CN1289665C - Recombined aspergillus oryzae tannase and its expression and purification - Google Patents

Abstract

The present invention relates to a method for expressing and purifying a recombinat aspergillus oryzae tannase. The present invention amplifies a nucleotide sequence coding an aspergillus oryzae tannase mature protein from an aspergillus oryzae gene by a PCR method, clones the nucleotide sequence to a methanol yeast expression vector pPIC9K, constructs an expression vector pPIC9K-TAN, uses an electric shock method to convert pichia KM71 to obtain a recombinat strain and uses a high density fermentation method for the induction expression of the recombinant tannase. Expression products are distributed in fermentation supernatant liquid, and the expression amount is 200 mg/L. The present invention establishes a method for purifying the recombinant aspergillus oryzae tannase, and DEAE anion-exchange column chromatography for one-step purification. The present invention also comprises a step of constructing constitutive expression vectors of pGAPZalpha A-TAN and pGAPZalpha A-ETAN of the recombinant tannase in the pichia, obtains an engineering strain with tannase activity by converting the pichia strain KM71H and is capable of expressing the recombinant tannase in a secretion mode. The recombinant aspergillus oryzae tannase has bioactivity.

Description

Reorganization aspergillus oryzae tannase and expression and purification process

Technical field

Aspergillus oryzae tannase and the secreting, expressing in methanol yeast thereof, purifying the present invention relates to recombinate.The invention still further relates to the application of reorganization aspergillus oryzae tannase in industrial production.

Background technology

Tannin (tannin) claim tannic acid again, extensively distributes in higher plant, comprises in monocotyledons, dicotyledons and the pteridophyte.Howes has enumerated the world and has contained tannin plant totally 87 sections kind more than 600.Tannin extensively is present in food and the feed, is especially one of main antinutritional factor in the feed of food.The anti-oxidant action of tannin mainly contains three aspects: (1) tannin and sialoprotein, glycoprotein interact in the oral cavity, make tissue produce convergency, cause a series of disagreeable to the taste reaction.Tannin can cause the food consumption of animal minimizing to feed in the feed.When tannin content in the herbage surpasses the 20mg/g dry-matter, the poultry food refusal.(2) there are a large amount of phenolic hydroxyl group groups and aromatic ring structure in the tannin molecule, can form complex compound, make the proteins coagulation precipitation, influence proteinic digestion and absorption with protein.Tannin and protein complex (Tannin Protein Complex) in the Mammals enteron aisle, are difficult to by decomposition such as proteolytic enzyme.Too high then its feed nutritive value of leguminous forage tannin content reduces.(3) tannin can reduce the activity of Mammals enteron aisle digestive ferment, and gastrointestinal mucosa is produced detrimentally affect.Tannin and digestive ferment constitute mixture, interferases biological activity.Experiment in vitro shows that containing tannin extractive substance (Testa Viciae fabae etc.) in the feed has reduced trypsinase, Chymotrypsin, alpha-amylase activity.Weibull or chlorination Weibull cause mouse stomach and duodenum mucous membrane to change, and cause stomach mucus excessive secretion, gastric mucosa necrosis, atrophy of gallbladder, the degradation untoward reaction down of intestinal epithelial cell oxygen consumption.In addition, tannin is very big to the toxicity of ruminating animal, the search for food robur that contains tannin and some tropical pulse family trees are real and acute poisoning can take place during cauline leaf of cattle and sheep.In the production of aqueous solution herbal tea beverage, the tannin that is rich in the tea causes tea breast precipitation.Protein in tannin and beer and the fruit juice generates precipitation, can cause the product muddiness.In the production of food, beverage, poultry and livestock feed, must remove unnecessary tannin composition ^[9]With the unnecessary tannin of tannase degraded, be a kind of technology that has wide application prospects.

Tannin is the antagonist of most of microbe, and to the toxic effect of microorganism, but some microorganisms have resistance to tannin.These microorganisms are by various mechanism and method degraded tannin.1913, Knudson was separated to the effect that aspergillus niger (Aspergillusniger) and mould (Penicillum sp.) have the degraded Weibull, first the tannin fermentative degradation is studied.Over past ten years, many intestinal bacteria are found the ability with degraded tannin.Osawa successively is separated to the streptococcus bovis and the enterobacteria of degraded tannin-protein complex from the ight soil of sloth and caecum.People such as Nenuetr are reported in the bacterium that the horse enteron aisle is isolated the degraded tannin.Makkai in 1994 finds that the hair spore belongs to can effectively degrade condensed tannin in the robur of fungi (Sportrichum Preluerulentum).White rot mould (Ceriporiopsis subvermispora) can carry out chemically modified to the condensed tannin that is rich in the leaf, thereby improves three times of the digestibilities of leaf.Tannin Acyl-hydrolase (EC3.1.1.20) is commonly referred to tannase (Tannase). and the ester bond of tannase Hydrolysable Tannins produces gallic acid and glucose.Tannase is the key enzyme of tannin biology degradation.The progressivity research of tannase starts from the sixties.Successively from aspergillus oryzae and aspergillus niger, separation and purification is to tannase in the candidiasis.Also from some inoculum, separate tannase.Adachi proves that to the physico-chemical property research of aspergillus oryzae tannase tannase is typical serine easterase, and is consistent with the experimental result of Barthomeuf in 1994 etc.

