CN1904041A - Human recombination phospholipase D2, its preparation method and application in preparation medicine - Google Patents
Human recombination phospholipase D2, its preparation method and application in preparation medicine Download PDFInfo
- Publication number
- CN1904041A CN1904041A CNA2005100191724A CN200510019172A CN1904041A CN 1904041 A CN1904041 A CN 1904041A CN A2005100191724 A CNA2005100191724 A CN A2005100191724A CN 200510019172 A CN200510019172 A CN 200510019172A CN 1904041 A CN1904041 A CN 1904041A
- Authority
- CN
- China
- Prior art keywords
- cell
- polynucleotide
- polypeptide
- sequence
- rhpld2
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Enzymes And Modification Thereof (AREA)
Abstract
The present invention discloses a human recombinant phospholipase D2, its preparation method and application of it in preparation of medicine. Said invention also provides a human recombinant phospholipase D2 mutamer and its polynucleotide sequence for coding said protein polypeptide. At the same time said invention also provides the preparation method of said protein polypeptide and polynucleotide and provides their medicinal functions of resisting inflammation, resisting asthma and resisting leukemia cell, etc.
Description
The invention describes human recombination phospholipase D 2 (recombinant human phospholipase D2, rhPLD2), extremely the encode polynucleotide sequence of this protein polypeptide of a kind of human phosphatidase D2 allosteric body.Illustrated the preparation method of this protein polypeptide and polynucleotide simultaneously; And done the statement of science with regard to the research of functions such as its anti-inflammatory, anti-asthma, leukemia cell (HL-60) apoptosis.Particularly importantly the clinical value of this protein polypeptide and polynucleotide and huge DEVELOPMENT PROSPECT have been indicated.
One, the field comprises following content under technical field the present invention.
(1) molecular biology category.
(2) protein molecular research field.
(3) immunologic function research field.
(4) disease treatment medical research field.
Two, background technology
(1) molecular biology: the application's main body is human recombination phospholipase D 2 (rhPLD2).And this protein is to extract mRNA from the Daudi cell, through shear, the splicing allosteric, the clone has obtained not contain film combining site and signal peptide, 631 amino acid whose PLD2 cDNA sequences of codified.
(2) protein molecular research:, obtained to have the rhPLD2 protein product of certain biologic activity by the genetic expression of above-mentioned PLD2 cDNA sequence, proteic separation and purifying.
(3) immunologic function research.
1. with the relation of cytodifferentiation
PLD extensively is present in the mammalian cell, and relevant with the differentiation of various types of cells.Recently, two kinds of relevant PLD isozymes: PLD1 and PLD2 are cloned.The activity of PLD1 is regulated by protein kinase C and small molecular weight adenosine triphosphate (GTP) conjugated protein (Arf, Rho family) external.By contrast, PLD2's is active high, and to these catalyzer no responses.In the differentiation and apoptosis of various cells, the PLD of cell mRNA level active and these isozymes has very big change.Experimental observation is arranged in the apoptotic process of Jurkat T cell the activity of this class PLD sharply increase.The PLD activity is controlled in translation skill in some cases, and in the differentiation of mammalian cell, PLD plays a role in survival and the apoptosis.The interaction of extracellular signaling molecule and cell surface receptor often activates PLD-mediation Yelkin TTS and other phosphatide, produces phosphatidic acid.The activation of PLD is assert to bring into play important effect in the adjusting of cell function and destiny.
2. with the relation of acceptor
FcgammaRI, human high-affinity IgG acceptor are responsible for the internalization and the lysosomal degraded of secondary of immunocomplex.We cause the little bubble structure of temporary transient swelling in this proof has been closed immunocomplex on interferon-gamma precursor cell U937 FcgammaRI polymerization.The inclusion body in late period of possible swelling disappears after immunocomplex is degraded.Wortmannin and LY294002 is the specific inhibitor of PI3-kinases, can postpone the disappearance of these structures, correspondingly suppresses the immunocomplex degraded by the FcgammaRI mediation.These inhibitor also can postpone the immunocomplex endocytosis by FcgammaRI mediation in addition, and stop PLD activity-PLD by the FcgammaRI mediation a kind ofly to transport relevant enzyme with film.This explanation PLD and immunocomplex endocytosis are closely related.The endocytosis of immunocomplex and people's high-affinity IgG receptor activation PLD need tangible phosphoinositide-3 kinase activity.
3. with the relation of cytokine
Found that EGF can cause cell PLD2 activation, but what be worth inquiring into is that the activity of EGF-R is at all unaffected.What other two kinds of energy activated PLD in ARF-dependence mode is acceptor-Tyrosylprotein kinase agonist: as Regular Insulin, PDGF.Thisly can may be PLD2 with the interactional Phospholipid hydrolase of Regular Insulin, because the effect of Regular Insulin can be by the PLD2 of immobilized non-enzymatic activity blocking-up, and immobilized PLD1 can not block the effect that Regular Insulin causes.It has been generally acknowledged that chemotactic cytokine may be by different signaling mechanism mediations in the function of inflammatory conditions, wherein importantly Small GTPases is regulated the cytoskeleton rearrangement, participate in cell adhesion and chemotaxis, and the generation of mediation Phospholipase D (PLD) activation and peroxide oxidation enzyme.
(4) disease treatment medical research:
PLD can by multiple inflammatory mediator (platelet activation factor, IL-1, IL-4, IL-8, IFN-γ, chenotactic peptide etc.), hormone, cytokine, neurotransmitter, oxygenant, intracellular toxin (lipopolysaccharide, LPS) and many extracellulars signal activation such as somatomedin and bring into play the effect of this enzyme in the inflammatory reaction process.Have the scholar to find that phosphatidylinositol diphosphate and phosphatidyl three inositols can directly activate PLD, phosphatidylinositols does not then possess this biological function.Can be after this enzyme activates by following approach performance biological effect, 1. direct or indirect product P A, DG, the LPA of PLD are the second messenger; 2. will change the biological property of film behind the important composition phosphatidylcholine on the PLD hydrolysis cytolemma.At present, there is research to think that this process of PLD hydrolysis PC has very important biological action in such as physiology, pathologic processes such as inflammatory reaction, cell fission and apoptosis.1. with the relation of inflammation
PLD plays a significant role in signal conduction and the process by chemotactic polypeptide fMet-Leu-Phe stimulation polymorphonuclear leucocyte generation super-oxide (in the respiratory burst) by Yelkin TTS.The phosphoesterase D of EOS has the effect of deactivation PAF.And PAF be at present known in transformation reactions the strongest inflammatory factor of proinflammatory effect, its effect is equivalent to 1000 times of other inflammatory mediator approximately.
2. with the relation of disease
1) ovum reel silk from cocoons ovarian follicle obturation
Although having proved ovum reel silk from cocoons ovarian follicle obturation is by due to the apoptosis of granulosa cell, the interior conducted signal approach of cell that relates to apoptotic cell death still seldom is described.The granulocyte that detects granulocyte solute and immune labeled cultivation with Western blot confirms the antigenic expression of Fas.Granulocyte mixes with anti-Fas mAb and causes important sphingophospholipid hydrolysis, and follows increasing of endogenous ceramide levels.Result of study shows that perhaps Fas/ ceramide signal pathway plays a role in the granulocyte apoptosis; And think that the PLD/DAG approach may connect Fas/ ceramide approach in the granulocyte apoptosis.
2) tuberculosis
ATP inductive human mast cell Kill hinders the participation that the toxicity tubercule bacillus is wanted PLD.There is proof ATPe to promote the gulp down Kill of patient's scavenger cell, and emphasizes that the activation of PLD brings into play this keying action in this process the toxicity tubercule bacillus.Being proved to be with the vaccine of gene detoxification PLD preparation to have anti-pseudotuberculosis coryneform bacteria-cause that the cheesy woods of sheep fawns on inflammation, and effective to small part.On antigen presenting cell (APC), thereby CTLA-4 combines the antigen that directly merges immunity induction site with B7.Proved with the DeltaPLD of dna encoding relatively, target DeltaPLD (with CTLA-4 as target antigen) increases speed, quantity and the time of antibody response significantly as a kind of fusion rotein.All DeltaPLD sheep vaccines with dna encoding, with those with irrelevant plasmid immune or non-immune group more all can play a protective role preferably.Therefore, the target antigen on the APC cell provides the strategy of gene for the effect that strengthens dna vaccination.
