CN1712536A

CN1712536A - Expression of interleukin 24 from yeast cell

Info

Publication number: CN1712536A
Application number: CN 200510057045
Authority: CN
Inventors: 邹全明; 杨珺
Original assignee: Third Military Medical University TMMU
Current assignee: Third Military Medical University TMMU
Priority date: 2005-04-28
Filing date: 2005-04-28
Publication date: 2005-12-28
Anticipated expiration: 2025-04-28
Also published as: CN100383249C

Abstract

Expression of human interleukin 24 from yeast cell is carried out by cloning IL-24 gene or IL-24 gene with base mutation, constructing them onto three expression carriers pPIC3.5K, pPIC9K or pA0815, obtaining eight expression carriers, using His-pichia GS115, KM71 or SMD1168 as host cell, endocellular soluble expressing or exocellular secretory expressing, and obtaining expression human interleukin 24. It achieves stable, higher efficiency and biological activity and correct space structure of IL-24.

Description

Method for expressing human interleukin 24 by yeast cells

Technical Field

The invention relates to the technical field of protein medicine production by utilizing a recombinant DNA technology, in particular to a method for expressing human interleukin 24 by yeast cells.

Background

The differential hybridization method of Paul.B.Fisher, university of Columbia in 1995 is used for finding a new gene related to melanoma differentiation, namely mda-7(melanoma differentiation-associatedge 7), in a melanoma cell cDNA library, and preliminary experiments prove that the mda-7 has the property of inhibiting the proliferation of melanoma and the capacity of promoting terminal differentiation in the process of melanoma. Subsequently mda-7 was studied as a tumor suppressor until the 2002 time when Caudell et al demonstrated the cytokine profile of mda-7 in a series of experiments, suggesting that mda-7 was renamed to interleukin 24(interleukin-24, IL-24) to the IL-24 family.

The IL-24 gene is located on human chromosome 1q32.2-1q41 and has 7 exons and 6 introns. IL-24 full-length mRNA was 1975bp (GENEBANK NM-006850). IL-24 has 206 amino acids, wherein 48 amino acids at the N terminal are signal peptides, which guide the secretion of IL-24 to the extracellular space for function. The molecular weight of IL-24 with signal peptide is 23.8kD, and the molecular weight of mature protein is 18.4 kD. The peptide chain of IL-24 has 3N-glycosylation sites at amino acids 85, 99 and 126. Also has 3 sites for phosphorylation of casein kinase II and 3 sites for phosphorylation of protein kinase C.

IL-24 expression is more tissue specific in human cells, predominantly in a subset of immune cells, including normal or LPS-stimulated monocytes and T cells, with further sub-classification showing approximately 15-20% CD19+ and 50-80% CD56+ as positive for IL-24 expression. IL-24 is expressed in both normal and primary melanoma cells, IL-24 expression is gradually reduced as the melanoma progresses, and IL-24 expression is barely detectable during metastasis and infiltration of the melanoma. IL-24 protein expression was not determined in over 50 tumor cell lines of different origins. Studies by Vincenti et al indicate that IL-24mRNA is strongly up-regulated by the proinflammatory cytokine, interleukin-1 β, suggesting that IL-24 is an early response gene with a stress response function.

So far, many experiments prove that the IL-24 has obvious tumor inhibition effect, can selectively inhibit the growth of various tumors and induce the apoptosis of tumor cells, including human melanoma, glioblastoma, osteosarcoma, breast cancer, cervical cancer, colon cancer, lung cancer, gastric cancer, nasopharyngeal carcinoma, prostatic cancer and the like. The inhibition effect is independent of cancer suppressor genes such as p53, Rb, p16, etc., and has no influence on normal cells. The tumor inhibition mechanism of IL-24 is not clear, so that the tumor inhibition effect is realized through various ways, the anti-tumor effect is very obvious, and the method becomes a research and development hotspot of tumor specific therapeutic drugs.

With the intensive research on the action mechanism and gene therapy of the IL-24, on one hand, the function of selectively inhibiting the tumor growth of the IL-24 is determined, and on the other hand, the clinical application range of the IL-24 is expanded; at the same time, it also shows a large demand for IL-24, so that it is necessary to produce recombinant human IL-24 with high purity and natural activity in a large scale by genetic engineering means.

The existing literature on the expression of IL-24 shows that the method focuses on the transient expression of IL-24 mediated by adenovirus in tumor cells abroad, and has very obvious effect of inducing apoptosis, and the problems of safety of adenovirus and short action effect exist. Two documents exist in China, one is that inclusion body expression is performed in escherichia coli, and the defects are that the inclusion body expression mode and protein-free post-translational modification cannot be guaranteed; secondly, transient expression in COS cells also has the problem of short action effect.