Tannase is of many uses in industrial production, is subjected to people's attention day by day.In the production of water-soluble herbal tea beverage, the tannase tannin that tea is rich in that is used for degrading generates the tea breast to avoid tannin to cause.Protein in tannin and beer and the fruit juice generates precipitation, causes muddiness, and tannase can be used as finings and is applied in the production of this type of beverage.In the feed processing, add the detrimentally affect that tannase can reduce tannin, improve the utilization ratio of feed.When utilizing the characteristic protein purification of tannin precipitating proteins, tannase can be used to the tannin in the disgorging.In addition, tannase also is used to produce gallic acid and gallic acid ester.Gallic acid is a kind of fine chemical material of many uses, pharmaceutically is used to make first benzyl chloride pyrimidine (for Trimpex), Biphenylylmethylcarbinol (controlling hepatopathy), Cormelian medicines such as (controlling coronary heart disease).Tenox PG, gallic acid glyceride etc. are as the oxidation inhibitor and the sanitas of food.Gallic acid also is used for synthetic dyestuff, chemical analysis with purposes such as reagent.

Tannase all extracts from produce the tannase bacterial strain fermentation liquor all the time.Lane in 1997 etc. have prepared the tannase preparation from aspergillus oryzae.But yield of enzyme is few relatively, is difficult to again purify, so extract tannase cost height from producing the tannase bacterial strain fermentation liquor, efficient is low, is difficult to apply.Hatameto cloned the tannase gene of aspergillus oryzae in 1996.The plasmid PT1 that will have the tannase gene transforms the strains A spergillus orygze Aol that tannase yields poorly, and improves the output of the tannase of host bacterium.This lays the foundation for utilizing efficient expression system production reorganization tannase.

As yeast expression system of new generation, the methanol yeast expression system is compared with existing main recombinant protein production system and is had many-sided advantage.As eukaryote, the methanol yeast expression system has the advantage of eukaryotic expression system such as yeast saccharomyces cerevisiae expression system, has Eukaryotic protein translation post-treatment function, have to be suitable for eukaryotic gene expression product correctly folding intracellular environment and sugar chain system of processing, can also secrete exogenous protein and in substratum, be beneficial to purifying.This is that intestinal bacteria prokaryotic expression systems such as (E.coli) is unexistent.System compares with animal cell expression, and the methanol yeast system has the advantages that breeding is quick, cultivation is easy, cost is low, also carries out the molecular genetic operation simultaneously easily.Methanol yeast has advantage than yeast saccharomyces cerevisiae and shows: recombinant strain go down to posterity stable, expression level is high and industrial scale easily industry amplify etc.Methanol yeast system exogenous protein expression level than the high 10-100 of yeast saccharomyces cerevisiae system doubly.This is because methanol yeast has the AOX promotor.The AOX promotor is one of control eukaryotic promoter the strongest in the promotor of having studied at present, thereby has the very large ability of efficiently expressing by the exogenous gene expression of AOX promoters driven.From Gzegy in 1987 etc. express hepatitis B surface antigen(HBsAg) (HbsAg) first in pichia spp (P.pastoris) since, a few years time, had at least 40 kinds of foreign proteins in P.pastoris, to obtain expression.Glyceraldehyde 3-phosphate dehydro-genase in the pichia spp (GAP) promotor has been cloned in separation such as Waterham in 1997, and it is a composing type efficient promoter.The GAP promotor can start foreign gene and efficiently express in the process of growth of cell, need not induce.Because it is more convenient that the high efficiency of GAP promotor and operation are gone up, so it has huge application potential, is effective replacer of AOX promotor.An extraordinary advantage is arranged is exactly that P.pastoris self secretory protein level is very low to the P.pastoris secreting, expressing in addition.This means that when growing, the most of albumen in cultivation is target protein on the P.pastoris minimum medium, this favo(u)rable target protein purification.On secretory protein glycosylation modified, pichia spp can not resemble the super glycosylation of yeast saccharomyces cerevisiae, and this is another advantage of pichia spp.

Summary of the invention

The invention provides a kind of new aspergillus oryzae tannase and encoding gene thereof; The present invention also provides the purification process and the application of above-mentioned new expression of gene and expression product.

The present invention is by having designed a pair of special primer, to encode aspergillus oryzae tannase maturation protein (the mature peptide sequence of its coding as in the sequence table＜400〉2 sequences shown in) nucleotide sequence (as in the sequence table＜400〉1 sequences shown in) increase from the aspergillus oryzae gene with PCR method, be cloned into yeast expression vector pPIC9K (available from Invitrogen company), construction of expression vector carrier pPIC9K-TAN adopts electric shocking method to transform pichia spp KM71 (available from Invitrogen company) and obtains recombinant bacterial strain.Host's mushroom type, the shake-flask culture condition, fermentation culture conditions etc. are groped and are optimized, and the Recombinant Protein Expression amount reaches 200mg/L.

The present invention also arrives the tannase gene clone among the yeast expression vector pGAPZ α A (available from Invitrogen company), and by the method for PCR the expression of gene framework is transformed, made up constitutive expression carrier pGAPZ α A-TAN and pGAPZ α A-ETAN.Adopt electric shocking method to transform Pichi strain KM71H (available from Invitrogen company) and obtain recombinant bacterial strain, and under the shake-flask culture condition, express with secreted form.

The present invention also gropes and has optimized the proteic purification condition of reorganization tannase, expression product adopts DEAE Sepharose (available from Amersham Biosciences company) anion-exchange chromatography single step purification, can obtain purity and reach reorganization tannase albumen more than 95%.

The reorganization tannase biologically active that the present invention obtains.