3) hypertension
Recently prove that the product phosphatidic acid of PLD catalysis hydrolyzed lecithin is being brought into play keying action in the regulating effect of MAPK cascade.At the A10 cell, a kind of smooth muscle cell is; If when not having the PLD activity and existing, excite the phosphorylation of the required angiotonin of MAPK approach-Ang II to be suppressed.Therefore, changing the active regulating effect of PLD by the vasoactive polypeptide perhaps plays an important role in hypertensive evolution.
4) tumour
Induce in the apoptotic process of HL-60 at camptothecine and TNF and to increase with PLD2 is active, the activity that suppresses PLD2 can suppress the apoptosis of HL-60 cell.This just shows that PLD2 has important biological function in inducing HL-60 cytodifferentiation and apoptotic process.The cell strain PC-12 for example that is reported in other is also arranged, and in the process of inducer of apoptosis cell death inducing, the activity increase of PLD2 has anti-apoptotic effect.
Human recombination phospholipase D 2 is not all reported or describe to domestic and foreign literature at present, and English name recombinant humanphospholipase D2 is called for short rhPLD2, and the polynucleotide sequence of the allosteric body of human recombination phospholipase D 2 and this protein polypeptide of encoding thereof.Also do not report or describe the preparation method of this protein polypeptide and polynucleotide, especially do not have the research report of functions such as its anti-inflammatory, anti-asthma, leukemia cell (HL-60) apoptosis.More do not report or narrate the clinical value of this protein polypeptide and polynucleotide and huge DEVELOPMENT PROSPECT.
Three, summary of the invention
(1) source of rhPLD2: the application's main body is human recombination phospholipase D 2 (rhPLD2).And this protein is the mRNA that extracts PLD2 from the Daudi cell, through shear, the splicing allosteric, the clone has obtained not contain film combining site and signal peptide, 631 amino acid whose PLD2 cDNA sequences of codified; By the genetic expression of above-mentioned PLD2 cDNA sequence, proteic separation and purifying, obtained to have the rhPLD2 protein product of certain biologic activity.
(2) Fa Ming feature
1, the feature of rhPLD2:
1) this research department purifying exsiccant rhPLD2 protein product be a kind of tasteless white or flaxen powder.More soluble in water, its solubleness is 88-100% at normal temperatures.The rhPLD2 molecular weight of albumen is 71.6KD.
2) activity of the rhPLD2 of 1mg is about as much as 65mu PLD.The activity of the rhPLD2 of 1mg is about as much as 65muPLD.Its biologic activity useful range is about 0.5 μ g/ml-150mg/ml.Optimum range: 0.5 μ g/ml-150 μ g/ml.Its coding gene sequence is not contain film combining site and signal peptide, 631 amino acid whose PLD2 cDNA sequences of codified, total length 1893bp.See sequence table＜210 for details〉1.
3) the amino acid polypeptide sequence of rhPLD2,631 amino acid of total length.See sequence table＜210 for details〉2.
4) rhPLD2 proteinaceous product rhPLD2 is carried out animal allergic experiment and toxicity test.Show: through abdominal injection concentration is the rhPLD2 of 0.4537-2mg/mL, and animal is not had sensitization and any toxic action.
2, the application characteristic of rhPLD2
1) anti-asthma
The rising of asthma prevalence makes this disease receive much concern in recent years, and the whole world has 100,000,000 6 thousand ten thousand patients approximately now, and on the rise.At present, existing a large amount of somatomedins is identified out in bronchial smooth muscle, is comprised platelet-derived growth factor, Urogastron etc.Thereby the signal transduction pathway that suppresses bronchial smooth muscle propagation will be a new viewpoint of treatment asthma.The product P A of PLD and DAG can make the PKC activation, follow Cytoplasmic Ca simultaneously
2+Rising, and Ca
2+The variation of concentration is the necessary signals of emiocytosis.In addition, PLD2 can regulate PKC, and then regulates the expression that some participates in the inflammatory factor of asthma morbidity by the activity that influences nuclear factor; And by regulating the hyperplasia that signal transduction pathways such as MAPK are regulated bronchial smooth muscle.Therefore, we select the target spot of PLD2 as the control signal transduction, thereby suppress the propagation of bronchial smooth muscle.By the activity that changes PLD2 may be treatment asthma/or a kind of method of relieving asthma symptoms.For this reason, the human recombination phospholipase D 2 that we use this prepared in laboratory is that (this rhPLD2 is a kind of pinch PLD2 to rhPLD2, promptly removed some peptide section of N-end, simultaneously also point mutation is carried out in some site of PLD2 gene, thereby it is active to change its basis) intervene the asthmatic guinea pigs model as the treatment factor.Therefore, we can select the target spot of PLD2 as the control signal transduction, thereby suppress the propagation of bronchial smooth muscle and the secretion of cytokine.This can yet be regarded as and treats a kind of method of asthma.
Utilize the animal model of allergy (asthma), further research is used the rhPLD2 patients before and after intervention, the level of eosinophilic granulocyte (Eos), platelet activation factor (PAF), t cell growth factor (IL-5), matrix metalloproteinase 9 (MMP-9) in the samples such as the performance of laboratory animal clinical symptom and animal blood circulation, lung tissue and bronchoalveolar lavage fluid on the basis of extracorporeal anti-inflammatory experiment.
2) anti-inflammatory
Microglia is monokaryon-phagocytic cell of central nervous system (CNS), has important immunosurveillance and immune defense function.When CNS was inflamed, stress reaction appearred in microglia at first, changes active state into by stationary state, participated in inflammatory reaction.We find that at mRNA level and protein level rhPLD2 all can suppress activatory mouse microglia and express IL-1 β, TNF-α, and this control for the central inflammation provides new thinking.
3) inducing leukemia cell (HL-60) apoptosis
Leukemia is a malignant tumor of hematopoiesis system, is commonly called as " leukemia ", is one of domestic ten big malignant tumours occurred frequently, and is the highest with leukemic sickness rate in children's's malignant tumour.At present, leukemic main treatment means is chemotherapy and hematopoietic stem cell transplantation.But the toxic side effect of chemotherapeutics also is a problem that can not be ignored, and this has just limited the using dosage of chemotherapeutics in therapeutic process to a certain extent.And treat in the leukemic process at chemotherapeutics, it also is the major cause of chemotherapy failure that the leukemia cell develops immunity to drugs to chemotherapeutics.How to improve the susceptibility of chemotherapeutics to the leukemia cell, increase the result of treatment of chemotherapeutics, the toxic side effect that reduces chemotherapeutics is a problem of needing solution badly.And induce in the apoptotic process of HL-60 in camptothecine, the DAG level raises in PLD causes examining in the nuclear by activating, and then makes that PKC α activates in the nuclear, PKC α phosphorylation lamin B (lamin B) and cause apoptosis.
(3) obtained 4 of rhPLD2 clones, they are respectively:
Clone No. 1: 1 fragment (600bp);
Clone No. 2: 2 fragments (600bp);
Clone No. 3: 3 fragments (677bp);
Clone No. 4: 1+2+3 fragment (1893bp).
Four, goal of the invention:
1. isolating new human recombination phospholipase D 2 polypeptide is provided, and it comprises: have sequence table＜210〉polypeptide or its examples of conservative variations, bioactive fragment, analogue or the derivative of 2 aminoacid sequences.
2. the polynucleotide of this polypeptide of coding are provided.It comprises a kind of nucleotide sequence or its variant that is selected from down group:
(a) coding has sequence table＜210〉polynucleotide of the polypeptide of 2 aminoacid sequences;
(b) with polynucleotide (a) complementary polynucleotide;
(c) with (a) or polynucleotide sequence (b) have the polynucleotide of at least 88% homogeny.
More preferably, the sequence of these polynucleotide is be selected from down group a kind of: (a) have sequence table＜210〉sequence of 414-504 position in 1; (b) have sequence table＜210〉sequence of 615-789 position in 1; (c) have sequence table＜210〉sequence of 912-1407 position in 1; (d) have sequence table＜210〉sequence of 1353-1455 position in 1.
Promptly the invention provides isolating nucleic acid (polynucleotide), have sequence table＜210 by coding substantially the polynucleotide of the polypeptide of 2 aminoacid sequences form.Polynucleotide sequence of the present invention comprises sequence table＜210〉1 nucleotide sequence.
3. polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can with sequence table＜210 varient of the identical or degeneracy of the coding region sequence shown in 1.The polynucleotide of the mature polypeptide of code sequence tabulation＜210〉2 comprise: the encoding sequence that has only mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.