Disclosure of Invention

The invention aims to provide a method for expressing recombinant human IL-24 by yeast, in particular to a process for obtaining stable and high-efficiency expression of human interleukin 24 by using yeast cells to perform intracellular soluble expression or extracellular secretory expression, and ensuring the correct spatial structure and the biological activity of the IL-24.

The invention selects His-Pichia yeast GS115 strain, KM71 strain and SMD1168 strain, integrated expression plasmids are pPIC3.5K, pPIC9K and pAO815, 3 vectors and 3 strains are purchased from Invitrogen company of America, and are all in an expression kit (Multi-copy Pichia expression kit, catalog No. k 1750-01).

The method comprises the following steps:

1. cloning of the human IL-24 Gene: using the total mRNA of human peripheral blood mononuclear cells stimulated by ConA as a template, total cDNA was amplified by RT-PCR, and IL-24 with the original signal peptide (named mIL-24) or IL-24 without the original signal peptide (named IL-24) was amplified with IL-24 specific primers. The sequences of mIL-24 and IL-24 are identical to those published by Genbank, which has an accession number of Genbank NM-006850. Or,

cloning of human IL-24 Gene with Point mutations: using the total mRNA of the human peripheral blood mononuclear cells stimulated by ConA as a template, total cDNA was amplified by RT-PCR, and then a mutant IL-24 with the original signal peptide (named smIL-24) or a mutant IL-24 without the original signal peptide (named sIL-24) was amplified by IL-24 specific primers. The cDNA sequences of smoL-24 and sIL-24 are compared with the sequences published by Genbank, and point mutation of base is generated at the same position, and thus, an amino acid change is caused, and the sequences of nucleic acid and amino acid are shown in a sequence table 1.

2. Constructing a recombinant expression vector in vitro to transform pichia pastoris, and carrying out extracellular secretory expression and intracellular soluble expression:

1) in vitro construction of recombinant secretory expression vectors:

a) recombining IL-24 or sIL-24 with original signal sequence between multiple cloning sites EcoR1 and Not1 of an integrated expression vector pPIC9K to obtain a secretory expression vector IL-24/pPIC9K or sIL-24/pPIC9K with alpha factor; respectively recombining a fusion gene formed by connecting IL-24 or sIL-24 without an original signal sequence with an alpha-factor and mIL-24 or smIL-24 with the original signal sequence to an EcoRI site of a vector pAO815, and constructing a multi-copy expression cassette on the pAO815 in vitro by using Bgl II and BamHI endonucleases to obtain secreted multi-copy expression vectors n (alpha IL-24)/pAO815 and n (alpha sIL-24)/pAO815 with the alpha factor;

b) the mIL-24 or the smIL-24 with the original signal sequence is recombined between the multiple cloning sites BamH1 and Not1 of the integrated expression vector pPIC3.5K to obtain the secretory expression vector mIL-24/pPIC3.5K or the smIL-24/pPIC3.5K with the IL-24 self-secretion signal.

2) In vitro construction of recombinant intracellular soluble expression vectors:

the IL-24 or sIL-245' end without the original signal sequence is added with an initiation codon ATG and recombined between the multiple cloning sites EcoR1 and Not1 of the vector pPIC3.5K to obtain a soluble expression vector:

(3) transformation of pichia pastoris: the recombinant plasmid is cut into linear plasmid by restriction enzyme Sal I or Sac I, and pichia pastoris is transformed by an electroporation method or a protoplast method; the soluble expression vector is transformed into an SMD1168 yeast strain to obtain a recombinant yeast strain IL-24/pPIC3.5K/SMD1168 or sIL-24/pPIC3.5K/SMD 1168; the secretory expression vector is used for transforming yeast strains GS115 or KM71 respectively to obtain recombinant yeast strains IL-24/pPIC9K/GS115, sIL-24/pPIC9K/GS115, mIL-24/pPIC3.5K/GS115, smIL-24/pPIC3.5K/GS115, n (alpha IL-24)/pAO815/GS115, n (alpha smIL-24)/pAO815/GS115, IL-24/pPIC9K/KM71, sIL-24/pPIC9K/KM71, mIL-24/pPIC3.5K/KM71 or IL-24/pPIC3.5K/KM 71.

3. Pichia pastoris expresses human IL-24: adding methanol into the Pichia pastoris culture medium for induction expression, wherein the final concentration of the methanol is 0.2-1.0%, the temperature is 28-30 ℃, the induction time is 3-14 days, the target protein is secreted and subjected to soluble expression according to the expectation, and the expression amount is 4-195 mg/L.

