CN1609120A - Cotton verticillium wilt germ secreted exciton gene and its application - Google Patents
Cotton verticillium wilt germ secreted exciton gene and its application Download PDFInfo
- Publication number
- CN1609120A CN1609120A CN 200310108076 CN200310108076A CN1609120A CN 1609120 A CN1609120 A CN 1609120A CN 200310108076 CN200310108076 CN 200310108076 CN 200310108076 A CN200310108076 A CN 200310108076A CN 1609120 A CN1609120 A CN 1609120A
- Authority
- CN
- China
- Prior art keywords
- vdnep
- sequence
- polypeptide
- polynucleotide
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention provides non-specific exciton gene VdNEP of Verticillium dahliae capable of causing disease resisting allergic reaction on cotton and other plant and its application. VdNEP protein can induce the expression of Arabidopsis thalianum disease course related gene. Low concentration VdNEP protein can induce suspended cotton cell to synthesize gossypol as phytoalexin, while high concentration VdNEP protein can induce the allergic death of suspended cotton cell. When it is injection to cotton cotyledon, the protein in low concentration may cause allergic necrosis spot and the protein in high concentration may cause cotyledon wilting. Treating mature cotton euphylla with the protein will cause the euphylla dewatering. Applying VdNEP provides new way of improving plant disease resistance and has wide application foreground.
Description
Technical field
The present invention relates to the genetic engineering of plant for disease resistance field, relate more specifically to a kind of gene and application thereof that can on cotton and other plant, cause disease-resistant anaphylactoid non-specific big beautiful Verticillium (Verticillium dahliae) exciton.
Background technology
Be identified in plant and pathogen do mutually play keying action in the process.Pathogen must be discerned host plant possible in its living environment, and further discerns the special surface characteristic of host plant so that successful intrusion and infecting, and pathogen is wanted the host that infects of success, must discern and overcome the defense response of plant.Meanwhile, plant also must discern in its living environment various possible pathogen and start self corresponding defense mechanism.
In the recognition process of plant and pathogen, exciton and acceptor thereof play important effect.The initial only expression of exciton can be synthesized and plain molecule or other stimulating factors of accumulator plant defendance by inducing plant, but now generally is used for the molecule that all can stimulate defense mechanism, comprises oligosaccharides, glycoprotein, polypeptide and lipid molecule etc.
Exciton may be the material molecule that derives from pathogenic bacteria, also may be the compound that plant discharges under the effect of pathogenic bacteria.Exciton can be divided into 2 big classes, the specific exciton of nonspecific exciton and microspecies.Non-specific exciton can cause defense response on host and non-host plant, and specific exciton can only cause disease resistance response on the plant of special kind.
The defense mechanism of plant comprises the synthetic and accumulation that antimicrobial plant defendance is plain, attack the generation of the glycosyl hydrolase of pathogen surface polymer, oxygen production, the hypersensitive necrosis of cell suppresses protein inhibition synthetic of pathogen degrading enzyme and owing to callose, is rich in oxyproline glycoprotein or xylogen deposition and to the modification of plant cell wall.Final result is the disease resistance that strengthens plant.
Plant diseases has a strong impact on growth and development of plant, and the generation of disease often causes great loss to agriculture production, has a strong impact on development and national economy.Aspect the preventing and treating of Plant diseases, because toxicity, residual and resistance three big problems, the application of chemical prevention is very limited.Along with being gradually improved of molecular biological deeply development and recombinant DNA technology, utilize the disease-resistant gene engineering to improve the disease resistance of crop, obtained development rapidly in recent years.
Initial strategy be in plant the overexpression antibacterial protein strengthening the disease resistance of crop, but this method tends to influence the yield and quality of crop, and this resistance often is confined to seldom several pathogenic bacterias, can not produce the disease resistance of wide spectrum.The most important thing is that the effect of the antibacterial protein that changes over to can be subjected to the influence of the defense mechanism of plant own, the albumen that changes over to must be complementary with plant endogenous disease-resistant compound just can play disease-resistant effect.The disease-resistant gene of plant also is widely used in breeding for disease resistance, but the disease resistance that plant obtained tends to owing to the variation of pathogenic bacteria microspecies is lost, and disease-resistant gene usually can not well work in sibship species far away, and this has brought very big restriction (Maarten ﹠amp for application of disease-resistant gene; Jerome, 2001, Nature, 411:865-868).