4. the invention still further relates to the varient of foregoing description polynucleotide, its coding has the polypeptide of identical aminoacid sequence or segment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.
5. the invention provides a kind of new polypeptide human recombination phospholipase D 2 one by one, it is basically by sequence table＜210〉aminoacid sequence shown in 2 forms.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.
6. the recombinant vectors of the polynucleotide that contain the human recombination phospholipase D 2 of encoding is provided.Expression vector particularly; Among the present invention, the polynucleotide sequence of coding human recombination phospholipase D 2 can be inserted in the carrier, contains the recombinant vectors of polynucleotide of the present invention with formation.Comprise that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carrier.
Persons skilled in the art all know how to select appropriate carriers/transcriptional regulatory element (as promotor, enhanser etc.) and selected marker.
7. the genetically engineered host cell of the polynucleotide that contain the human recombination phospholipase D 2 of encoding is provided.Among the present invention, the polynucleotide of human recombination phospholipase D 2 or the recombinant vectors that contains these polynucleotide can transform or transduce into host cell, contain the genetically engineered host cell of these polynucleotide or recombinant vectors with formation.Term " host cell " refers to prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; Bacterial cell such as Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; Insect cell such as fruit bat S2 or Sf9; Zooblast such as CHO, COS or Bowes melanoma cells etc.
8. the method for producing human recombination phospholipase D 2 is provided.Can carry out with routine techniques well known to those skilled in the art with dna sequence dna of the present invention or the recombinant vectors transformed host cell that contains described dna sequence dna.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results
2Method is handled, and used step is well-known in this area.Alternative is to use MgCl
2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, perhaps conventional mechanical method such as microinjection, electroporation, liposome packing etc.
By the recombinant DNA technology of routine, utilize polynucleotide sequence of the present invention to can be used to express or produce the human recombination phospholipase D 2 of reorganization.In general following steps are arranged:
(1), or transforms or the transduction proper host cell with the recombinant expression vector that contains these polynucleotide with the polynucleotide (or varient) of coding human recombination phospholipase D 2 of the present invention; (2) in suitable medium, cultivate host cell; (3) separation, protein purification from substratum or cell.
In step (2), according to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
In step (3), recombinant polypeptide can wrap and be expressed or be secreted into the extracellular in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.These methods include, but are not limited to: conventional renaturation is handled, protein precipitant is handled (salt analysis method), centrifugal, the broken bacterium of infiltration, the combination of ultrasonication, super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLc) and other various liquid chromatography (LC) technology and these methods.
9. the special polynucleotide sequence of coding human recombination phospholipase D 2 of the present invention can obtain with several different methods.For example, separate polynucleotide with hybridization technique well known in the art.These technology including, but not limited to: 1) with probe and genome or the hybridization of cDNA library to detect homologous polynucleotide sequence and 2) antibody screening of expression library to be to detect the polynucleotide passage of the clone with common structure feature.
10. the antibody at human recombination phospholipase D 2 of the present invention is provided, and relate to a kind of can with polypeptid specificity bonded antibody of the present invention.
11. the invention still further relates to the application in preparation anti-inflammatory, anti-asthma, medicine such as antitumor of polypeptide of the present invention or polynucleotide.
12. the antagonist of polypeptide of the present invention and this polypeptide, agonist and inhibitor can be directly used in disease treatment, for example, can treat malignant tumour, all kinds of inflammation, asthma etc.
Polypeptide of the present invention, polynucleotide and stand-in thereof, agonist, antagonist and inhibitor and suitable pharmaceutical carrier combination back can be used.These carriers can be water, glucose, ethanol, salt, damping fluid, glycerine and their combination.Composition comprises the polypeptide or the antagonist of safe and effective amount and carrier and the vehicle that does not influence effect of drugs.These compositions can be used as medicine and are used for disease treatment.
13. the present invention also provides medicine box or the test kit that contains one or more containers, and one or more medicinal compositions compositions of the present invention are housed in the container.With these containers, can have by the given indicative prompting of government authorities of making, using or selling medicine or biological products, the government authorities that this prompting reflects production, uses or sells permits it to use on human body.In addition, polypeptide of the present invention can be used in combination with other treatment compound.
Pharmaceutical composition can be with mode administration easily, as by in part, intravenously, intraperitoneal, intramuscular, subcutaneous, atomizing, the nose or the route of administration of intracutaneous.Human recombination phospholipase D 2 comes administration with the amount that treats and/or prevents concrete indication effectively.The amount and the dosage range that are applied to patient's human recombination phospholipase D 2 will depend on many factors, as administering mode, person's to be treated healthiness condition and diagnostician's judgement.
Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
Five, description of drawings
Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.
Fig. 1 is the PCR product gel electrophorogram of inventor's recombination phospholipase D 2.
Fig. 2 is the polyacrylamide gel electrophoresis figure (SDS-PAGE) of isolating human recombination phospholipase D 2.71.6kDa be proteinic molecular weight.The arrow indication is isolated protein band.
The renaturation of Fig. 1 .PCR product gel electrophorogram Fig. 2 .rhPLD2
M:DNA molecular weight standard DL 15000; 1. molecular weight of albumen standard
1:1 fragment (600bp); 2.rhPLD2 renaturation after supernatant 71.6kD)
2:2 fragment (600bp); 3.rhPLD2 renaturation postprecipitation (71.6kD)
3:3 fragment (677bp);
4:1+2+3 fragment (1893bp) ..
Fig. 3 is the amino acid sequence homology comparison diagram of inventor's recombination phospholipase D 2 and human phosphatidase.FROM NET is a human recombination phospholipase D 2.
Fig. 4 is former technological line.
Fig. 5 is the technological line after changing.It is the legal point mutation synoptic diagram of PCR.Step1,2: amplify two fragments with P1 (1+2 fragment) and P2 (2+3 fragment) respectively with the primer P3 (PLDm3) and the P4 (PLDm5) that contain the mutational site; Step3: two fragments are mixed back sex change, annealing, form hybrid molecule; Step4: add the pfuDNA pyro polymerase and extend into template; Step5: add P1, the P2 template amplification obtains the purpose product: the cDNA that does not contain N-terminal hPLD2.
Fig. 6 is the basic flow sheet of human recombination phospholipase D 2 protein purification and evaluation.
Six, embodiment
(1) case study on implementation
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as sanlbrook, molecular cloning: laboratory manual (New York:cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1: the clone of human recombination phospholipase D 2
The cDNA sequence of the known hPLD2 that announces according to GenBank (accession number: AF035483), be a fragment, the full length gene of its 2802bp from 909bp, is divided into three fragments according to every 600bp.Be 600bp, 600bp, 677bp.And designed 5 ' and 3 ' end Oligonucleolide primers, introduce the EcoRI restriction enzyme site at the first segmental 5 ' end, and add the protectiveness base.In second segmental the 466th base (the 1991st base of former sequence): A is sported G.That is, all introduce BamH I restriction enzyme site at segmental 3 ' end primer of 1+2 and segmental 5 ' the end primer of 2+3.5 ' the terminal KpnI restriction enzyme site of introducing at the 3rd segmental 3 ' end primer.Each segmental 5 ' and 3 ' end primer sequence is respectively: see Table 1..With Daudi cell (10
12Individual ml
-1) through 5%CO
2, under 37 ℃ of conditions, with 20% calf serum, 100 μ gml
-1Streptomycin sulphate, 100Uml
-1The DMEM culture medium culturing of penicillin.Through centrifugal, the collecting precipitation cell therefrom extracts mRNA then, and carries out RT-PCR according to designed 5 ' and 3 ' end Oligonucleolide primers and mutant primer.Amplification condition: 94 ℃ of sex change 1min; Add Taq enzyme/LA enzyme (5U/ μ l); Then with 94 ℃ of 30s, 55 ℃ of 40s, the program loop of 72 ℃ of 45s (total length 2.5min) 30 times (total length 35 times); Last 72 ℃ are extended 7min.The PCR product adopt in gene inner primer pcr amplification and the gene digestion with restriction enzyme method carry out Analysis and Identification correct after, be cloned on the carrier pUCm-Tvector/pSK.Enzyme is cut, and its exactness is identified in PCR and order-checking.Dna fragmentation reclaims the glass powder method that adopts, and plasmid extraction adopts alkaline process, and intestinal bacteria transform adopts Calcium Chloride Method.Concrete steps are with reference to " molecular cloning ".Determined dna sequence shows: the dna sequence dna of PCR product and sequence table＜210〉1-1893bp shown in 1 is identical.(seeing Fig. 1 .)
