormone with the level that is higher than about 5.0g hGH/L milk.

46. the method for claim 45, wherein said Mammals produces human growth hormone with the level that is higher than about 6.0g hGH/L milk.

47. the method for claim 36 or 37, wherein said non-human transgenic Mammals belongs to the ox species.

48. the method for claim 36 or 37, wherein said non-human transgenic Mammals is pig, sheep, goat or rodent.

Images