Anaphylaxis (hypersensitive response) is the most strong weapon in the plant defense system.Selection can the anaphylactoid exciton gene of inducing plant, with the pathogenic bacterium inducing promoters driven and transform plant, this gene is expressed under the situation that pathogenic bacteria is invaded, and starts the anaphylaxis of plant, thereby is expected to obtain the disease resistance of broad spectrum.(Harald keller etc. such as Harald keller, 1999, The plant cell, 11:223-235) come the mould exciton gene cryptogein transformation of tobacco of arrogant male epidemic disease with the promoters driven of tobacco hsr203J gene, obtained the antimycotic tobacco of broad-spectrum, and the exciton gene that changes over to is only expressed under the situation that pathogen infects.And Maarten ﹠amp; The transgenic Fructus Lycopersici esculenti of Jerome can suppress (the Maarten ﹠amp that infects of virus; Jerome, 2001, Nature, 411:865-868).
Cotton is one of important cash crop of China, and verticillium is the pandemic a kind of disease of cotton.Because the generation of verticillium causes suitable serious economy loss for the Cotton Production of China.The most effective in the prophylactico-therapeutic measures of taking at verticillium is exactly to plant disease-resistant variety.Obtain the approach of resistant variety, a kind of is traditional breeding method, but breeding time is long, and expensive big, the resistance of resistant variety is easily degenerated, and is subjected to the few restriction of resistant variety resource.Another kind method is by the disease-resistant gene engineering genes involved to be imported in the cotton body, cotton is obtained or enhances disease resistance, and do not influence the fine quality of cotton itself.The exciton gene that the clone can cause allergic reaction on cotton will provide genetic resources for the cotton disease resistance genetically engineered.
Up to now, verticillium dahliae secretor type exciton gene was not still reported in this area, so this area presses for exploitation verticillium dahliae secretor type exciton gene.
Summary of the invention
Purpose of the present invention just provides a kind of verticillium dahliae secretor type exciton gene.
In a first aspect of the present invention, a kind of isolated VdNEP polypeptide of novelty is provided, the arrogant beautiful Verticillium of this peptide source, it comprises: polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative with SEQ ID NO:2 aminoacid sequence.
Preferably, this polypeptide is selected from down group: (a) have 1-233 position among the SEQ ID NO:2,19-233 position (removal signal peptide), or the polypeptide of 24-233 position (removing signal peptide and preceding 5 aa) aminoacid sequence; (b) with 1-233 position among the SEQ ID NO:2, the 19-233 position, or the described aminoacid sequence in 24-233 position forms through replacement, disappearance or the interpolation of one or more amino-acid residues, and have cause hypersensitive necrosis spot function by (a) polypeptides derived.
More preferably, this polypeptide is to have 1-233 position among the SEQ ID NO:2,19-233 position, or 24-233 amino acids polypeptide of sequence.
In a second aspect of the present invention, the polynucleotide of isolating these polypeptide of coding are provided, these polynucleotide comprise a nucleotide sequence, and this nucleotide sequence is shown at least 70% homogeny with a kind of nucleotides sequence that is selected from down group: (a) polynucleotide of the above-mentioned VdNEP polypeptide of coding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 19-717 position among the SEQ ID NO:1; (b) has the sequence of 1-903 position among the SEQ ID NO:1; (c) has the sequence of 73-717 position among the SEQ ID NO:1.
In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.
In a fourth aspect of the present invention, provide preparation to have the method for the active polypeptide of VdNEP, this method comprises: (a) under the condition that is fit to expression VdNEP, cultivate the above-mentioned host cell that is transformed or transduce; (b) from culture, isolate and have the active polypeptide of VdNEP.
In a fifth aspect of the present invention, provide and above-mentioned VdNEP polypeptid specificity bonded antibody.The nucleic acid molecule that can be used for detecting also is provided, and it contains a successive 10-903 Nucleotide in the above-mentioned polynucleotide.
In a sixth aspect of the present invention, the method that whether has VdNEP in the test sample is provided, it comprises: sample is contacted with the specific antibody of VdNEP, observe whether form antibody complex, formed antibody complex and just represented to exist in the sample VdNEP.