The primer sequence of table 1.RT-PCR
M3: be the segmental downstream of 1+2 (3 ' end) primer; M5: be the segmental upstream of 2+3 (5 ' end) primer.
Primer1:5 '-GGAATTCGGTCCTTGATTCTCAAGTGC-3 ' (sequence table＜210〉3)
Primer2:5 '-CCTTGGTGATCAGATTGCTG-3 ' (sequence table＜210〉4)
Primer3:5 '-CAGCAATCTTATCACCAAGG-3 ' (sequence table＜210〉5)
Primer4:5 '-CACGACACAGTGTCCTGTAAG-3 ' (sequence table＜210〉6)
Primer5:5 '-CTTCAGGATCCTGTCCATAATC-3 ' (sequence table＜210〉7)
Primer6:5 '-GACTGTGGACAGGATCCTGAAG-3 ' (sequence table＜210〉8)
Primer7:5 '-CTTACAGCACCCTGTGTCGTG-3 ' (sequence table＜210〉9)
Primer8:5 '-GGGGTACCCTATGTCCTCACTTCTAGGG-3 ' (sequence table＜210〉10)
1. former technological line is: obtain three fragments of hPLD2 carboxyl terminal respectively, connect 1+2 then, 2+3 fragment or directly obtain 1+2 with pcr amplification, the 2+3 fragment.At last with SmaI excision 1+2 fragment and the segmental consensus sequence of 2+3.
But place, SmaI point of contact can't be connected by former technological line.Analyzing its reason may be that joint efficiency is not high because the restriction enzyme site SmaI of No. 2 fragments itself is the tack connection.So 1+2 and the segmental clone of 2+3 can't be connected into total length.For this reason, the change technological line is as follows:
Locate to have carried out a point mutation at the 1991bp of the former sequence of hPLD2 (second segmental the 466th base): make A sport G.That is, all introduce BamH I restriction enzyme site at segmental 3 ' end primer of 1+2 and segmental 5 ' the end primer of 2+3.Because being sticking head, BamH I connects its joint efficiency height.For this reason, the middle primer that synthesizes full length fragment again: PLDm3 (upstream segmental 3 ' terminal primer) and PLDm5 (downstream segmental 5 ' terminal primer).
2. the detailed Figure of description 5 of asking for an interview of the technological line after changing.
Embodiment 2: the structure of human recombination phospholipase D 2 expression vector
The PCR product adopt in gene inner primer pcr amplification and the gene digestion with restriction enzyme method carry out Analysis and Identification correct after, be cloned on the carrier pUCm-Tvector/pSK.Adopt respectively that enzyme is cut, PCR and order-checking identify its exactness.Then film combining site and signal peptide, 631 amino acid whose PLD2 cDNA sequences of codified have been obtained not contain.
The DNA full length fragment of rhPLD2 is cloned among prokaryotic expression carrier pET30a (+) and the carrier for expression of eukaryon COS-7, constructs the prokaryotic expression carrier system of the fusion rotein that can give expression to the pET30a-rhPLD2 that has 6 * His purifying mark and the expression plasmid carrier pCI-rhPLD2 of COS-7.
Embodiment 3: the vivoexpression of human recombination phospholipase D 2, separation and purifying
The expression vector of the E.coli engineering strain that does not contain signal peptide and N-terminal rhPLD2 that makes up has successfully obtained the expression product of membranin: the allosteric protein of rhPLD2 in the inclusion body of bacterial cell.Institute's recombinant protein that obtains through separate, purifying, SDS-PAGE, Western Blot identifies its molecular weight and purity.And adopt BCA Protein Assay Reagent Kit to measure its protein content.Simultaneously, the Protocol that provides with reference to Amplex Red Phospholipase D Assay Kit carries out human recombination phospholipase D 2 activity of proteins mensuration.
E.coli BL21-Condonplus (the DE3)-RP pET30a-rhPLD2 engineering bacteria of cryopreservation is inoculated in (containing kantlex concentration is 15mg/L) in the LB solid medium, 37 ℃ are spent the night, the single colony inoculation of picking is (containing kantlex concentration is 15mg/L) in 2mL LB liquid nutrient medium, 37 ℃, 270r/min cultivates 12-16h.Be inoculated in (containing kantlex concentration is 15mg/L) in the 250mL LB liquid nutrient medium with 1: 100 (volume ratio) rate of vaccination again, 37 ℃, 200r/min cultivates 12-16hr, spends the night.Next day, utilize 15 liters of fermentation systems to carry out the 10L fermentation.Fermentation condition: PH:8.0; Rotating speed: 500rpm. temperature: 37 ℃, gas velocity: 10L/M, pressure: 3.0PSIG; When being cultured to A
600nm0.6-0.8 the time, add IPTG to final concentration 0.5mmol/L, continue to cultivate A
600nm(1.50 total incubation time 6 hours).Collect zymocyte liquid, 4,000rpm * 20min, 4 ℃ are centrifugal, collect bacterial sediment, suspend with PBS (PH:7.4), and bacterial concentration is: 10
13-10
15Individual/mL.Control Circulation water-4 ℃, under condition of ice bath, with ultrasonic refiner broken wall, 9,000rpm * 20min, 4 ℃ are centrifugal, collect the inclusion body precipitation.In the inclusion body precipitation, add a small amount of Buffer B (Tris 20mM, Nacl 0.5M, EDTA 1mM, Tween 20 0.5%), Rolling wears into emulsus with homogenizer, and 9,000rpm * 20min, 4 ℃ centrifugal, collects the inclusion body precipitation, adds Denaturing Buffer (Tris 10mM in 1.5: 1000 ratios, Urea 8M, β me 10mM), abundant mixing, 4 ℃ are spent the night.Metaprotein liquid is poured in the drop bottle, and it is slowly dropped to Renaturing Buffer (Tris 10mM, Nacl 150mM, GSH 0.1Mm, Tween 20 0.05%) in, spend the night with renaturation 4 ℃ of stirrings, be proteic state of saturation until the solution muddiness.5,000rpm * 20min, 4 ℃ are centrifugal, collect supernatant and wait to be further purified.Repeat repeatedly, almost can't see precipitation after centrifugal till.Collect the renaturation supernatant, carry out the preliminary evaluation of albumen sepn, the exogenous protein expression (Fig. 2 .) of 71.6kD is arranged in the host bacterium inclusion body.Its aminoacid sequence is seen sequence table＜210〉2. thin layer scanning demonstration, expressing quantity accounts for the 68-72% of bacterial protein.With the damping fluid washing cellular lysate liquid that contains stain remover, the precipitation of centrifugal acquisition is removed a part of foreign protein, and the inclusion body of results is through SDS-PAGE and briliancy scanning analysis, and the purity of rhPLD2 reaches 76%.
Embodiment 4: proteic evaluation of human recombination phospholipase D 2 and activation analysis
Ni on the renaturation supernatant
2+Affinity chromatography glue, Elute Buffer (250mM imidazoles, 2mol/L Nacl, 80mmol/LTis-HCl PH7.9) specificity wash-out.Elutriant is again through concentrating, dialysing.Institute's recombinant protein that obtains is identified molecular weight and purity through SDS-PAGE.The target protein of collecting carries out Western with 6X His monoclonal Antibody Albumin Free and PLD (Carboxy terminus) goatPolyclonal IgG to be identified.Determining the protein quantity adopts BCA Protein Assay Reagent Kit.The detailed Figure of description 6 of asking for an interview of the basic procedure of human recombination phospholipase D 2 protein purification and evaluation.
Compare through the PLD standard (Sigma) with natural membranes albumen that extracts and purifying, rhPLD2 has biological activity preferably.The activity of the rhPLD2 of 1mg is about as much as 65mu PLD.Its biologic activity useful range is about 0.5 μ g/ml-150mg/ml.Optimum range: 0.5 μ g/ml-150 μ g/ml.
Proteinaceous product rhPLD2 is carried out animal allergic experiment and toxicity test.Show: through abdominal injection concentration is the rhPLD2 of 0.4537-1.815mg/mL, and animal is not had sensitization and any toxic action.