The present invention has made up the expression plasmid pPIC9k-TAN (building process is seen Figure 13) that contains aspergillus oryzae tannase albumen mature polypeptide coding sequence and has contained expression plasmid pGAPZ α A-TAN and pGAPZ α A-ETAN (building process is seen Figure 14)

The present invention has made up the expression plasmid pPIC9K-TAN of aspergillus oryzae tannase mature protein coding sequence, through the EcoRI/NotI double digestion, can obtain the fragment of 1.7kbp by this expression plasmid carrier, is aspergillus oryzae tannase mature polypeptide coding sequence.The tannase gene is by XhoI and NotI clone among expression plasmid pGAPZ α A-TAN and the pGAPZ α A-ETAN, because an XhoI restriction enzyme site is contained at the 1405bp place in the tannase mature protein coding sequence, expression plasmid can obtain two fragments of about 300bp and 1.4kb through the XhoI/NotI double digestion.

The clone method of expression plasmid carrier of the present invention:, press CaCl with reference to Sambrook (Sambrook, et al.1989, Molecularcloing.Cold Spring Harbor Labroratory Press.USA) method ₂Method transforms plasmid in E.Coli.DH5 α bacterial strain, the bacterium that has transformed pPIC9K-TAN is cultivated with the LB substratum that contains 100 μ g/ml penbritins, the bacterium that has transformed pGAPZ α A-TAN and pGAPZ α A-ETAN is cultivated with the less salt LB substratum that contains 25 μ g/ml, and alkaline process extracts plasmid.

Description of drawings

Fig. 1 is the tannase gene electrophoresis result of pcr amplification from the aspergillus oryzae gene.The tannase gene of 1:PCR amplification; 2: negative control; M:1kb DNAmarker.

Fig. 2 cuts the evaluation electrophoresis result for the enzyme of tannase methanol yeast expression vector carrier pPIC9k-TAN.1：pPIC9k-TAN(EcoR?I+Not?I)；2：pPIC9k(EcoR?I+Not?I)；M1：1kb?DNAmarker。

Fig. 3 is that the reorganization methanol yeast bacterial strain PCR that has integrated carrier pPIC9k-TAN identifies electrophoresis result.1: positive colony; 2: negative control; M1:1kb DNA marker.

Fig. 4 carries out the expression product SDS-PAGE electrophoresis result of abduction delivering for the reorganization tannase passes through expression vector pPIC9k-TAN with methyl alcohol.1: induce the primary fermentation supernatant liquor; 2～5: 1～4 day fermented supernatant fluid behind methanol induction; 6: the molecular weight of albumen standard.

Fig. 5 is the purification result SDS-PAGE electrophoretic analysis of reorganization tannase.1: fermented supernatant fluid; The tannase (non-reduced) of 2:DEAE anionresin purifying; 3: the tannase de-glycosylation (non-reduced) of purifying; 4: the molecular weight of albumen standard; The tannase (reduction) of 5:DEAE anionresin purifying; 6: the tannase de-glycosylation (reduction) of purifying.

Fig. 6 is the optimal reactive temperature curve of reorganization tannase.

Fig. 7 is the thermostability curve of reorganization tannase.

Fig. 8 is the optimal reaction pH curve of reorganization tannase.

Fig. 9 is the ph stability linearity curve of reorganization tannase.

The cell culture supernatant SDS-PAGE electrophoresis result that Figure 10 expresses by expression vector pGAPZ α A-TAN for the reorganization tannase.1: the molecular weight of albumen standard; 2～9: the culture supernatants of cultivating 2～9 days.

Figure 11 is the tannin plate screening result who has transformed the Pichi strain KM71H of expression vector pGAPZ α A-TAN and pGAPZ α A-ETAN.A: the Pichi strain KM71H that has transformed pGAPZ α A-TAN; B: the Pichi strain KM71H that has transformed pGAPZ α A-ETAN.

Figure 12 is the expression framework synoptic diagram of tannase among expression vector pGAPZ α A-TAN and the pGAPZ α A-ETAN.A: tannase expression of gene framework among the expression vector pGAPZ α A-TAN; B: tannase expression of gene framework among the expression vector pGAPZ α A-ETAN.

Figure 13 is the structure synoptic diagram of tannase methanol yeast expression vector carrier pPIC9k-TAN.

Figure 14 is that expression vector pGAPZ α A-TAN and pGAPZ α A-ETAN make up synoptic diagram.

Embodiment

The invention will be further described below in conjunction with drawings and Examples, will help those of ordinary skill in the art to understand the present invention, but not limit the present invention in any form.

The pcr amplification of embodiment one, aspergillus oryzae tannase gene

The genomic experimental program that extracts with reference to " modern molecular biology experimental technique " of aspergillus oryzae, cut the site according to maturation protein two terminal sequences of tannase genes encoding and the multienzyme of yeast expression vector pPIC9K (available from Invitrogen company), synthetic a pair of primer, sequence is as follows:

Upstream primer, 5 ' G GAATTCGCTTCTTTTACCGATGTGTGCAC3 ' (single underscore is partly cut sequence for the EcoRI enzyme);

Downstream primer, (single underscore is partly cut sequence for the NotI enzyme, and double underline is a terminator codon).

Pcr amplification, gene clone are carried out all according to a conventional method.The about 1700bp of PCR product, as Fig. 1,570 amino-acid residues of encoding.

The structure of embodiment two, tannase methanol yeast expression vector pPIC9k-TAN

The aspergillus oryzae tannase gene of pcr amplification is cloned into the corresponding enzyme of methanol yeast expression vector pPIC9K with EcoRI and NotI double digestion and is cut window, obtain expression vector pPIC9K-TAN, building process is seen Figure 13, cuts evaluation (Fig. 2) and sequencing analysis shows that cloned genes is a goal gene through enzyme.