In a seventh aspect of the present invention, a kind of method of improving disease resistance of plant is provided, it comprises step:
(1) provide the Agrobacterium of carrying expression vector, described expression vector contains VdNEP polypeptid DNA encoding sequence, and described VdNEP polypeptide has 1-233 position among the SEQ ID NO:2,19-233 position, or the aminoacid sequence of 24-233 position;
(2) vegetable cell or tissue or organ are contacted with Agrobacterium in the step (1), thereby make VdNEP polypeptid DNA encoding sequence change vegetable cell over to, and be incorporated on the karyomit(e) of vegetable cell;
(3) select vegetable cell or tissue or the organ that changes VdNEP polypeptid DNA encoding sequence over to;
(4) vegetable cell in the step (3) or tissue or neomorph are become plant.
Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
Description of drawings
Fig. 1 has shown the VdNEP gene nucleotide series
Fig. 2 has shown the protein sequence of VdNEP gene:
Fig. 3 has shown that the ethene of VdNEP albumen and several different plant species and the proteic homology of necrosis induction compare (BLASTP) result.VdNEP albumen be respectively 62% from the ethene and the necrosis induction Argine Monohydrochloride sequence homology of fusarium (Fusarium oxysporum), list corruption mould (Pythium monospermum), melon and fruit corruption mould (Pythium aphanidermatum) and big male epidemic disease mould (Phytophthora sojae), 38%, 36%, 33%.
Fig. 4 has shown the hypersensitive necrosis spot that the VdNEP expressing protein causes on tobacco (A), Arabidopis thaliana (B) and cotton (C) blade.
Embodiment
The present invention has obtained coding ethene and the proteic gene VdNEP of necrosis induction from big beautiful Verticillium first through extensive and deep research.This gene amounts to 702 Nucleotide, and the albumen that prokaryotic expression obtains can cause the hypersensitive necrosis spot on tobacco and Arabidopsis leaf, and is attended by the outburst of active oxygen, is a kind of nonspecific exciton.Finished the present invention on this basis.
Of the present invention studies show that: VdNEP albumen can be induced the Arabidopis thaliana course of disease (PR) expression of gene of being correlated with.VdNEP albumen can the synthetic gossypol of inducing cotton suspension cell (kind of plant defendance is plain) under very low concentration.Cause the supersensitivity death (having typical DNA to shear phenomenon) of cotton suspension cell along with the raising of working concentration.The VdNEP protein injection is gone into cotton cotyledon, under lower concentration, the hypersensitive necrosis spot can occur equally, wilt and the blade dehydration under the high density condition, occurs.Handle sophisticated cotton true leaf blade with VdNEP albumen, then cause the dehydration of blade withered.
In the present invention, term " VdNEP ", " VdNEP polypeptide " or " exciton VdNEP " are used interchangeably, and all refer to have the albumen or the polypeptide of big beautiful Verticillium exciton VdNEP aminoacid sequence (SEQ ID NO:2).They comprise the exciton VdNEP that contains or do not contain initial methionine, also comprise the VdNEP that contains signal peptide.
As used herein, " isolating " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.
As used herein, " isolating VdNEP or polypeptide " is meant that the VdNEP polypeptide is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying VdNEP of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.
Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.
The present invention also comprises fragment, derivative and the analogue of VdNEP.As used herein, term " fragment ", " derivative " are meant with " analogue " and keep identical biological function of natural VdNEP of the present invention or active polypeptide basically.Polypeptide fragment of the present invention, derivative or analogue can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferred conservative amino acid residue), and the amino-acid residue of such replacement can be also can not encoded by genetic code, or (ii) in one or more amino-acid residues, has a polypeptide of substituted radical, or (iii) mature polypeptide and another compound (such as the compound that prolongs the polypeptide transformation period, polyoxyethylene glycol for example) merges formed polypeptide, or (iv) additional aminoacid sequence is fused to this peptide sequence and the polypeptide that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying, or with the fusion rotein of the segmental formation of antigen I gG).According to the instruction of this paper, these fragments, derivative and analogue belong to the known scope of those skilled in the art.
In the present invention, term " VdNEP polypeptide " refers to have the active SEQ ID of VdNEP NO.2 polypeptide of sequence.This term also comprises having and the variant form VdNEP identical function, SEQ ID NO.2 sequence.These variant forms comprise (but being not limited to): one or more (it is individual to be generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and C-terminal and/or one or more (being generally in 20 of N-terminal interpolation, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises active fragments and the reactive derivative of VdNEP.
The variant form of this polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, under high or low tight degree condition can with the coded albumen of the DNA of VdNEPDNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-VdNEP polypeptide to obtain.The present invention also provides other polypeptide, as comprises VdNEP polypeptide or its segmental fusion rotein (fusion rotein shown in SEQ ID NO:3).Except the polypeptide of total length almost, the present invention has also comprised the soluble fragments of VdNEP polypeptide.Usually, this fragment have the VdNEP peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.