Embodiment 5: the proteic applied research of human recombination phospholipase D 2
The activation of human phosphatidase D (Phospholipase D PLD) and many important cell functions and cell fate are closely related, comprise activate the phagocytic capacity, respiratory burst, mitotic division and regulate secretion.Wherein, a lot of functions comprise in inflammation and the tumour having vital role at morbid state.So the immunologic function of research rhPLD2 will provide the important theory foundation for clinical application from now on.
See the mechanism of action and the effect of (two) rhPLD2 for details
(2) mechanism of action of rhPLD2 and effect
1, the anti-asthma function of rhPLD2
1) after rhPLD2 reduces eosinophil levels in cavy chronic asthma model blood specimen, the bronchoalveolar lavage fluid and gives cavy chronic asthma model abdominal injection rhPLD2 1.5mg/kg, 3mg/kg, 6mg/kg, brings out successfully the back respectively at 3～4 days, asthma before the cavy sensitization and intervene for 9～12 hours, the 3rd time and got each 1ml of blood in back 6 hours, 9～12 hours and 18～24 hours and carry out the Eos counting.The result shows: rhPLD2 is the level that 3.0mg/kg can reduce the Eos in the cavy chronic asthma model blood when above in concentration.But the Eos count results in the bronchoalveolar lavage fluid shows, and: rhPLD2 has during for 1.2mg/kg-10mg/kg in concentration and suppresses the wetting capacity of Eos in lung.Optimum effective concentration is 6mg/kg rhPLD2.
2) rhPLD
2The content of PAF in the blood when reducing cavy chronic asthma state
Use platelet aggregation method research rhPLD
2The influence of PAF in the blood during to cavy chronic asthma state.Find: the content of PAF (thinking that with the NS group comparison p value is all less than 0.01) in blood when 1. abdominal injection rhPLD2 3.0mg/kg group and rhPLD2 6.0mg/kg group all can reduce cavy chronic asthma state; But no significant difference (p=0.593) between these two groups.Illustrate: the above dosage of abdominal injection rhPLD2 3.0mg/kg can reduce the content of PAF in blood, but action intensity is not strengthened along with the increasing of dosage.
3) rhPLD
2Intervening down, the IL-5 of guinea pig lung tissue expression of gene is suppressed
Genetic expression and rhPLD for research cavy chronic asthma state I L-5
2Concern, extract total RNA of each drug intervention group lung tissue, row sxemiquantitative RT-PCR.(the PCR product of β-actin) is observed electrophoretic band on 1.5% sepharose to obtain goal gene (IL-5) and corresponding house-keeping gene.With gel images the fluorescence intensity level of the amplified band that obtains is carried out imaging analysis, promptly carry out the mRNA semi-quantitative analysis.The result shows: the rhPLD2 of abdominal injection high density (2.0mg/kg-6mg/kg) can suppress the expression of IL-5 in chronic asthma guinea pig lung tissue.
4) rhPLD
2The influence of bronchoalveolar lavage fluid MMP-9 protein expression during to cavy chronic asthma state
Use the ELISA method to detect rhPLD
2The expression of bronchoalveolar lavage fluid MMP-9 during to cavy chronic asthma state.Find to suppress the expression of MMP-9 more than the abdominal injection rhPLD2 2.0mg/kg in lung tissue.
5) rhPLD
2Reduce the enzymic activity of GPI-PLD in the chronic asthma guinea pig serum
Detect GPI-PLD enzymic activity in the serum by the TX-114 split-phase method, we have detected respectively, and rhPLD2, dexamethasone, physiological saline are intervened before and after the variation and asthma of serum GPI-PLD enzymic activity after the asthmatic guinea pigs, the variation of different time sections (intervening back 6h, 12h, 18h) enzymic activity after each intervention group effect.And the rhPLD2 with 3 various dose intervenes asthmatic guinea pigs, observes the influence of various dose rhPLD2 to GPI-PLD enzymic activity in the asthmatic guinea pigs serum.
Experiment shows that serum GPI-PLD enzymic activity all has significance to change before and after each intervention group asthma.GPI-PLD enzymic activity paired t-test before and after each intervention group asthma, its p value illustrates that GPI-PLD may have certain meaning in the asthma pathogenic process between 0.001 to 0.027.
With different intervention factor interventions, find that dexamethasone and rhPLD2 group can make all that the enzymic activity of GPI-PLD significantly reduces in the serum after the asthma, and the most obvious with Dexamethasone group, drop to 39.4% of asthma state, and rhPLD2 can reduce to 50.7% approximately; Guinea pig serum GPI-PLD level compares during with the asthma state, and the two P value is all less than 0.01.And physiological saline intervention group patients before and after intervention does not have significant difference (P=0.249), illustrates that rhPLD2 has certain downward modulation effect to the GPI-PLD activity in the guinea pig serum.By detection to the GPI-PLD enzymic activity of three time points (6h, 12h, 18h), find that active downward modulation effect does not change and has significance to change rhPLD2 in time to GPI-PLD, and 1.5mg/kg rhPLD2 intervention group and the 3.0mg/kg rhPLD2 intervention group regulating effect to serum GPI-PLD behind 18h after the intervention not obvious (the P value is respectively 0.113 and 0.055).Active adjusting has dose-dependently to prompting rhPLD2 to GPI-PLD, and along with increasing of used dosage, it is more lasting to GPI-PLD regulating effect in the serum.
The active influence of lung tissue nuclear factor P65 when 6) rhPLD2 is to cavy chronic asthma state
The principle that detects by test kit (with specific oligonucleotide be coated on enzyme plate on combine detect its activity by the nuclear factor in the extract), press the following formula detection nuclear factor P65 of guinea pig lung tissue activity:
Oda＝Odt-Odc
The nuclear factor P65 of different treatment group guinea pig lung tissue activity sees Table 4 and Fig. 6, experiment shows: active significantly raise (the p value is less than 0.001) of asthmatic guinea pigs lung tissue P65, after rhPLD2 and DXM intervention, the transcriptional activity of P65 significantly reduces, but curative effect indifference (p=0.736) between the two.Experimental result is found that NS organizes its lung tissue P65 activity after the asthma and also significantly is lower than asthma state group (p＜0.01), ((x ± SD) is 0.87500 ± 0.096670 to asthma state group OD value but its reduction level is limited, physiological saline treatment group is 0.72863 ± 0.090955, and its lung tissue of normal guinea pig P65 activity is 0.36213 ± 0.066714).RhPLD2 and DXM group compare with the physiological saline group, find the former two's physiological saline group (both p values are all less than 0.001) that is better than evident in efficacy, and the active reduction of prompting physiological saline group P65 is because asthmatic guinea pigs has natural remission; And rhPLD2 and DXM have the obvious suppression effect to the expression level of lungs of asthmatic guinea pigs tissue core transcription factor P65.
In a word:
1) rhPLD2 does not have sensitization to cavy; The rhPLD2 0.5ml of 2mg/ml is that the small white mouse of 20g does not have the acute toxicity effect to body weight.
2) the rhPLD2 Eos that can suppress the cavy chronic asthma soak into, the protein content of MMP-9 in the activity of the expression of GPI-PLD level, lung tissue IL-5 mRNA and nuclear factor P65, the bronchoalveolar lavage fluid in the content, serum of PAF in the blood.
3) rhPLD2 can suppress the release of cavy chronic asthma model related inflammation medium.
2, the function of the anti-maincenter inflammation of rhPLD2
1) rhPLD2 downward modulation microglia (N9 cell) IL-1 β, TNF-α expression of gene and protein level
Microglia is monokaryon-phagocytic cell of central nervous system (CNS), has important immunosurveillance and immune defense function.When CNS was inflamed, stress reaction appearred in microglia at first, changes active state into by stationary state, participated in inflammatory reaction.Expression and rhPLD for research microglia inflammatory factor
2Relation adopts LPS to stimulate the N9 cell, and intervenes cell by aforementioned schemes, extracts the total RNA that respectively organizes different time points, and IL-1 β and TNF-α are carried out sxemiquantitative RT-PCR.Obtain goal gene and the electrophoretic band of corresponding house-keeping gene PCR product on 1.5% sepharose.
Gel images is carried out semi-quantitative analysis, find rhPLD
2Can significantly suppress activatory N9 cell expressing IL-1 β and TNF-α.1. at each time point, the rhPLD of 10 μ g/ml-120 μ g/ml
2All can suppress the expression (comparing p＜0.05) of IL-1 β with the physiological saline group.It acts on 4 little time points and significantly is different from 24 hours (p=0.047), but does not show difference between all the other each groups.