The secretory expression human active protein IL-24 in pichia pastoris has good advantages: firstly, it can prevent the degradation of host bacteria to the expression product, reduce the load of host cell metabolism and the toxic effect of the expression product to the host; secondly, the secretory protein can be promoted to fold in a proper mode and the natural conformation and activity of the secretory protein can be recovered; and thirdly, the pichia pastoris is moderately glycosylated and modified while expressing the recombinant protein, because the pichia pastoris has N-connected sugar chains with moderate length and a small amount of 0-connection, and the core part of the sugar chains has no alpha-1, 3 glycosidic bond, the superantigen reaction can not be caused, the use safety is improved, and the bioactivity of the glycosylated protein is also facilitated. The secretory alpha-factor on the yeast carrier and the signal peptide of IL-24 are used for guiding the secretion expression of the target gene. The target protein is secreted into the culture solution in a large amount, an accurate disulfide bond and a correct spatial structure can be formed, and the natural activity of the IL-24 is maintained; because the protein in host thallus cells is not influenced, the purification process is reduced, and the recovery rate is improved; meanwhile, the yeast cell has simple structure, rapid growth, easy culture and fermentation, low production cost and high yield of the target protein.

The patent uses eukaryotic yeast to express IL-24, and adopts secretory expression or soluble expression and proper post-modification to ensure its biological activity and obtain great amount of stable protein.

Drawings

FIG. 1: the construction schematic diagram of the recombinant plasmids IL-24/pPIC9K and sIL-24/pPIC 9K;

FIG. 2: a schematic diagram of the construction of recombinant plasmids mIL-24/pPIC3.5K and smIL-24/pPIC3.5K;

FIG. 3: a schematic construction diagram of recombinant plasmids IL-24/pPIC3.5K and sIL-24/pPIC3.5K;

FIG. 4: schematic diagrams of recombinant plasmids n (alpha IL-24)/pAO815 and n (alpha smIL-24)/pAO 815.

Detailed Description

1. Cloning of the human IL-24 complete Gene:

taking 5ml of the anti-coagulation of a healthy person, and collecting a leucocyte layer by using lymphocyte separation liquid; hank's liquid washing twice, adding RPMI1640 complete culture medium and ConA with the total concentration of 25 mu g/ml, incubating at 37 ℃ and 5% CO2 for 48 h; centrifugally collecting human peripheral blood mononuclear cells, and extracting total RNA; IL-24cDNA was synthesized from mRNA under reverse transcription conditions of 30 ℃ for 10s, 50 ℃ for 30s, 99 ℃ for 5s, 5 ℃ for 5s, 1 cycle. The three primers are as follows:

p1: 5 'CGGCATATGAATTTTCAACAGAGGC 3' containing an EcoR1 cleavage site;

p2: 5 'CCATGGCGGCCCAGGGCCAAGAATTCC 3' containing an EcoR1 cleavage site;

p3: 5 'GGATCCTTACAGAGCTTGTAGAATTTCTG 3', containing a Not1 cleavage site;

PCR reactions were performed with a pair of primers P1 and P3 under the following conditions: 5min at 94 ℃, 1min at 55 ℃, 1min at 72 ℃ and 30 cycles; amplifying the smIL-24 or mIL-24 at 72 ℃ for 10 min; PCR reactions were performed with a pair of primers P2 and P3 under the following conditions: 5min at 94 ℃; 1min at 94 ℃, 1min at 60 ℃, 1min at 72 ℃ and 30 cycles; amplifying the smIL-24 or mIL-24 at 72 ℃ for 10 min. The obtained DNA fragments are respectively connected to a high-efficiency cloning vector pMD18-T (purchased from Dalian TAKARA company) to obtain recombinant plasmids IL-24/pMD18-T, sIL-24/pMD18-T, mIL-24/pMD18-T or smIL-24/pMD18-T, and the recombinant plasmids are identified by PCR, enzyme digestion and nucleic acid sequencing.

2. The construction method of the Pichia pastoris integrated expression vector comprises the following steps:

2.1) Pichia pastoris strains GS115, KM71 and SMD168 used in the invention and their expression vectors pPIC3.5K, pPIC9K, pAO815 were all from Invitrogen.