The conversion of embodiment three, yeast strain and the screening of positive colony

Expression plasmid pPIC9K-TAN adopts electric shocking method to transform pichia spp KM71 (available from Invitrogen company) with the PmeI simple tangentization, transforms same linearizing empty carrier pPIC9K simultaneously in contrast.At MD solid culture plate screening positive colony, and with the dull and stereotyped further screening positive clone of the YPD that contains the G418 resistance.Transformant is further identified by the method for PCR, the PCR primer is α-factor sequencing primer (5 '-TACTATTGCCAGCATTGCTGC-3 ') and 3 ' AOX1 sequencing primer (5 '-GCAAATGGCATTCTGACATCC-3 '), adopt the Taq archaeal dna polymerase to carry out the PCR reaction, positive colony genome with extraction is a template, the reaction cycle condition is, 94 ℃ 5 minutes, 94 ℃ 45 seconds, 52 ℃ 30 seconds, 72 ℃ 2 minutes, 32 circulations, 72 ℃ 10 minutes, 4 ℃ of preservations.Agarose gel electrophoresis detects and shows Fig. 3, and pcr amplification obtains the about 1.8kb DNA of specificity band, conforms to the size of expection.

The high density fermentation abduction delivering of embodiment four, reorganization aspergillus oryzae tannase

Choose mono-clonal from the YPD flat board, be inoculated in the 20ml BMGY substratum, 30 ℃, 240rpm are cultivated 20h.Be inoculated in the 300ml BMGY substratum with 1: 50 ratio, 30 ℃, 240rpm are cultured to OD600=2～6, in order to the inoculation fermentation jar.

The 7L fermentor tank adds 3L fermentation basic medium, and 121 ℃ of sterilization 20min adjust the temperature to 30 ℃, regulate pH to 5.5 with ammoniacal liquor, add PTM1 (4.35ml L ^-1), insert kind of a daughter bacteria (1: 10).In the fermenting process, temperature is controlled at 30 ℃, and air flow maintains 2vvm, and rotating speed is controlled between 300～800rpm to keep dissolved oxygen more than 20%.

Fermentation is divided into three phases: from adding kind of a daughter bacteria, cultivate about 16～24h vegetative period, glycerine exhausts in fermentor tank, shows as dissolved oxygen and rises suddenly; Enter the glycerine promotes growth phase afterwards, add 50% glycerine and (contain PTM1,12ml L ^-1), feed supplement speed is 18ml L ^-1h ^-1, continue 4～6h; Enter inductive phase at last, regulate pH to 5.0 with ammoniacal liquor, stream adds 100% methyl alcohol and (contains PTM1,12ml L ^-1), flow velocity is from 1ml L ^-1h ^-1Rise to 3ml L through the 10h linearity ^-1h ^-1, continue 120h.The fermentation supernatant detects protein expression with SDS-PAGE, as Fig. 4.

The purifying of embodiment five, reorganization aspergillus oryzae tannase

Fermented liquid is in 4 ℃ of centrifugal 30min of 8000rpm, supernatant is through Sephendex G-25 desalination, be replaced by 10mmol/L citric acid pH5.5 damping fluid, again through DEAE Sepharose Fast Flow ion exchange column purifying, eluent system is a 10mmol/L citric acid pH5.5 damping fluid, the NaCl linear gradient (0～0.5mol/L), pH5.5.Elution samples is carried out Analysis and Identification (Fig. 5) with SDS-PAGE.Merge the target protein component, distilled water dialysis, the sample lyophilize of dialysis back ,-20 ℃ of preservations.

The activity identification of embodiment six, reorganization aspergillus oryzae tannase

The activity identification of reorganization aspergillus oryzae tannase is with reference to the method for Beverini (1990).The enzyme of 1IU is lived and is defined the required enzyme amount of hydrolysis in 1 minute 1 μ mol Weibull.The enzyme biopsy is surveyed our the reorganization aspergillus oryzae tannase enzyme work of preparation and is reached 50,000IU/g.

Embodiment seven, reorganization aspergillus oryzae tannase optimal reactive temperature and thermal stability determination

At differing temps (10 ℃～70 ℃), measure enzymic activity.When measuring thermostability, then enzyme liquid is measured its remaining enzymic activity in insulation under the differing temps after 10 minutes.Record the reorganization tannase optimal reactive temperature be 40 ℃, the thermostability scope be 10～40 ℃ (Fig. 6, Fig. 7).

Embodiment eight, reorganization aspergillus oryzae tannase optimal reaction pH and ph stability are measured

Prepare the Na of different pH values ₂HPO ₄-citrate buffer solution (pH2.2～8.0), 0.5 pH unit is a gradient.When measuring optimal reaction pH value, tannase is dissolved in the deionized water, with the Na of different pH values ₂HPO ₄5 times of-citrate buffer solution dilutions; Measuring enzyme then lives.When measuring ph stability, then tannase is dissolved in the damping fluid of different pH values,, measures enzyme then and live at the 50mM citrate buffer solution of 30 ℃ of insulations pH5.5 of 20 times of volumes of adding after a hour.Measurement result, the reorganization tannase optimal reaction pH value be pH6.0, the ph stability scope be pH4～6 (Fig. 8, Fig. 9).