2) rhPLD2 downward modulation microglia (N9 cell) IL-1 β, the proteic level of TNF-α
The ELISA method detects the expressing quantity of respectively organizing N9 cell IL-1 β, TNF-α, and we find rhPLD
2Can suppress IL-1 β and the proteic expression of TNF-α.1. remove the 24h time point, 3 μ g/3ml LPS organize and 33 μ g/3ml PLD+0.4 μ g/3ml anti-PLD experimental group do not have obvious significant difference outer (p=0.062), and surplus each group is all organized significant difference with the corresponding positive.2. at 1h time point, rhPLD
2Inhibition ability and concentration positive correlation to target protein.At 4h time point, rhPLD
2Inhibition ability to target protein is strengthened.
In sum:
1) rhPLD2 can suppress activatory mouse microglia expression IL-1 β and TNF-α in the mRNA level.
2) rhPLD2 can suppress activatory mouse microglia expression IL-1 β and TNF-α at protein level.
3) rhPLD2 is certain concentration dependent and temporal correlation to the inhibition of activatory mouse microglia expression IL-1 β and TNF-α.
At mRNA level and protein level, rhPLD2 all can suppress activatory mouse microglia and express IL-1 β, TNF-α, and this control for the central inflammation provides new thinking.
3, the function of the inducing leukemia cell HL-60 apoptosis of rhPLD2
The cell inhibitory effect experiment: the rhPLD2 list of observation different concns is used or is share the influence of camptothecine to HL-60 cell proliferation, and utilizes this testing sieve to select the optimum concn gradient that rhPLD2 acts on the HL-60 cell.The experiment grouping: 1. rhPLD2 organizes (observe the influence of rhPLD2 to HL-60 cell proliferation by preliminary experiment, filter out five suitable concentration gradients), each dosage three multiple hole.2. camptothecine positive controls, according to the result of document and preliminary experiment, the camptothecine activity that filters out a best is as positive control (proliferation inhibition rate that acts on HL-60 cell pair cell after 48 hours is approximately 50%), three multiple holes.3. standard P LD organizes, and concentration is 250U/ml, three multiple holes.4. rhPLD2 (five concentration gradients are the same) and standard P LD (250U/ml) and camptothecine combined action group.5. negative control group, the inoculum density of cell is identical with each treatment group, but cell is intervened without any processing factor.The HL-60 cell is after above-mentioned intervention factor is handled, and (24h, 48h 72h) observe the influence of each processing factor to the growth of HL-60 cell in different time points.
Result of experiment shows: rhPLD2 has the obvious suppression effect to the growth of HL-60.When the concentration of rhPLD2 when 80ug/ml is above, the growth table of HL-60 cell is revealed great restraining effect.Compare P＜0.01 with control group.
The two methods of dying of Hoechst 33258 and PI can be carried out qualitative (distinguishing apoptosis with downright bad) to this phenomenon.
Sequence table
＜110〉Zhu Ling of Medical University Of Fujian
＜120〉human recombination phospholipase D 2 and encoding sequence thereof
<140>2005100191724
<141>2005-7-25
<160>10
<210>1
<211>1893
<212>DNA
＜213〉human B cell myelomatosis (Daudi cell strain)
<400>1
1 caagagatca?ctgagctggc?gcagggccca?ggcagagact?tcctacagct?gcaccggcat
61 gacagctacg?ccccaccccg?gcctgggacc?ttggcccggt?ggtttgtgaa?tggggcaggt
121 tactttgctg?ctgtggcaga?tgccatcctt?cgagctcaag?aggagatttt?catcacagac
181 tggtggttga?gtcctgaggt?ttacctgaag?cgtccggccc?attcagatga?ctggagactg
241 gacattatgc?tcaaraggaa?ggcggaggag?ggtgtccgtg?tgtctattct?gctgtttaaa
301 gaagtggaat?tggccttggg?catcaacagt?ggctatagca?agagggcgct?gatgctgctg
361 caccccaaca?taaaggtgat?gcgtcaccca?gaccaagtga?cgttgtgggc?ccatcatgag
421 aagctcctgg?tggtggacca?agtggtagca?ttcctggggg?gactggacct?tgcctatggc
481 cgctgggatg?acctgcacta?ccgactgact?gaccttggag?actcctctga?atcagctgcc
541 ttccagcctc?ccaccccgcg?cccagactca?ccagccaccc?cagacctctc?tcacaaccaa
601 ttcttctggc?tgggcaagga?ctacagcaat?cttatcacca?aggactgggt?gcagctggac
661 cggcctttcg?aagatttcat?tgacagggag?acgacccctc?ggatgccatg?gcgggacgtt
721 ggggtggtcg?tccatggcct?accggcccgg?gaccttaccc?ggcacttcat?ccagcgctgg
781 aacttcacca?agaccaccaa?ggccaagtac?aagactccca?cataccccta?cctgcttccc
841 aagtctacca?gcacggccaa?tcagctcccc?ttcacacttc?caggagggca?gtgcaccacc
901 gtacaggtct?tgcgatcagt?ggaccgctgg?tcagcaggga?ctctggagaa?ctccatcctc
961 aatgcctacc?tgcacaccat?cagggagagc?cagcacttcc?tctacattga?gaatcagttc
1021?ttcattagct?gctcagatgg?gcggacggtt?ctgaacaagg?tgggcgatga?gattgtggac
1081?agaatcctga?aggcccacaa?acaggggtgg?agttaccgag?tctacgtgct?tttgccctta
1141?ctccctggct?tcgagggtga?catctccacg?ggcggtggca?actccatcca?ggccattctg
1201?cactttactt?acaggaccct?gtgtcgtggg?gagtattcaa?tcctgcatcg?ccttaaagca
1261?gccatgggga?cagcatggcg?ggactatatt?tccatctgcg?ggcttcgtac?acacggagag
1321?ctgggcgagc?accccgtctc?ggagctcatc?tacatccaca?gcaaggtgct?catcgcagat
1381?gaccggacag?tcatcattgg?ttctgcaaac?atcaatgacc?ggagcttgct?ggggaagcgg
1441?gacagtgagt?tggccgtgct?ggtcgaggac?acagagacgg?aaccatccct?catgaatggg
1501?gcagagtatc?aggcgggcag?gtttgccttg?agtctgcgga?agcactgctt?cagtgtgatt
1561?cttggagcaa?atacccggcc?agacttggat?ctccgagacc?ccatctgtga?tgacttcttc
1621?cagttgtggc?aagacatggc?tgagagcaac?gccaatatct?atgagcagat?cttccgctgc
1681?ctgccatcca?atgccacgcg?ttccctgcgg?actctccggg?agtacgtggc?cgtggagccc
1741?ttggccacgg?tcagtccccc?cttggctcgg?tctgagctca?cccaggtcca?gggccacctg
1801?gtccacttcc?ccctcaagtt?cctagaggat?gagtctttgc?tgcccccgct?gggtagcaag
1861?gagggcatga?tccccccaga?agtgtggaca?tag
<210>2
<211>631
<212>PRT
＜213〉human B cell myelomatosis (Daudi cell strain)
<400>2
1 Glu?Ile?Thr?Glu?Leu?Ala?Gln?Gly?Pro?Gly?Arg?Asp?Phe?Leu?Gln?Leu
17 His?Arg?His?Asp?Ser?Tyr?Ala?Pro?Pro?Arg?Pro?Gly?Thr?Leu?Ala?Arg
33 Trp?phe?Val?Asn?Gly?Ala?Gly?Tyr?Phe?Ala?Ala?Val?Ala?Asp?Ala?Ile
49 Leu?Arg?Ala?Gln?Glu?Glu?Ile?Phe?Ile?Thr?Asp?Trp?Trp?Leu?Ser?Pro
65 Glu?Val?Tyr?Leu?Lys?Arg?Pro?Ala?His?Ser?Asp?Asp?Trp?Arg?Leu?Asp