2.2) construction of recombinant plasmids for yeast expression the following procedure was followed:

2.2.1) construction of recombinant secretory Yeast expression vectors in vitro

2.2.1.1) construction method of recombinant secretory yeast expression vector IL-24/pPIC9K or sIL-24/pPIC 9K:

2.2.1.1.1) the recombinant plasmid IL-24/pMD18-T or sIL-24/pMD18-T is double digested with EcoR I and Not I to obtain the target fragment IL-24 or sIL-24, the reaction solution comprises the following components, the endonuclease and the buffer solution are both purchased from Dalian TAKARA company,

recombinant plasmid 50. mu.l

10×H buffer 10μl

BSA 10μl

Not I 10U

Sterile water Up to 100. mu.l

Total volume 100. mu.l

2.2.1.1.2) the expression vector pPIC9K was digested with EcoR I and Not I to obtain vector fragments, the reaction solution was composed as follows, the endonuclease and buffer were purchased from Dalian TAKARA,

expression vector 50. mu.l

10×H buffer 10μl

BSA 10μl

Not I 10U

Sterile water Up to 100. mu.l

Total volume 100. mu.l

2.2.1.1.3) when the size of the target DNA fragment and the vector fragment obtained by the above enzyme digestion reaction is in accordance with the expected size, the target fragment and the vector fragment are recovered by using a DNA gel recovery kit, purchased from Shanghai Shenyou company, and the specific operation is carried out according to the kit instruction.

2.2.1.1.4) ligation: t4 DNA ligase (purchased from MBI, USA) ligated the above recovered target fragment and vector fragment DNA into recombinant yeast expression plasmid IL-24/pPIC9K or sIL-24/pPIC9K, as shown in FIG. 1, the reaction solution was composed as follows, ligated at 22 ℃ overnight.

10 μ l of the fragment of interest

Vector fragment 5. mu.l

10×ligase buffer 2μl

T4 ligase 1μl

Sterile water 2. mu.l

Total volume 20. mu.l

2.2.1.1.5) transformation competent bacteria DH5 α: coli competence was prepared according to the conventional method (molecular cloning, A laboratory Manual, second edition, science Press 1999, SammBruker et al). Mixing 10 μ l of the ligation product with 100 μ l of competent bacteria at 4 deg.C for 30min, 42 deg.C for 2min, 4 deg.C for 10 min; then adding 500 mul LB culture solution, culturing at 37 deg.C for 30min for 60 min; and (3) centrifuging at room temperature for 1min at 6000rpm, removing 550 mu l of supernatant, resuspending the bacterial precipitate in the residual solution, coating all bacterial solutions on Amp + LB plates, and culturing at 37 ℃ for 18 hours.

2.2.1.1.6) enzyme cutting identification: randomly selecting 4 single colonies, inoculating the single colonies into 5ml Amp + LB culture solution, performing shaking culture at 37 ℃ for 16 hours, using extracted plasmids, purchasing from Shanghai Shenyou company, and operating according to the kit instructions. The enzyme digestion system consists of:

recombinant Yeast expression plasmid 50. mu.l

10×H buffer 10μl

BSA 10μl

Not I 10U

Sterile water Up to 100. mu.l

Total volume 100. mu.l

2.2.1.2) construction method of recombinant secretory yeast expression vector mIL-24/pPIC3.5K or smIL-24/pPIC3.5K: the target DNA fragment mIL-24/or smIL-24 was excised from the recombinant plasmid mIL-24/pMD18-T or smIL-24/pMD18-T with EcoR I and Not I dual enzymes according to the method of 2.2.1.1, inserted into the expression vector pPIC3.5K, respectively, and ligated with the recombinant yeast expression plasmid mIL-24/pPIC3.5K or smIL-24/pPIC3.5K. As shown in fig. 2.

2.2.1.3) secretory multicopy expression vector n (. alpha.IL-24)/pAO 815 or n (. alpha.sIL-24)/pAO 815.

2.2.1.3.1) construction method: connecting a secretion signal sequence alpha-factor of yeast to the 5 ' end of the IL-24 or the sIL-24 to form a fusion gene alpha IL-24 or alpha sIL-24, and adding an enzyme digestion sequence of EcoR I to the 5 ' end and the 3 ' end of the fusion gene for enzyme digestion of the EcoR I; simultaneously, the plasmid pAO815 is cut by EcoR I enzyme at 37 ℃ for 2 hours; adding phenol/chloroform with the same volume, oscillating, and centrifuging at 13200rpm for 5 min; adding equal volume of chloroform into the supernatant, oscillating, and centrifuging at 13200rpm for 5 min; taking the supernatant, adding 1/103M NaAc and 2 times of absolute ethyl alcohol, and carrying out 30min at-30 ℃; centrifuging at 13200rpm at 4 deg.C for 10min, collecting supernatant, rinsing the precipitate with 70% cold ethanol twice, and drying at room temperature; the precipitate was suspended by adding sterile water at pH 8.0.