Invention also provides the analogue of VdNEP or polypeptide.The difference of these analogues and natural VdNEP polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
In the present invention, " VdNEP conservative property variation polypeptide " refers to compare with the aminoacid sequence of SEQ ID NO:2, has 10 at the most, preferably at the most 8, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best.These conservative property variation polypeptide preferably carry out the amino acid replacement according to table 1 and produce.
Table 1
| Initial residue | Representational replacement | The preferred replacement |
| Ala(A) | Val；Leu；Ile | Val |
| Arg(R) | Lys；Gln；Asn | Lys |
| Asn(N) | Gln；His；Lys；Arg | Gln |
| Asp(D) | Glu | Glu |
| Cys(C) | Ser | Ser |
| Gln(Q) | Asn | Asn |
| Glu(E) | Asp | Asp |
| Gly(G) | Pro；Ala | Ala |
| His(H) | Asn；Gln；Lys；Arg | Arg |
| Ile(I) | Leu；Val；Met；Ala；Phe | Leu |
| Leu(L) | Ile；Val；Met；Ala；Phe | Ile |
| Lys(K) | Arg；Gln；Asn | Arg |
| Met(M) | Leu；Phe；Ile | Leu |
| Phe(F) | Leu；Val；Ile；Ala；Tyr | Leu |
| Pro(P) | Ala | Ala |
| Ser(S) | Thr | Thr |
| Thr(T) | Ser | Ser |
| Trp(W) | Tyr；Phe | Tyr |
| Tyr(Y) | Trp；Phe；Thr；Ser | Phe |
| Val(V) | Ile；Leu；Met；Phe；Ala | Leu |
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.As used herein, " varient of degeneracy " is meant that in the present invention coding has the protein of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.
The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence of an encoding mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.
Term " polynucleotide of coded polypeptide " can be the polynucleotide that comprise this polypeptide of encoding, and also can be the polynucleotide that also comprise additional code and/or non-coding sequence.
The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.
The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 50%, preferably at least 70%, the polynucleotide of at least 80% homogeny more preferably.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 90%, be more preferably 95% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.
The invention still further relates to nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " contains 15 Nucleotide at least, better is at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid to determine and/or to separate the polynucleotide of coding VdNEP.
VdNEP Nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.
In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.
In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.
At present, can be fully obtain the dna sequence dna of code book invention albumen (or its fragment, or derivatives thereof) by chemosynthesis.This dna sequence dna can be introduced in various existing dna moleculars as known in the art (or as carrier) and the cell then.In addition, also can will suddenly change and introduce in the protein sequence of the present invention by chemosynthesis.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with carrier of the present invention or VdNEP encoding sequence, and the method that produces polypeptide of the present invention through recombinant technology.
Recombinant DNA technology (Science, 1984 by routine; 224:1431), can utilize polymerized nucleoside acid sequence of the present invention to can be used to express or produce the VdNEP polypeptide of reorganization.In general following steps are arranged:
(1). with the polynucleotide (or varient) of coding of the present invention VdNEP polypeptide, or with the recombinant expression vector that contains these polynucleotide proper host cell that transforms or transduce;
(2). the host cell of in suitable medium, cultivating;
(3). separation, protein purification from substratum or cell.
Among the present invention, the VdNEP polynucleotide sequence can be inserted in the recombinant expression vector.Term " recombinant expression vector " refers to bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus or other carriers.In a word, as long as can duplicate in host and stablize, any plasmid and carrier can be used.A key character of expression vector is to contain replication orgin, promotor, marker gene and translation controlling elements usually.
Method well-known to those having ordinary skill in the art can be used to make up and contains VdNEP DNA sequences encoding and suitable transcribing/the translate expression vector of control signal.These methods comprise extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technology of body etc.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance.
Comprise the carrier of above-mentioned suitable dna sequence dna and suitable promotor or control sequence, can be used to transform appropriate host cell, so that it can marking protein.
Host cell can be a prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as vegetable cell.Representative example has: intestinal bacteria, streptomyces, Agrobacterium; Fungal cell such as yeast; Vegetable cell etc.
When polynucleotide of the present invention are expressed in higher eucaryotic cells, be enhanced if will make to transcribe when in carrier, inserting enhancer sequence.Enhanser is the cis acting factor of DNA, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.