The structure of embodiment nine, reorganization tannase pichia spp constitutive expression carrier pGAPZ α A-TAN and pGAPZ α A-ETAN

Part signal peptide sequence and tannase encoding sequence design synthetic primer according to expression vector pGAPZ α A (available from Invitrogen company):

Upstream primer:

(1): 5 ' CCG CTCGAGAAAAGA GCTTCTTTTACCGATGTGTGCAC3 ' (single underscore partly is the XhoI restriction enzyme site in the carrier signal peptide sequence),

(2):

(single underscore partly is the XhoI restriction enzyme site in the carrier signal peptide sequence, and double underline partly is the Ste13 proteolytic enzyme cutting sequence of carrier signal peptide sequence end);

Downstream primer: 5 ' TCGCTGGACTGGCCATAAAAGC3 ' (downstream primer is one section sequence at about 480bp place in the tannase encoding sequence).

With pPIC9K-TAN is template, carries out pcr amplification with two groups of primers respectively, and the clip size that amplification obtains is about 500bp, with being cut into two fragments behind XhoI and the SphI double digestion, reclaims the wherein fragment of about 100bp; With plasmid pPIC9K-TAN SphI and NotI double digestion, reclaiming size is the tannase gene fragment of 1.4kb; These two fragments are connected to the corresponding XhoI/NotI enzyme of expression vector pGAPZ α A cut in the window, be built into expression vector pGAPZ α A-TAN and pGAPZ α A-ETAN, building process is seen Figure 14; Tannase expression of gene framework such as Figure 12 in the expression vector, tannase is directly connected in carrier signal peptide end in pGAPZ α A-TAN, the tannase gene is connected in pichia pastoris protein Ste13 proteolytic enzyme cutting site end in pGAPZ α A-ETAN, promptly contains 4 amino-acid residue EAEA between signal peptide sequence and tannase; Cut and the success of dna sequencing evaluation vector construction through enzyme.

The conversion of embodiment ten, Pichi strain and the screening of positive colony

Expression vector pGAPZ α A-TAN and pGAPZ α A-ETAN carry out linearizing with AvrII respectively, adopt electric shocking method to transform pichia spp KM71H, transform same linearizing empty carrier pGAPZ α A simultaneously in contrast.Cell after the conversion filters out resistance clone with the zeocine resistant panel, selects the tannase active bacterial strain with the YNB+0.5% glucose flat screen that contains 0.2% Weibull again.Wherein have the active recombinant bacterial strain of tannase and can form a transparent tannin degraded circle (Figure 11) in periphery of bacterial colonies.

Embodiment 11, reorganization tannase carry out constitutive expression by expression vector pGAPZ α A-TAN

Picking list bacterium colony from the YPD flat board, be seeded to the 50mlYPD substratum, 30 ℃, 240rpm cultivation, added final concentration every 24 hours and be 0.5% glucose solution, and get culture supernatant and carry out the SDS-PAGE analysis, at the about 100kDa of molecular weight place one characteristic protein band is arranged, be reorganization tannase product (Figure 10).

Sequence table

＜110〉Zhongshan University

＜120〉reorganization aspergillus oryzae tannase and expression and purification process

<160>2

<210>1

<211>1710

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<220>

<221>mat?peptide

<222>(1)…(570)