The EcoR I enzyme cuts the dephosphorylation of the pAO815 plasmid, the reaction system is as follows, dephosphorylation enzyme CIAP and buffer solution are purchased from TAKARA company:

pAO815/EcoR I 20μl

10×CIAP buffer 5μl

CIAP 3μl

sterile water up to 50 μ l

30min at 37 ℃. Extracting with phenol/chloroform, connecting with EcoR I enzyme-cut alpha IL-24 or alpha sIL-24, transforming competent Escherichia coli, plating for culturing, selecting single colony, inoculating Amp + LB liquid for shaking culture, extracting plasmid, EcoR I enzyme-cut to identify whether the target gene is recombined on pAO815 plasmid (the method is the same as above); then HindIII and BamH I are used for identifying the positive and negative directions of the target gene of the recombinant plasmid:

10. mu.l of recombinant plasmid

10×K buffer 2μl

BamH I 5U

HindIII 5U

Sterile water up to 20 μ l

10. mu.l of the gel was subjected to 1% agarose electrophoresis at 37 ℃ for 3 hours, observed under an ultraviolet lamp, and photographed. If there is a fragment of about 400bp in addition to about 7.7kb, it indicates that the target fragment is in the forward direction on the pAO815 vector, and if there is no 400bp band, it is in the reverse direction.

2.2.1.3.2) the recombinant plasmid alpha IL-24/pAO815 or alpha sIL-24/pAO815 constructed by the method is cut by Bgl I and BamH I respectively, and the segment of about 2200bp is recovered, namely a single copy expression cassette, purified solution is added with T4 ligase and buffer solution thereof, 20 mul is totally, and overnight ligation reaction is carried out at 16 ℃; then adding Bgl II 2U, BamH I2U, 10 xKbuffer 10 μ l and sterile water to 100 μ l, and carrying out 2 hours at 37 ℃ in order to carry out enzyme digestion to eliminate head-head, tail-tail connected expression cassettes; the enzyme digestion product is connected with a corresponding recombinant plasmid (containing a corresponding single copy expression cassette) which is cut by BamH I and dephosphorylated after phenol/chloroform extraction and ethanol precipitation (the method is the same as the above), E.coli DH5 alpha is transformed, a single colony is picked up, the plasmid is extracted, Bgl II and BamH I are used for enzyme digestion identification and screening, besides 4028bp and 2393bp, 2039bp (alpha IL-24/pAO815 or alpha sIL-24/pAO815) or 4076bp (2 x alpha IL-24/pAO815 or 2 x alpha sIL-24/pAO815) or 6117bp (3 x alpha IL-24/pAO815 or 3 x alpha sIL-24/pAO8152039) … … is observed through electrophoresis, the band and the plasmid band of the multiple copy expression cassettes of 1, 2 and 3 … … are selected, and the pichia pastoris recombinant plasmid containing the most copies is further transformed. Wherein 8 (. alpha.IL-24)/pAO 815 and 8 (. alpha.smil-24)/pAO 815 were constructed as shown in FIG. 4.

2.2.2) in vitro construction of recombinant intracellular soluble expression vectors

The desired DNA fragment IL-24/or sIL-24 was excised from the recombinant plasmid IL-24/pMD18-T or sIL-24/pMD18-T using EcoR I and Not I dual enzymes according to the method 2.2.1.1, inserted into the expression vector pPIC3.5K, respectively, and ligated to the recombinant yeast expression plasmid IL-24/pPIC3.5K or sIL-24/pPIC3.5K. As shown in fig. 3

2.3) transforming Pichia pastoris with the recombinant vector and screening yeast transformants of the multi-copy expression cassette in vivo:

2.3.1) after the recombinant plasmid constructed in the way is subjected to Sal I enzyme digestion linearization, the recombinant plasmid is integrated on a pichia pastoris chromosome by using an electroporation method or a protoplast method.

2.3.1.1) electroporation:

inoculation of His^-Single colonies of Pichia pastoris GS115, KM71 and SMD1168 are cultured in 500ml YPD culture solution overnight to OD₆₀₀About 1.3 to about 1.5. Centrifuging at 4 deg.C and 3000rpm for 5min, collecting cells, and precipitating with 250ml frozen sterile water; the yeast cells were suspended in 1ml sorbitol after washing twice with frozen sterile water and twice with frozen 1M sorbitol. Mu.g of the linearized DNA digested with Sal I was taken, mixed with 80. mu.l of electroporation competent cells in a frozen 0.2cm electroporation cuvette and incubated for 5 minutes on ice.