Persons skilled in the art all know how to select appropriate carriers, promotor, enhanser and host cell.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results
2Method is handled, and used step is well-known in this area.Another kind method is to use MgCl
2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.
Transform plant and also can use methods such as Agrobacterium-mediated Transformation or particle gun conversion, for example leaf dish method.Can use ordinary method regeneration plant for plant transformed cell, tissue or organ, thereby obtain the plant that disease resistance improves.
The transformant that obtains can be cultivated with ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
The extracellular can be expressed or be secreted into to recombinant polypeptide in the above methods in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation handles, with protein precipitant handle (salt analysis method), centrifugal, the broken bacterium of infiltration, superly handle, the combination of super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
The VdNEP or the polypeptide of reorganization are of use in many ways.For example be used to screen antibody, polypeptide or other part that promotes or resist the VdNEP function.Can be used for seeking the valuable peptide molecule that can suppress or stimulate the VdNEP function with the reorganization VdNEP screening peptide library of expressing.
On the other hand, the present invention also comprises VdNEPDNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Preferably, refer to that those can combine with VdNEP gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress the molecule of VdNEP, comprise that also those do not influence the antibody of VdNEP function.The present invention also comprise those can with modify or without the VdNEP gene product bonded antibody of modified forms.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment or chimeric antibody.
Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the VdNEP gene product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing VdNEP or its has antigenic segmental cell and can be used to immune animal and produce antibody.This type of monoclonal antibody can utilize hybridoma technology to prepare.Each antibody-like of the present invention can utilize the fragment or the functional zone of VdNEP gene product, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of VdNEP gene product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).
Available VdNEP of the production of polyclonal antibody or polypeptide immune animal, as rabbit, mouse, rat etc.Multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.
The invention still further relates to the testing method of quantitative and detection and localization VdNEP level.These tests are known in the art.A kind of method that whether has VdNEP in the test sample that detects is to utilize the specific antibody of VdNEP to detect, and it comprises: sample is contacted with the VdNEP specific antibody; Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample VdNEP.
In an example of the present invention, a kind of isolating polynucleotide are provided, its coding has the polypeptide of aminoacid sequence shown in the SEQ IDNO:2.Polynucleotide of the present invention are isolated from big beautiful Verticillium cDNA library.Its sequence is shown in SEQ ID NO:1, and the polynucleotide sequence total length that it comprises is 903 bases, and its open reading frame is positioned at the 19-717 position, and the coding total length is 233 amino acid whose VdNEP (SEQ IDNO:2).
VdNEP provides new approach for the disease resistance of improving plant, thereby has great application prospect.The plant that available VdNEP of the present invention improves disease resistance (especially resisting verticillium bacterium) is not particularly limited, because VdNEP is nonspecific exciton.Representational plant comprises (but being not limited to): cotton, tobacco, Arabidopis thaliana or the like.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
The structure in big beautiful Verticillium cDNA library and the release of phage
25 ℃, 150rpm shakes suspension culture big beautiful Verticillium (Verticillium dahliae) 2-3 week, when the secretion of its secretory protein peaks, collecting thalline is material, extract total RNA, that utilizes Stratagene company builds the storehouse test kit, has made up the cDNA library of a verticillium dahliae in order to method down.
Sample after synthetic first and second chain cDNA and the fractional separation is all got certain amount electrophoresis, guarantee quality, the especially fractional separation of cDNA after, the component that contains the following cDNA of 500bp does not all adopt, in order to avoid influence the joint efficiency of big segment cDNA.CDNA through the packaging protein packing, is contained 1.0 * 10 with after ZAP express carrier (Stratagene company) is connected approximately
6The former storehouse of Pfu independent cloning.
With XL
1-Blue competent cell (Stratagene company) is used 10mM MgSO
4Be diluted to OD
600Be 1.0.The preparation of SOLR cell is similar to XL
1-Blue cell grows to OD at last
600Between 0.5-1.0.In the 1.5ml centrifuge tube, add 200 μ l XL1-Blue cells, 5 μ l positive bacteriophage solution, 1 μ l ExAssit helper phage (＞1 * 10
6Pfu/ml, Stratagene company), mixing, 37 ℃ of incubation 15min.Mixed solution is gone among the 3ml LB, 37 ℃ shaking culture 2-2.5 hour.2, the centrifugal 15min of 000g, sucking-off supernatant.70 ℃ of incubation 15min, 4, the centrifugal 15min of 000g, sucking-off supernatant liquor.Respectively add the fresh XLOLR cell of 200 μ l (Stratagene company) in two 1.5ml centrifuge tubes, and add above-mentioned supernatant liquor 100,10 μ l respectively, 37 ℃ of incubation 15min respectively get 10-50 μ l shop LB (containing 100 μ g/ml Amp) flat board, 37 ℃ of overnight incubation.Obtain mono-clonal.