81 Ile?Met?Leu?Lys?Arg?Lys?Ala?Glu?Glu?Gly?Val?Arg?Val?Ser?Ile?Leu
97 Leu?Phe?Lys?Glu?Val?Glu?Leu?Ala?Leu?Gly?Ile?Asn?Ser?Gly?Tyr?Ser
113?Lys?Arg?Ala?Leu?Met?Leu?Leu?His?Pro?Asn?Ile?Lys?Val?Met?Arg?His
129?Pro?Asp?Gln?Val?Thr?Leu?Trp?Ala?His?His?Glu?Lys?Leu?Leu?Val?Val
145?Asp?Gln?Val?Val?Ala?Phe?Leu?Gly?Gly?Leu?Asp?Leu?Ala?Tyr?Gly?Arg
161?Trp?Asp?Asp?Leu?His?Tyr?Arg?Leu?Thr?Asp?Leu?Gly?Asp?Ser?Ser?Glu
177?Ser?Ala?Ala?Phe?Gln?Pro?Pro?Thr?Pro?Arg?Pro?Asp?Ser?Pro?Ala?Thr
193?Pro?Asp?Leu?Ser?His?Asn?Gln?Phe?Phe?Trp?Leu?Gly?Lys?Asp?Tyr?Ser
209?Asn?Leu?Ile?Thr?Lys?Asp?Trp?Val?Gln?Leu?Asp?Arg?Pro?Phe?Glu?Asp
225?Phe?Ile?Asp?Arg?Glu?Thr?Thr?Pro?Arg?Met?Pro?Trp?Arg?Asp?Val?Gly
241?Val?Val?Val?His?Gly?Leu?Pro?Ala?Arg?Asp?Leu?Thr?Arg?His?Phe?Ile
257?Gln?Arg?Trp?Asn?Phe?Thr?Lys?Thr?Thr?Lys?Ala?Lys?Tyr?Lys?Thr?Pro
273?Thr?Tyr?Pro?Tyr?Leu?Leu?Pro?Lys?Ser?Thr?Ser?Thr?Ala?Asn?Gln?Leu
289?Pro?Phe?Thr?Leu?Pro?Gly?Gly?Gln?Cys?Thr?Thr?Val?Gln?Val?Leu?Arg
305?Ser?Val?Asp?Arg?Trp?Ser?Ala?Gly?Thr?Leu?Glu?Asn?Ser?Ile?Leu?Asn
321?Ala?Tyr?Leu?His?Thr?Ile?Arg?Glu?Ser?Gln?His?Phe?Leu?Tyr?Ile?Glu
337?Asn?Gln?Phe?Phe?Ile?Se?Cys?Ser?Asp?Gly?Arg?Thr?Val?Leu?Asn?Lys
353?Val?Gly?Asp?Glu?Ile?Val?Asp?Arg?Ile?Leu?Lys?Ala?His?Lys?Gln?Gly
369?Trp?Ser?Tyr?Arg?Val?Tyr?Val?Leu?Leu?Pro?Leu?Leu?Pro?Gly?Phe?Glu
385?Gly?Asp?Ile?Ser?Thr?Gly?Gly?Gly?Asn?Ser?Ile?Gln?Ala?Ile?Leu?His
401?Phe?Thr?Tyr?Arg?Thr?Leu?Cys?Arg?Gly?Glu?Tyr?Ser?Ile?Leu?His?Arg
417?Leu?Lys?Ala?Ala?Met?Gly?Thr?Ala?Trp?Arg?Asp?Tyr?Ile?Ser?Ile?Cys
433?Gly?Gle?Arg?Thr?His?Gly?Glu?Leu?Gly?Glu?His?Pro?Val?Ser?Glu?Leu
449?Ile?Tyr?Ile?His?Ser?Lys?Val?Leu?Ile?Ala?Asp?Asp?Arg?Thr?Val?Ile
465?Ile?Gly?Ser?Ala?Asn?Ile?Asn?Asp?Arg?Ser?Leu?Leu?Gly?Lys?Arg?Asp
481?Ser?Glu?Leu?Ala?Val?Leu?Val?Glu?Asp?Thr?Glu?Thr?Glu?Pro?Ser?Leu
497?Met?Asn?Gly?Ala?Glu?Tyr?Gln?Ala?Gly?Arg?Phe?Ala?Leu?Ser?Leu?Arg
513?Lys?His?Cys?Phe?Ser?Val?Ile?Leu?Gly?Ala?Asn?Thr?Arg?Pro?Asp?Leu
529?Asp?Leu?Arg?Asp?Pro?Ile?Cys?Asp?Asp?Phe?Phe?Gln?Leu?Trp?Gln?Asp
545?Met?Ala?Glu?Ser?Asn?Ala?Asn?Ile?Tyr?Glu?Gln?Ile?Phe?Arg?Cys?Leu
561?Pro?Ser?Asn?Ala?Thr?Arg?Ser?Leu?Arg?Thr?Leu?Arg?Glu?Tyr?Val?Ala
577?Val?Glu?Pro?Leu?Ala?Thr?Val?Ser?Pro?Pro?Leu?Ala?Arg?Ser?Glu?Leu
593?Thr?Gln?Val?Gln?Gly?His?Leu?Val?His?Phe?Pro?Leu?Lys?Phe?Leu?Glu
609?Asp?Glu?Ser?Leu?Leu?Pro?Pro?Leu?Gly?Ser?Lys?Glu?Gly?Met?Ile?Pro
625?Pro?Glu?Val?Trp?Thr?***
<210>3
<211>27
<212>DNA
＜213〉artificial sequence
<400>3
GGAATTCGGTCCTTGATTCTCAAGTGC
<210>4
<211>20
<212>DNA
＜213〉artificial sequence
<400>4
CCTTGGTGATCAGATTGCTG
<210>5
<211>20
<212>DNA
＜213〉artificial sequence
<400>5
CAGCAATCTTATCACCAAGG
<210>6
<211>21
<212>DNA
＜213〉artificial sequence
<400>6
CACGACACAGTGTCCTGTAAG
<210>7
<211>22
<212>DNA
＜213〉artificial sequence
<400>7
CTTCAGGATCCTGTCCATAATC
<210>8
<211>22
<212>DNA
＜213〉artificial sequence
<400>8
GACTGTGGACAGGATCCTGAAG
<210>9
<211>21
<212>DNA
＜213〉artificial sequence
<400>9
CTTACAGCACCCTGTGTCGTG
<210>10
<211>28
<212>DNA
＜213〉artificial sequence
<400>10
GGGGTACCCTATGTCCTCACTTCTAGGG
Claims (10)
1. a new human recombination phospholipase D 2 (rhPLD2) polypeptide, it comprises: polypeptide or its examples of conservative variations, bioactive fragment, analogue or derivative with SEQ ID NO.2 aminoacid sequence.
2. can the encode polynucleotide of this polypeptide, it comprises a kind of nucleotide sequence or its variant that is selected from down group:
(a) coding has sequence table＜210〉polynucleotide of the polypeptide of 2 aminoacid sequences; (b) with polynucleotide (a) complementary polynucleotide; (c) with (a) or polynucleotide sequence (b) have the polynucleotide of at least 88% homogeny; More preferably, the sequence of these polynucleotide is be selected from down group a kind of: (a) have sequence table＜210〉sequence of 414-504 position in 1; (b) have sequence table＜210〉sequence of 615-789 position in 1; (c) have sequence table＜210〉sequence of 912-1407 position in 1; (d) have sequence table＜210〉sequence of 1353-1455 position in 1.
3. the varient of polynucleotide as claimed in claim 1 or 2, its coding has the polypeptide of identical aminoacid sequence or segment, analogue and the derivative of polypeptide with this; The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place; These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient; As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.
4. new polypeptide one human recombination phospholipase D 2, it is basically by sequence table＜210〉aminoacid sequence shown in 2 forms; This polypeptide can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell); The host used according to the recombinant production scheme, the polypeptide that is somebody's turn to do can be glycosylated, maybe can be nonglycosylated; This polypeptide also can comprise or not comprise initial methionine residues.
5. the recombinant vectors, particularly expression vector that contain the polynucleotide of the human recombination phospholipase D 2 of encoding; The genetically engineered host cell that contains the polynucleotide of the human recombination phospholipase D 2 of encoding; In being somebody's turn to do, the polynucleotide sequence of coding human recombination phospholipase D 2 can be inserted in the carrier, contains the recombinant vectors of these described polynucleotide with formation; Comprise that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carrier; The polynucleotide of human recombination phospholipase D 2 or the recombinant vectors that contains these polynucleotide can transform or transduce into host cell, contain the genetically engineered host cell of these polynucleotide or recombinant vectors with formation; Term " host cell " refers to prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell; Representative example has: intestinal bacteria, streptomyces; Bacterial cell such as Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; Insect cell such as fruit bat S2 or Sf9; Zooblast such as CHO, COS or Bowes melanoma cells etc.