Employing an electrotransfer instrument BIO-RAD Gene Pulse Xcell^TMIn the Electroporation System, Electroporation was performed at a voltage of 2000V, a capacitance of 25. mu.F and a resistance of 200. omega. and then 1ml of frozen 1M sorbitol was added, and 200. mu.l of the solution was applied to an MD plate. Culturing at 30 deg.C, and selecting single colony. Obtaining recombinant yeast strains IL-24/pPIC9K/GS115, sIL-24/pPIC9K/GS115, mIL-24/pPIC3.5K/GS115, smIL-24/pPIC3.5K/GS115, 8 (. alpha.IL-24)/pAO 815/GS115, 8 (. alpha.smIL-24)/pAO 815/GS115, IL-24/pPIC9K/KM71, sIL-24/pPIC9K/KM71, mIL-24/pPIC3.5K/KM71 or smIL-24/pPIC3.5K/KM 71;

2.3.1.2) protoplast method:

His^-pichia pastoris GS115, KM71 and SMD1168 are cultured to OD₆₀₀Centrifuging at 3000rpm for 5min at room temperature at 0.2-0.3, and collectingThe cells were collected, washed sequentially with 20ml of sterile water, 20ml of SED, 20ml of 1M sorbitol, and 20ml of SCE, and finally resuspended in 1ml of SCE solution. Mu.l of 1mg/ml Lyticase (Sigma product) was added, the cell walls were digested at 30 ℃ for about 15min, centrifuged at 2500rpm for 5min to obtain protoplasts, which were washed 1 time with 20ml of 1M sorbitol and 20ml of CaS, and finally suspended in 0.6ml of CaS. And (3) adding 10 mu g of recombinant plasmid linearized by Sal I enzyme into 100 mu l of protoplast, incubating for 10min at room temperature, adding 1ml of PEG/Cat, incubating for 10min at room temperature, centrifuging for 10min at 2000rpm at room temperature, suspending the precipitate with 150 mu l of SOS solution, standing for 20min at room temperature, slowly mixing with 850 mu l of 1M sorbitol, mixing 100 mu l of the precipitate with 2ml of RD soft agar upper layer culture medium, coating an RD plate, and culturing for 6 days at 30 ℃. Single colonies were picked. Obtaining recombinant yeast strains IL-24/pPIC9K/GS115, sIL-24/pPIC9K/GS115, mIL-24/pPIC3.5K/GS115, smIL-24/pPIC3.5K/GS115, 8 (. alpha.IL-24)/pAO 815/GS115, 8 (. alpha.smIL-24)/pAO 815/GS115, IL-24/pPIC9K/KM71, sIL-24/pPIC9K/KM71, mIL-24/pPIC3.5K/KM71 or smIL-24/pPIC3.5K/KM 71;

2.3.2) G418 selection of Yeast transformants with multiple copies of the expression cassette:

50 recombinants were selected from RD plates or MD plates and inoculated on MD plates, then inoculated on 96-well plates containing 200. mu.l YPD culture medium for three passages to make the concentration of each recombinant substantially uniform, 10. mu.l each was inoculated on YPD plates containing different concentrations of G418(0.25, 0.5, 1.0, 2.0, 3.0, 4.0mg/ml) and cultured at 30 ℃. Recombinants (i.e., transformants containing multiple copies of the expression cassette) resistant to high concentrations were selected for inducible expression.

2.4) Pichia transformants induced expression of human IL-24 protein:

the resulting recombinant yeast strains IL-24/pPIC9K/GS115, sIL-24/pPIC9K/GS115, mIL-24/pPIC3.5K/GS115, smIL-24/pPIC3.5K/GS115, 8 (. alpha.IL-24)/pAO 815/GS115, 8 (. alpha.smIL-24)/pAO 815/GS115, IL-24/pPIC9K/KM71, sIL-24/pPIC9K/KM71, mIL-24/pPIC3.5K/KM71 or smIL-24/pPIC3.5K/KM71 single colonies were inoculated into 20ml of BMGY, cultured with shaking at 30 ℃ for 48 hours, the cells were collected and suspended in 10ml of BMMY, cultured with shaking at 30 ℃ and sampled for 1ml every 12 hours and supplemented with 0.5% methanol every 24 hours. Separating the supernatant for 5 days, performing SDS-PAGE and WesternBlotting according to a conventional method for identification and detection, and screening the recombinants with high expression level for mass induction culture.

The recombinant yeast strains IL-24/pPIC9K/GS115, sIL-24/pPIC9K/GS115, mIL-24/pPIC3.5K/GS115, smIL-24/pPIC3.5K/GS115, 8 (alpha IL-24)/pAO815/GS115, 8 (alpha smIL-24)/pAO815/GS115, IL-24/pPIC9K/KM71, sIL-24/pPIC9K/KM71, mIL-24/pPIC3.5K/KM71 or smIL-24/pPIC3.5K/KM71 are obtained from the different recombinant expression strains, and all have certain expression. Wherein the expression level of the two recombinant strains of 8 (alpha IL-24)/pAO815/GS115 and 8 (alpha smIL-24)/pAO815/GS115 is the highest and reaches 195 mg/L. But also secreted and soluble expression forms facilitate subsequent purification and maintenance of their biological activity.