The result:
The library phage is discharged in the XLOLR cell, obtains 2000 of mono-clonals.
Embodiment 2
The analysis of order-checking and ESTs sequence
The picking mono-clonal, 96 orifice plates concussion overnight incubation.Extract plasmid, sampling electrophoresis detection plasmid quality.With the T3 primer is sequencing primer, checks order on the Megabase automatic sequencer.1300 dna sequence dnas that obtain are compared in Genebank, according to comparative result, according to the function that the ESTs sequence is possible classify (expected value is greater than e-3).
The result:
In these 1300 ESTs sequences, the sequence of decision albumen destiny has 35; 12 of the sequences synthetic relevant with albumen; 5 of the sequences relevant with cytoskeleton; 24 of transfer related proteins; The sequence 71 that the signal conduction is relevant is individual; Transcribe 10 of relevant sequences; With self-defense with infect 52 of the relevant sequences of host; 5 of the metabolic sequences of DNA; 17 of the relevant sequences of energy metabolism; In Genebank, do not find any homologous sequence 229, account for 17.6%, 646 of the sequences of homology lower (expected value is greater than e-3) are near 50%; With 41 of the sequences of the albumen homology of Unknown Function; And the sequence more than 100 of other function is individual.
With fungi defence with infect in 52 relevant ESTs sequences of host, the virulence factor in partial sequence encoded protein and other plant or the animal pathogen or infect associated protein and higher similarity is arranged, the exciton of the big beautiful Verticillium of may encoding.
Wherein, the 06H05 sequence encoding secretes the outer aspartate protease of born of the same parents, and this proteolytic enzyme plays a part crucial in many animal pathogens infect host's process, may with the adhering to, grow surely and invade relevant of pathogenic bacteria.The 03E05 sequence encoding secretes the outer serine protease of born of the same parents, and 09F07 sequence encoding lignoenzyme all may participate in the degraded of host cell wall.
Interesting is that the ethene of an about 25KD of 07G01 sequence encoding and necrosis induction albumen are 62% with the ethene and the necrosis induction Argine Monohydrochloride sequence homology that separate from sickle-like bacteria.There are some researches show, separate can evoking tobacco from the ethene of sickle-like bacteria and necrosis induction albumen disease-resistant defense response, thereby 07G01 a kind of exciton of probably also encoding, this gene is named as VdNEP.
To sequencing result such as the SEQ ID NO:1 and shown in Figure 1 of VdNEP, be total to 903bp, wherein ORF is positioned at the 19-717 position, the albumen (SEQ ID NO:2 and Fig. 2) that the total length of encoding is 233aa.Wherein signal peptide is positioned at the 1-18 position.
The proteic homology of the ethene of VdNEP albumen and several different plant species and necrosis induction compares (BLASTP) result as shown in Figure 3.VdNEP albumen be respectively 62% from ethene and the necrosis induction Argine Monohydrochloride sequence homology of Fusarium oxysporum, Pythium monospermum, Pythium aphanidermatum and Phytophthora sojae, 38%, 36%, 33%.
VdNEP Prokaryotic Expression and purifying
(a) structure of expression vector:
VdNEP gene cDNA full length sequence forward primer VdNEPEcoRF 5 ' gaattccagcagccccccaaggtt 3 ' (SEQ ID NO:3; Contain EcoR I restriction enzyme site) and reverse primer VdNEPNotR 5 ' gcggccgcttaaaacgcggcgcgcatg 3 ' (SEQ ID NO:4; Contain the NotI restriction enzyme site), with extractive big beautiful Verticillium mRNA is template, after carrying out the RT-PCR amplification, the Pfu polysaccharase (removed the signal peptide sequence of prediction), enzyme is cut, connect importing pET32a (+) plasmid (Novagen company), the heat shock method changes bacillus coli DH 5 alpha over to, selects positive colony, shake bacterium and extract plasmid, sequence verification.