<400>1

gct?tct?ttt?acc?gat?gtg?tgc?acc?gtg?tct?aac?gtg?aag?gct?gca?ttg 48

Ala?Ser?Phe?Thr?Asp?Val?Cys?Thr?Val?Ser?Asn?Val?Lys?Ala?Ala?Leu

1 5 10 15

cct?gcc?aac?gga?act?ctg?ctc?gga?atc?agc?atg?ctt?ccg?tcc?gcc?gtc 96

Pro?Ala?Asn?Gly?Thr?Leu?Leu?Gly?Ile?Ser?Met?Leu?Pro?Ser?Ala?Val

20 25 30

acg?gcc?aac?cct?ctc?tac?aac?cag?tcg?gct?ggc?atg?ggt?agc?acc?act 114

Thr?Ala?Asn?Pro?Leu?Tyr?Asn?Gln?Ser?Ala?Gly?Met?Gly?Ser?Thr?Thr

35 40 45

acc?tat?gac?tac?tgc?aat?gtg?act?gtc?gcc?tac?acg?cat?acc?ggc?aag 192

Thr?Tyr?Asp?Tyr?Cys?Asn?Val?Thr?Val?Ala?Tyr?Thr?His?Thr?Gly?Lys

50 55 60

ggt?gat?aaa?gtg?gtc?atc?aag?tac?gca?ttc?ccc?aag?ccc?tcc?gac?tac 240

Gly?Asp?Lys?Val?Val?Ile?Lys?Tyr?Ala?Phe?Pro?Lys?Pro?Ser?Asp?Tyr

65 70 75 80

gag?aac?cgt?ttc?tac?gtt?gct?ggt?ggt?ggt?ggc?ttt?tcc?ctc?tct?agc 288

Glu?Asn?Arg?Phe?Tyr?Val?Ala?Gly?Gly?Gly?Gly?Phe?Ser?Leu?Ser?Ser

85 90 95

gat?gct?acc?gga?ggt?ctc?gcc?tat?ggc?gct?gtg?gga?ggt?gcc?acc?gat 336

Asp?Ala?Thr?Gly?Gly?Leu?Ala?Tyr?Gly?Ala?Val?Gly?Gly?Ala?Thr?Asp

100 105 110

gct?gga?tac?gac?gca?ttc?gat?aac?agc?tac?gac?gag?gta?gtc?ctc?tac 384

Ala?Gly?Tyr?Asp?Ala?Phe?Asp?Asn?Ser?Tyr?Asp?Glu?Val?Val?Leu?Tyr

115 120 125

gga?aac?gga?acc?att?aac?tgg?gac?gcc?aca?tac?atg?ttc?gca?tac?cag 432

Gly?Asn?Gly?Thr?Ile?Asn?Trp?Asp?Ala?Thr?Tyr?Met?Phe?Ala?Tyr?Gln

130 135 140

gca?ctg?gga?gag?atg?acc?cgg?atc?gga?aag?tac?atc?acc?aag?ggc?ttt 480

Ala?Leu?Gly?Glu?Met?Thr?Arg?Ile?Gly?Lys?Tyr?Ile?Thr?Lys?Gly?Phe

145 150 155 160

tat?ggc?cag?tcc?agc?gac?agc?aag?gtc?tac?acc?tac?tac?gag?ggt?tgc 528

Tyr?Gly?Gln?Ser?Ser?Asp?Ser?Lys?Val?Tyr?Thr?Tyr?Tyr?Glu?Gly?Cys

165 170 175

tcc?gat?gga?gga?cgt?gag?ggt?atg?agt?caa?gtc?cag?cgc?tgg?ggt?gag 576

Ser?Asp?Gly?Gly?Arg?Glu?Gly?Met?Ser?Gln?Val?Gln?Arg?Trp?Gly?Glu

180 185 190

gag?tat?gac?ggt?gcg?att?act?ggt?gcc?ccg?gct?ttc?cgt?ttc?gct?cag 624

Glu?Tyr?Asp?Gly?Ala?Ile?Thr?Gly?Ala?Pro?Ala?Phe?Arg?Phe?Ala?Gln

195 200 205

caa?cag?gtt?cac?cat?gtg?ttc?tcg?tcc?gaa?gtg?gag?caa?act?ctg?gac 672

Gln?Gln?Val?His?His?Val?Phe?Ser?Ser?Glu?Val?Glu?Gln?Thr?Leu?Asp

210 215 220

tac?tac?ccg?cct?cca?tgt?gag?tcg?aag?aag?atc?gtg?aac?gcc?acc?att 720

Tyr?Tyr?Pro?Pro?Pro?Cys?Glu?Ser?Lys?Lys?Ile?Val?Asn?Ala?Thr?Ile

225 230 235 240

gct?gct?tgc?gac?ccg?ctt?gat?gga?aga?acc?gac?ggt?gtt?gtg?tcc?cgg 768

Ala?Ala?Cys?Asp?Pro?Leu?Asp?Gly?Arg?Thr?Asp?Gly?Val?Val?Ser?Arg

245 250 255

acg?gat?ctt?tgc?aag?ctt?aac?ttc?aat?ttg?acc?tct?atc?atc?ggt?gag 816

Thr?Asp?Leu?Cys?Lys?Leu?Asn?Phe?Asn?Leu?Thr?Ser?Ile?Ile?Gly?Glu

260 265 270

cct?tac?tac?tgt?gct?gcg?gga?act?agc?act?tcg?ctt?ggt?ttc?ggc?ttc 864

Pro?Tyr?Tyr?Cys?Ala?Ala?Gly?Thr?Ser?Thr?Ser?Leu?Gly?Phe?Gly?Phe

275 280 285

agc?aat?ggc?aag?cgc?agc?aat?gtc?aag?cgt?cag?gcc?gag?ggc?agc?acc 912