The solution formulation used in the above method:

LB medium (pH to 7.0):

tryptone 10g

Yeast extract 5g

NaCl 10g

Adding 2% agar into LB solid culture medium

YPD medium:

peptone 2%

Yeast extract 1%

2 percent of glucose

Agar was added to the YPD solid medium at a concentration of 2%.

MD solid Medium:

1.34% of nitrogenous base of yeast

Biotin 4X 10^-5％

2 percent of glucose

Agar 2%

RD solid medium:

1.34% of nitrogenous base of yeast

Biotin 4X 10^-5％

2 percent of glucose

Sorbitol 1M

Histidine-free mixed amino acids 0.005%

Upper soft agar 0.8%

Lower agar 2%

5.SCE：

Sorbitol 1M

EDTA 1mM

Citric acid buffer (pH5.8) 10mM

6.SED

1ml DTT +19ml SE (1M sorbitol, 25mM EDTA (pH8.0)

7.CaS

Sorbitol 1M

Tris-HCl(pH7.5) 10mM

CaCl₂ 10mM

8.SOS

Sorbitol 1M

YPD 0.3 times

CaCl₂ 10mM

9.CaT

Tris pH7.5 20mM

CaCl₂ 20mM

10.BMGY

Peptone 2%

Yeast extract 1%

1.34% of nitrogenous base of yeast

Biotin 4X 10^-5％

2 percent of glucose

Potassium phosphate buffer pH6.0100 mM

1% of glycerol

11.BMMY

Peptone 2%

Yeast extract 1%

1.34% of nitrogenous base of yeast

Biotin 4X 10-5%

2 percent of glucose

Potassium phosphate buffer pH6.0100 mM

0.5 percent of methanol

Sequence listing

<110> the third military of the people's liberation army of China

<120> method for expressing human interleukin 24 by yeast cell

<130>

<160>3

<210>1

<211>473

<212>DNA

<213> human interleukin 24

<400>1

cagggccaag aattccactt tgggccctgc caagtgaagg gggttgttcc ccagaaactg 60

tgggaagcct tctgggctgt gaaagacact atgcaagctc aggataacat cacgagtgcc 120

cggctgctgc agcaggaggt tctgcagaac gtctcggatg ctgagagctg ttaccttgtc 180

cacaccctgc tggagttcta cttgaaaact gttttcaaaa actaccacaa tagaacagtt 240

gaagtcagga ctctgaagtc attctctact ctggccaaca actttgttct catcgtgtca 300

caactgcaac ccagtcaaga aaatgagatg ttttccatca gagacagtgc acacaggcgg 360

tttctgctat tccggagagc attcaaacag ttggacgtag aagcagctct gaccaaagcc 420

cttggggaag tggacattct tctgacctgg atgcagaaat tctacaagct ctg 473

<210>2

<211>473

<212>DNA

<213> human interleukin 24 having one base mutation

<400>2

cagggccaag aattccactt tgggccctgc caagtgaagg gggttgttcc ccagaaactg 60

tgggaagcct tctgggctgt gaaagacact atgcaagctc aggataacat cacgagtgcc 120

cggctgctgc agcaggaggt tctgcagaac gtctcggatg ctgagagctg ttaccttgtc 180

cacaccctgc tggagttcta cttgaaaact gttttcaaaa accaccacaa tagaacagtt 240

gaagtcagga ctctgaagtc attctctact ctggccaaca actttgttct catcgtgtca 300

caactgcaac ccagtcaaga aaatgagatg ttttccatca gagacagtgc acacaggcgg 360

tttctgctat tccggagagc attcaaacag ttggacgtag aagcagctct gaccaaagcc 420

cttggggaag tggacattct tctgacctgg atgcagaaat tctacaagct ctg 473

<210>3

<211>158

<212>PRT

<213> human interleukin 24

<400>3

Ala Gln Gly Gln Glu Phe His Phe Gly Pro Cys Gln Val Lys Gly Val

1 5 10 15

Val Pro Gln Lys Leu Trp Glu Ala Phe Trp Ala Val Lys Asp Thr Met

20 25 30

Gln Ala Gln Asp Asn Ile Thr Ser Ala Arg Leu Leu Gln Gln Glu Val

35 40 45

Leu Gln Asn Val Ser Asp Ala Glu Ser Cys Tyr Leu Val His Thr Leu

50 55 60

Leu Glu Phe Tyr Leu Lys Thr Val Phe Lys Asn Tyr His Asn Arg Thr

65 70 75 80

Val Glu Val Arg Thr Leu Lys Ser Phe Ser Thr Leu Ala Asn Asn Phe

85 90 95

Val Leu Ile Val Ser Gln Leu Gln Pro Ser Gln Glu Asn Glu Met Phe

100 105 110

Ser Ile Arg Asp Ser Ala His Arg Arg Phe Leu Leu Phe Arg Arg Ala

115 120 125

Phe Lys Gln Leu Asp Val Glu Ala Ala Leu Thr Lys Ala Leu Gly Glu

130 135 140

Val Asp Ile Leu Leu Thr Trp Met Gln Lys Phe Tyr Lys Leu

145 150 155

Claims