(b) abduction delivering:
The plasmid that step (a) is obtained changes e. coli bl21 over to the heat shock method.Select positive colony, 37 ℃ are cultured to OD in the LB substratum that contains 100 μ g/ml Amp
600=0.4-0.6 adds IPTG (final concentration is 1mM), and 22 ℃, the 220rpm concussion was cultivated 12 hours.High speed centrifugation is collected thalline.With the lysis buffer thalline that suspends again, after the ultrasonic disruption thalline, 4 ℃ of high speed centrifugations are collected supernatant liquor.Get supernatant liquor 20uL, add the 2XSDS sample-loading buffer of equivalent, high speed centrifugation is 5 minutes after boiling water bath 3-5 minute.The SDS-PAGE electrophoresis, Coomassie brilliant blue R250 solution-dyed is observed protein induced expression.
The result: the SDS-PAGE electrophoresis detection, the amalgamation and expression albumen (His-VdNEP fusion rotein) of an about 42KD of acquisition conforms to predictor.
Protein purification:
PET system manipulation handbook according to Novagen company carries out, and adopts pET HisTag Ni affinity chromatography.The preparation of damping fluid is referring to operational manual.The supernatant liquor of collecting is slowly passed through the Ni-NTA resin column, make the expressing protein and the resin-bonded that have his albumen label, the foreign protein with a large amount of cleaning buffer solution non-specific binding elutes expressing protein with elution buffer at last from resin column.The protein solution that collection elutes, 4 ℃ of dialysed overnight in the phosphate buffered saline buffer of large volume.
Protein quantification:
The protein solution that obtains is quantitative with Xylene Brilliant Cyanine G G-250 solution.The his label protein of about 20KD of purifying pET32a (+) empty plasmid expression simultaneously in contrast.
Result: the amalgamation and expression albumen (His-VdNEP fusion rotein) that has obtained about 42KD of purifying.
Embodiment 4
The reaction that the VdNEP expressing protein causes on tobacco and Arabidopis thaliana
With the 1mL syringe of needle-less the VdNEP expressing protein solution of 0.02 μ g/ μ L is injected into the blade of tobacco and Arabidopis thaliana respectively from vacuum side of blade, injects the his label protein simultaneously in contrast.Observe the reaction on tobacco and the Arabidopsis leaf after 48 hours.
Inject 2 hours later on DAB (3,3 '-Diaminobenzidine) solution dyes to Arabidopsis leaf, observes oxygen production.Cut DAB (Sigma) that blade is immersed in 1mg/mL (pH3.8) in, 25 ℃ of illumination 8 hours is taken out blade and is placed 96% ethanol to boil 10 minutes, soaks 4 hours in fresh ethanol then, observes to have or not reddish-brown precipitation to produce and take pictures.
Inject and with trypan blue solution Arabidopsis leaf was dyeed later the supersensitivity death of observation of cell in 8 hours.Blade was boiled 2 minutes in containing the lactophenol solution of 0.25mg/mL trypan blue, place the Chloral Hydrate solution decolouring 12 hours of 2.5g/mL, observe and take pictures.Dead cell is dyed blueness.
RT-PCR analyzes: get required material and wear into fine powder with liquid nitrogen, add 1mLTRIzol reagent (Invitrogen), mixing and room temperature left standstill 5 minutes.Add 0.2mL chloroform mixing again, room temperature left standstill 3 minutes.Centrifugal 10 minutes of 4 ℃ of 12000g, supernatant move to new pipe and add 0.5mL Virahol room temperature and place 10 minutes with precipitated rna, centrifugal 10 minutes of 12000g.Precipitation is washed slightly with 70% ethanol, and RNA is dissolved in the water of DEPC processing of certain volume.
RNA PCR system of Takara company is adopted in the PolyA mRNA first chain reverse transcription.Get the total RNA of 1 μ g, according to the operation of test kit specification sheets, after room temperature left standstill 10min, 42 ℃ of reaction 30min took out, and after boiling water boils 5min, place on ice, so that the ThermoScript II inactivation.Get 1 μ l reverse transcription product and make PCR.With Actin muscle is interior mark, proofreaies and correct the template amount that is used for the RT-PCR reaction.Be PCR (PR1 gene forward primer PR1F:5 ' tcccgctcaaccgccaaaag3 ' (SEQ ID NO:5), reverse primer PR1R:5 ' acggaggcacaaccaagtcg3 ' (SEQ ID NO:6) with the specific separately primer of PR gene; ACS6 gene forward primer ACS6F:5 ' cataagtgttgcggaagtaa ' (SEQ ID NO:7), reverse primer ACS6R:5 ' ggcaatggaacgaacc3 ' (SEQ ID NO:8)), analyze the variation of PR genetic expression.