Ser?Asn?Gly?Lys?Arg?Ser?Asn?Val?Lys?Arg?Gln?Ala?Glu?Gly?Ser?Thr

290 295 300

acc?agc?tac?cag?ccc?gcc?cag?aac?ggc?acg?gtc?acc?gca?cgt?ggt?gta 960

Thr?Ser?Tyr?Gln?Pro?Ala?Gln?Asn?Gly?Thr?Val?Thr?Ala?Arg?Gly?Val

305 310 315 320

gct?gtc?gcc?cag?gcc?atc?tac?gat?ggt?ctc?cac?aac?agc?aag?ggc?gag 1008

Ala?Val?Ala?Gln?Ala?Ile?Tyr?Asp?Gly?Leu?His?Asn?Ser?Arg?Gly?Glu

325 330 335

cgc?gcg?tac?ctc?tcc?tgg?cag?att?gcc?tct?gag?ctg?agc?gat?gct?gag 1056

Arg?Ala?Tyr?Leu?Ser?Trp?Gln?Ile?Ala?Ser?Glu?Leu?Ser?Asp?Ala?Glu

340 345 350

acc?gag?tac?aac?tct?gac?act?ggc?aag?tgg?gag?ctc?aac?atc?ccg?tcg 1104

Thr?Glu?Tyr?Asn?Ser?Asp?Thr?Gly?Lys?Trp?Glu?Leu?Asn?Ile?Pro?Ser

355 360 365

acc?ggt?ggt?gag?tac?gtc?acc?aag?ttc?att?cag?ctc?ctg?aac?ctc?gac 1152

Thr?Gly?Gly?Glu?Tyr?Val?Thr?Lys?Phe?Ile?Gln?Leu?Leu?Asn?Leu?Asp

370 375 380

aac?ctt?tcg?gat?ctg?aac?aac?gtg?acc?tac?gac?acc?ctg?gtc?gac?tgg 1200

Asn?Leu?Ser?Asp?Leu?Asn?Asn?Val?Thr?Tyr?Asp?Thr?Leu?Val?Asp?Trp

385 390 395 400

atg?aac?act?ggt?atg?gtg?cgc?tac?atg?gac?agc?ctt?cag?acc?acc?ctt 1248

Met?Asn?Thr?Gly?Met?Val?Arg?Tyr?Met?Asp?Ser?Leu?Gln?Thr?Thr?Leu

405 410 415

ccc?gat?ctg?act?ccc?ttc?caa?tcg?tcc?ggc?gga?aag?ctg?ctg?cac?tac 1296

Pro?Asp?Leu?Thr?Pro?Phe?Gln?Ser?Ser?Gly?Gly?Lys?Leu?Leu?His?Tyr

420 425 430

cac?ggt?gaa?tct?gac?ccc?agt?atc?ccc?gct?gcc?tcc?tcg?gtc?cac?tac 1344

His?Gly?Glu?Ser?Asp?Pro?Ser?Ile?Pro?Ala?Ala?Ser?Ser?Val?His?Tyr

435 440 445

tgg?cag?gcg?gtt?cgt?tcc?gtc?atg?tac?ggc?gac?aag?acg?gaa?gag?gag 1392

Trp?Gln?Ala?Val?Arg?Ser?Val?Met?Tyr?Gly?Asp?Lys?Thr?Glu?Glu?Glu

450 455 460

gcc?ctg?gag?gct?ctc?gag?gac?tgg?tac?cag?ttc?tac?cta?atc?ccc?ggt 1440

Ala?Leu?Glu?Ala?Leu?Glu?Asp?Trp?Tyr?Gln?Phe?Tyr?Leu?Ile?Pro?Gly

465 470 475 480

gcc?gcc?cac?tgc?gga?acc?aac?tct?ctc?cag?ccc?gga?cct?tac?cct?gag 1488

Ala?Ala?His?Cys?Gly?Thr?Asn?Ser?Leu?Gln?Pro?Gly?Pro?Tyr?Pro?Glu

485 490 495

aac?aac?atg?gag?att?atg?atc?gac?tgg?gtc?gag?aac?ggc?aac?aag?ccg 1536

Asn?Asn?Met?Glu?Ile?Met?Ile?Asp?Trp?Val?Glu?Asn?Gly?Asn?Lys?Pro

500 505 510

tcc?cgt?ctc?aat?gcc?act?gtt?tct?tcg?ggt?acc?tac?gcc?ggc?gag?acc 1584

Ser?Arg?Leu?Asn?Ala?Thr?Val?Ser?Ser?Gly?Thr?Tyr?Ala?Gly?Glu?Thr

515 520 525

cag?atg?ctt?tgc?cag?tgg?ccc?aag?cgt?cct?ctc?tgg?cgc?ggc?aac?tcc 1632

Gln?Met?Leu?Cys?Gln?Trp?Pro?Lys?Arg?Pro?Leu?Trp?Arg?Gly?Asn?Ser

530 535 540

agc?ttc?gac?tgt?gtc?aac?gac?gag?aag?tcg?att?gac?agc?tgg?acc?tac 1680

Ser?Phe?Asp?Cys?Val?Asn?Asp?Glu?Lys?Ser?Ile?Asp?Ser?Trp?Thr?Tyr

545 550 555 560

gag?ttc?cca?gcc?ttc?aag?gtc?cct?gta?tac 1710

Glu?Phe?Pro?Ala?Phe?Lys?Val?Pro?Val?Tyr

565 570

<210>2

<211>570

<212>PRT

＜213〉aspergillus oryzae (Aspergillus oryzae)

<220>

<221>mat?peptide

<222>(1)…(570)