1. A method for expressing human interleukin 24 by yeast cells is characterized in that: it selects His^-The Pichia pastoris GS115 strain, KM71 strain or SMD1168 strain is used as a host cell, and the integrative expression plasmid is pPIC3.5K, pPIC9K or pAO 815; the method comprises the following steps:

(1) cloning of the human IL-24 Gene: using total mRNA of a ConA stimulated human peripheral blood mononuclear cell as a template, firstly amplifying total cDNA by RT-PCR, and then amplifying IL-24 or mutant IL-24 with an original signal peptide by using an IL-24 specific primer, namely named mIL-24 or smIL-24, or amplifying IL-24 or mutant IL-24 without the original signal peptide, namely named IL-24 or sIL-24; the cDNA sequences of IL-24 and mIL-24 are completely consistent with the sequence disclosed by GENBANK, the cDNA sequences of smIL-24 and sIL-24 are compared with the sequence disclosed by Genbank, point mutation of basic groups occurs at the same position, and thus, an amino acid change is caused, and the sequence table 1 of nucleic acid and amino acid is shown in the sequence table;

(2) in vitro construction of recombinant expression vectors, which may be secretory expression vectors or soluble expression vectors:

1) in vitro construction of recombinant secretory expression vectors:

a) respectively recombining IL-24 or sIL-24 without an original signal sequence between the multiple cloning sites EcoR1 and Not1 of the integrative expression vector pPIC9K to obtain a secretory expression vector IL-24/pPIC9K or sIL-24/pPIC9K with alpha factor; or, the fusion gene formed by connecting IL-24 and sIL-24 without original signal sequence with alpha-factor is recombined to the EcoR I site of the vector pAO815, Bgl II and BamH I endonucleases are used to construct a multi-copy expression cassette on pAO815 in vitro, and the secretory multi-copy expression vectors with alpha factor, n (alpha IL-24)/pAO815 and n (alpha sIL-24)/pAO815, are obtained;

b) respectively recombining mIL-24 or smIL-24 with an original signal sequence between multiple cloning sites BamH1 and Not1 of an integrated expression vector pPIC3.5K to obtain a secretory expression vector mIL-24/pPIC3.5K or smIL-24/pPIC3.5K with an IL-24 self-secretory signal;

adding an initiation codon ATG to the end of IL-24 or sIL-245 'without an original signal sequence, and respectively recombining the end of the IL-24 or sIL-245' into a multi-cloning site EcoR1 and Not1 of a vector pPIC3.5K to obtain soluble expression vectors IL-24/pPIC3.5K and sIL-24/pPIC3.5K;

(3) transformation of pichia pastoris: the recombinant plasmid is cut into linear plasmid by restriction enzyme Sal I or Sac I, and pichia pastoris is transformed by an electroporation method or a protoplast method; the soluble expression vector is transformed into an SMD1168 yeast strain to obtain a recombinant yeast strain IL-24/pPIC3.5K/SMD1168 or sIL-24/pPIC3.5K/SMD 1168; the secretory expression vector is used for transforming yeast strains GS115 or KM71 respectively to obtain recombinant yeast strains IL-24/pPIC9K/GS115, sIL-24/pPIC9K/GS115, mIL-24/pPIC3.5K/GS115, smIL-24/pPIC3.5K/GS115, 8 (alpha IL-24)/pAO815/GS115, 8 (alpha smIL-24)/pAO815/GS115, IL-24/pPIC9K/KM71, sIL-24/pPIC9K/KM71, mIL-24/pPIC3.5K/KM71 or IL-24/pPIC3.5K/KM 71;

(4) pichia pastoris expresses human IL-24.

2. The method of claim 1, wherein: the Pichia pastoris expression human IL-24 is induced and expressed by adding methanol into a Pichia pastoris culture medium, wherein the final concentration of the methanol is 0.2-1.0%, the temperature is 28-30 ℃, the induction time is 3-14 days, the target protein is secreted and expressed in a soluble way as expected, and the expression amount is 4-195 mg/L.