6. the production method of claim 1,2,4 or 5 described human recombination phospholipase D 2s can be carried out with routine techniques well known to those skilled in the art with this described dna sequence dna or the recombinant vectors transformed host cell that contains described dna sequence dna; When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results
2Method is handled, and used step is well-known in this area; Alternative is to use MgCl
2If desired, transforming also the method for available electroporation carries out; When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, perhaps conventional mechanical method such as microinjection, electroporation, liposome packing etc.; By the recombinant DNA technology of routine, utilize this polynucleotide sequence to can be used to express or produce the human recombination phospholipase D 2 of reorganization; In general following steps are arranged:
(1) transforms or the transduction proper host cell with this polynucleotide (or varient) of coding human recombination phospholipase D 2, or with the recombinant expression vector that contains these polynucleotide; (2) in suitable medium, cultivate host cell; (3) separation, protein purification from substratum or cell; In step (2), according to used host cell, used substratum can be selected from various conventional substratum in the cultivation; Under the condition that is suitable for the host cell growth, cultivate; After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again;
In step (3), recombinant polypeptide can wrap and be expressed or be secreted into the extracellular in cell or on cytolemma; If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry; These methods are well-known to those skilled in the art; These methods include, but are not limited to: conventional renaturation is handled, protein precipitant is handled (salt analysis method), centrifugal, the broken bacterium of infiltration, the combination of ultrasonication, super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLc) and other various liquid chromatography (LC) technology and these methods.
7. the antibody of a human recombination phospholipase D 2, and relate to a kind of can with this polypeptid specificity bonded antibody.
8. the polypeptide of a human recombination phospholipase D 2 or the polynucleotide application in preparation anti-inflammatory, anti-asthma, medicine such as antitumor.
9. human recombination phospholipase D 2, it is characterized in that: the activity of the rhPLD2 of 1mg is about as much as 65mu PLD; Its biologic activity useful range is about 0.5 μ g/ml-150mg/ml; Optimum range: 0.5 μ g/ml-150 μ g/ml; The polypeptide of human recombination phospholipase D 2 and the antagonist of this polypeptide, agonist and inhibitor can be directly used in disease treatment, for example, can treat malignant tumour, all kinds of inflammation, asthma etc.; Comprise this polypeptide, polynucleotide and stand-in thereof, agonist, antagonist and inhibitor and suitable pharmaceutical carrier combination back are used; These carriers can be water, glucose, ethanol, salt, damping fluid, glycerine and their combination; Composition comprises the polypeptide or the antagonist of safe and effective amount and carrier and the vehicle that does not influence effect of drugs.
10. contain the medicine box or the test kit of one or more containers, it is characterized in that: the medicinal compositions composition that one or more are somebody's turn to do is housed in the container; With these containers, can have by the given indicative prompting of government authorities of making, using or selling medicine or biological products, the government authorities that this prompting reflects production, uses or sells permits it to use on human body; In addition, the polypeptide that is somebody's turn to do can be used in combination with other treatment compound; Pharmaceutical composition can be with mode administration easily, as by in part, intravenously, intraperitoneal, intramuscular, subcutaneous, atomizing, the nose or the route of administration of intracutaneous; Human recombination phospholipase D 2 is to treat effectively or to prevent the amount of concrete indication to come administration; Wherein said medicine is propellant, tablet, capsule or suspensoid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2005100191724A CN1904041B (en) | 2005-07-25 | 2005-07-25 | Human recombination phospholipase D2, its preparation method and application in preparation medicine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2005100191724A CN1904041B (en) | 2005-07-25 | 2005-07-25 | Human recombination phospholipase D2, its preparation method and application in preparation medicine |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1904041A true CN1904041A (en) | 2007-01-31 |
| CN1904041B CN1904041B (en) | 2010-04-28 |
Family
ID=37673406
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2005100191724A Expired - Fee Related CN1904041B (en) | 2005-07-25 | 2005-07-25 | Human recombination phospholipase D2, its preparation method and application in preparation medicine |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1904041B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104087564A (en) * | 2014-07-04 | 2014-10-08 | 福建医科大学 | Applications of bradykinin in preparation of phosphatidylserine (PS) and in treatment of central nervous system diseases |
| CN104312994B (en) * | 2014-08-31 | 2017-10-20 | 福建医科大学 | Targeting amplification Foxp3+The phosphorous albumen of regulatory T cells and its application |
-
2005
- 2005-07-25 CN CN2005100191724A patent/CN1904041B/en not_active Expired - Fee Related
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104087564A (en) * | 2014-07-04 | 2014-10-08 | 福建医科大学 | Applications of bradykinin in preparation of phosphatidylserine (PS) and in treatment of central nervous system diseases |
| CN104087564B (en) * | 2014-07-04 | 2017-06-23 | 福建医科大学 | Application of the slow slow-witted peptide in phosphatidylserine and treatment the nervous system disease is prepared |
| CN104312994B (en) * | 2014-08-31 | 2017-10-20 | 福建医科大学 | Targeting amplification Foxp3+The phosphorous albumen of regulatory T cells and its application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1904041B (en) | 2010-04-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1904041A (en) | Human recombination phospholipase D2, its preparation method and application in preparation medicine | |
| CN1670197A (en) | Arginase of Japanese blood fluke, its coding nucleic acid and application | |
| CN1393549A (en) | Polypeptide-trypsinogen-26.51 and polynucleotide for coding it | |
| CN1342666A (en) | Polypeptide-protein 32.67 containing hemeobox domain and aconitase characteristic sequence and polynucleotide for coding it | |
| CN1393552A (en) | Polypeptide-human myotonic dystrophy protein kinase -61.27 and polynucleotide for coding it | |
| CN1301819A (en) | New polypeptide-human aminoacyl tRNA synthetase 10 and polynucleotide codign such polypeptide | |
| CN1345838A (en) | Novel polypeptide-human protein 9.68 containing ribosomal protein S24e characteristic sequence fragment and polynucleotide for encoding said polypeptide | |
| CN1351077A (en) | Polypeptide-human protein 12.21 containing cation exchange protein characteristic sequence fragment and polynucleotide for coding it | |
| CN1351061A (en) | Polypeptide-human protein 9.68 containing interleukin 1 characteristic sequence fragment and polynucleotide for coding it | |
| CN1381478A (en) | Polypeptide-ribosome S7 protein -11.77 and polynucleotide for coding it | |
| CN1376780A (en) | Polypeptide-threonine synthetase-9.35 and polynucleotide for coding it | |
| CN1351150A (en) | Polypeptide-human respiratory chain NADH dehydrogenase 30KDa subunit 11.88 and polynucleotide for coding it | |
| CN1341616A (en) | A novel polypeptide-human protein 9.46 with type I aminoacyl tRNA synthetase characteristic sequence fragment and polynucleotide for coding said polypeptide | |
| CN1351072A (en) | Polypeptide-human protein 9.13 containing cytochrome b/b6 characteristic sequence fragment and polynucleotide for coding it | |
| CN1351078A (en) | Polypeptide-human protein 9.35 containing pancreatic juice hormone family characteristic sequence fragment and polynucleotide for coding it | |
| CN1345852A (en) | Novel polypeptide-human protein 11.11 containing ribosomal protein S24e characterristic sequence fragment and polynucleotide for encoding said polypeptide | |
| CN1381572A (en) | Polypeptide-adenylate kinase-9.79 and polynucleotid for coding it | |
| CN1393554A (en) | Polypeptide-human protein-9.57 containing glycosylhydrolase family 17 characteristic sequence fragment and polynucleotide for coding it | |
| CN1323808A (en) | New polypeptide-human sec 13-related protein 10 and polynucleotides for coding same | |
| CN1324829A (en) | New polypeptide ribosome protein 13 and polynucleotides for encoding same | |
| CN1381564A (en) | Polypeptide-human phosphate synthetase-11.55 and polynucleotide for coding it | |
| CN1376707A (en) | Polypeptide-human zinc finger protein -35.09 and polynucleotide for coding it | |
| CN1342762A (en) | Polypeptide-human protein 32.67 containing enoyl-CoA hydratase characteristic sequence fragment and polynucleotide for coding it | |
| CN1360042A (en) | Polypeptide-human Ser/Thr protein kinase 55.66 and polynucleotide for coding it | |
| CN1351028A (en) | Polypeptide-human protein 9.46 containing ATP synthase characteristic sequence fragment and polynucleotide for coding it |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20100428 Termination date: 20210725 |