<400>2

Ala?Ser?Phe?Thr?Asp?Val?Cys?Thr?Val?Ser?Asn?Val?Lys?Ala?Ala?Leu

1 5 10 15

Pro?Ala?Asn?Gly?Thr?Leu?Leu?Gly?Ile?Ser?Met?Leu?Pro?Ser?Ala?Val

20 25 30

Thr?Ala?Asn?Pro?Leu?Tyr?Asn?Gln?Ser?Ala?Gly?Met?Gly?Ser?Thr?Thr

35 40 45

Thr?Tyr?Asp?Tyr?Cys?Asn?Val?Thr?Val?Ala?Tyr?Thr?His?Thr?Gly?Lys

50 55 60

Gly?Asp?Lys?Val?Val?Ile?Lys?Tyr?Ala?Phe?Pro?Lys?Pro?Ser?Asp?Tyr

65 70 75 80

Glu?Asn?Arg?Phe?Tyr?Val?Ala?Gly?Gly?Gly?Gly?Phe?Ser?Leu?Ser?Ser

85 90 95

Asp?Ala?Thr?Gly?Gly?Leu?Ala?Tyr?Gly?Ala?Val?Gly?Gly?Ala?Thr?Asp

100 105 110

Ala?Gly?Tyr?Asp?Ala?Phe?Asp?Asn?Ser?Tyr?Asp?Glu?Val?Val?Leu?Tyr

115 120 125

Gly?Asn?Gly?Thr?Ile?Asn?Trp?Asp?Ala?Thr?Tyr?Met?Phe?Ala?Tyr?Gln

130 135 140

Ala?Leu?Gly?Glu?Met?Thr?Arg?Ile?Gly?Lys?Tyr?Ile?Thr?Lys?Gly?Phe

145 150 155 160

Tyr?Gly?Gln?Ser?Ser?Asp?Ser?Lys?Val?Tyr?Thr?Tyr?Tyr?Glu?Gly?Cys

165 170 175

Ser?Asp?Gly?Gly?Arg?Glu?Gly?Met?Ser?Gln?Val?Gln?Arg?Trp?Gly?Glu

180 185 190

Glu?Tyr?Asp?Gly?Ala?Ile?Thr?Gly?Ala?Pro?Ala?Phe?Arg?Phe?Ala?Gln

195 200 205

Gln?Gln?Val?His?His?Val?Phe?Ser?Ser?Glu?Val?Glu?Gln?Thr?Leu?Asp

210 215 220

Tyr?Tyr?Pro?Pro?Pro?Cys?Glu?Ser?Lys?Lys?Ile?Val?Asn?Ala?Thr?Ile

225 230 235 240

Ala?Ala?Cys?Asp?Pro?Leu?Asp?Gly?Arg?Thr?Asp?Gly?Val?Val?Ser?Arg

245 250 255

Thr?Asp?Leu?Cys?Lys?Leu?Asn?Phe?Asn?Leu?Thr?Ser?Ile?Ile?Gly?Glu

260 265 270

Pro?Tyr?Tyr?Cys?Ala?Ala?Gly?Thr?Ser?Thr?Ser?Leu?Gly?Phe?Gly?Phe

275 280 285

Ser?Asn?Gly?Lys?Arg?Ser?Asn?Val?Lys?Arg?Gln?Ala?Glu?Gly?Ser?Thr

290 295 300

Thr?Ser?Tyr?Gln?Pro?Ala?Gln?Asn?Gly?Thr?Val?Thr?Ala?Arg?Gly?Val

305 310 315 320

Ala?Val?Ala?Gln?Ala?Ile?Tyr?Asp?Gly?Leu?His?Asn?Ser?Arg?Gly?Glu

325 330 335

Arg?Ala?Tyr?Leu?Ser?Trp?Gln?Ile?Ala?Ser?Glu?Leu?Ser?Asp?Ala?Glu

340 345 350

Thr?Glu?Tyr?Asn?Ser?Asp?Thr?Gly?Lys?Trp?Glu?Leu?Asn?Ile?Pro?Ser

355 360 365

Thr?Gly?Gly?Glu?Tyr?Val?Thr?Lys?Phe?Ile?Gln?Leu?Leu?Asn?Leu?Asp

370 375 380

Asn?Leu?Ser?Asp?Leu?Asn?Asn?Val?Thr?Tyr?Asp?Thr?Leu?Val?Asp?Trp

385 390 395 400

Met?Asn?Thr?Gly?Met?Val?Arg?Tyr?Met?Asp?Ser?Leu?Gln?Thr?Thr?Leu

405 410 415

Pro?Asp?Leu?Thr?Pro?Phe?Gln?Ser?Ser?Gly?Gly?Lys?Leu?Leu?His?Tyr

420 425 430

His?Gly?Glu?Ser?Asp?Pro?Ser?Ile?Pro?Ala?Ala?Ser?Ser?Val?His?Tyr

435 440 445

Trp?Gln?Ala?Val?Arg?Ser?Val?Met?Tyr?Gly?Asp?Lys?Thr?Glu?Glu?Glu

450 455 460

Ala?Leu?Glu?Ala?Leu?Glu?Asp?Trp?Tyr?Gln?Phe?Tyr?Leu?Ile?Pro?Gly

465 470 475 480

Ala?Ala?His?Cys?Gly?Thr?Asn?Ser?Leu?Gln?Pro?Gly?Pro?Tyr?Pro?Glu

485 490 495

Asn?Asn?Met?Glu?Ile?Met?Ile?Asp?Trp?Val?Glu?Asn?Gly?Asn?Lys?Pro

500 505 510

Ser?Arg?Leu?Asn?Ala?Thr?Val?Ser?Ser?Gly?Thr?Tyr?Ala?Gly?Glu?Thr

515 520 525

Gln?Met?Leu?Cys?Gln?Trp?Pro?Lys?Arg?Pro?Leu?Trp?Arg?Gly?Asn?Ser

530 535 540

Ser?Phe?Asp?Cys?Val?Asn?Asp?Glu?Lys?Ser?Ile?Asp?Ser?Trp?Thr?Tyr

545 550 555 560

Glu?Phe?Pro?Ala?Phe?Lys?Val?Pro?Val?Tyr

565 570

Claims (3)

1. the recombination method of an aspergillus oryzae tannase gene is cut the site according to maturation protein two terminal sequences of tannase genes encoding and the multienzyme of yeast expression vector pPIC9K, synthetic a pair of primer, and sequence is as follows:

Upstream primer, 5 ' G GAATTCGCTTCTTTTACCGATGTGTGCAC3 ';

Downstream primer, 5 ' GCG GCGGCCGC GTATACAGGGACCTTGAAGGC3 '; Obtain aspergillus oryzae tannase gene shown in SEQ ID NO:1 through pcr amplification.

2. the aspergillus oryzae tannase expression of gene method of claim 1 gained, in Pichi strain KM71, adopt methyl alcohol to carry out abduction delivering by expression vector pPIC9K-TAN, perhaps in Pichi strain KM71H, carry out constitutive expression, need not induce by expression vector pGAPZ α A-TAN and pGAPZ α A-ETAN; The expression product of dual mode is all secreted outside born of the same parents, carries out purifying and obtains reorganization aspergillus oryzae tannase shown in SEQ ID NO:2 by obtaining culture supernatants.

3. aspergillus oryzae tannase expression of gene method as claimed in claim 2, the purifying that it is characterized in that described culture supernatants are with DEAE anion exchange chromatography single step purification.

Images