The result:
The VdNEP expressing protein of 0.02ug/uL has caused hypersensitive necrosis spot (Fig. 4 A and Fig. 4 B) after 48 hours on tobacco and Arabidopsis leaf.Inject after 2 hours, Arabidopsis leaf is dyeed, find to have oxygen production with DAB solution.Inject and with trypan blue solution Arabidopsis leaf was dyeed later in 8 hours, promptly find to have the supersensitivity death of cell.
The RT-PCR analysis revealed, the expression that the VdNEP expressing protein can be induced Arabidopis thaliana PR albumen (ACS6 and PR1) in 4 hours later in injection.
Embodiment 5
The reaction that the VdNEP expressing protein causes on cotton
(a) to the influence of the cotton cells of suspension culture
The cotton cells suspension culture:
The picking growth is vigorous, the callus lines of short texture, be transferred to MB (MS macroelement, trace element+B5 organism, and additional 1mg/L 2,4-D, 0.1mg/L IAA, 0.1mg/L KT) in the liquid nutrient medium, 24 ℃, the 110rpm shaking culture, per 7 days succeeding transfer culture are once, behind subculture 3-5 time, be used for exciton and handle experiment.
Evans Blue dyeing:
Cell was dyeed 20 minutes in 0.02% Evans Blue staining fluid, behind big water gaging flushing cell, cell is layered on the slide glass, examine under a microscope and take pictures, dead cell is dyed blueness.
DNA shears:
Extract suspension cell DNA with apoptosis DNA extraction agent box (Hua Shun company), carry out electrophoresis detection on 2% sepharose, observation DNA shears phenomenon and takes pictures.
VdNEP expressing protein solution is added cotton suspension culturing cell to final concentration be respectively 0.01,0.05,0.1,0.5 and 1 μ g/mL, continue to cultivate after 36 hours, measure the content of gossypol in the suspension cell, the mortality ratio that the cotton suspension culturing cell is observed in the blue dyeing of ivens (Evans) simultaneously.
The result:
When the VdNEP protein concentration was 0.01-0.1ug/mL, the gossypol content in the suspension cell increased along with the raising of VdNEP expressing protein concentration, and the blue dyeing of Evans shows that the mortality ratio of cotton suspension culturing cell is also increasing.When VdNEP expressing protein concentration concentration reached 0.5ug/mL, the gossypol content in the suspension cell sharply descended, and the blue dyeing of Evans shows that the cotton suspension culturing cell is almost all dead.DNA detection shows that dead cell has tangible DNA to shear phenomenon, is typical supersensitivity death.
(b) to the influence of cotton leaf
(i) with the 1mL syringe of needle-less the VdNEP expressing protein solution of different concns (0.02,0.2 and 2ug/uL) is injected into the cotyledon of cotton respectively, 28 ℃ of illumination cultivation are regularly observed leaf symptom.
Found that, under lower concentration (0.02ug/uL), can form hypersensitive necrosis spot (Fig. 4 C) on 48 hours rear blades, under high density (2ug/uL), the wilting of promptly dewatering of 12 hours rear blades.
The cotton true leaf blade petiole that (ii) will newly cut immerses 0.7ug/uLVdNEP expressing protein solution, and 28 ℃ of illumination cultivation are regularly observed leaf symptom.
Found that after 48 hours, the blade dehydration is withered.
Embodiment 6
The characterization of molecules of VdNEP gene
Southern blot analyzes:
Extract the genomic dna of big beautiful Verticillium, every sample is got 20 μ g DNA and is used Pst I respectively, Xba I, and Xho I enzyme is cut.After treating the DNA complete degestion, 0.8% agarose gel electrophoresis cuts unnecessary gel, and 0.25M HCl soaks 15min, and washing adds sex change liquid, and in room temperature jog sex change 45min, of short duration washing adds in the neutralizer room temperature and 30min.With 20 * SSC serves as to shift liquid, inhales the seal method with kapillary and changes film 12-16 hour, and DNA is transferred on the Hybond-XL film, and with sample hole site on the pencil mark, the of short duration rinsing of 6 * SSC, 80 ℃ of bakings are fixed 2 hours, and are standby.
Probe mark:
The PCR product that embodiment 3 is obtained is got 25ng as the template label probe behind electrophoresis, rubber tapping purifying.The mark of probe uses Prime-a-Gene Labeling System (Promega), marked body be 50 μ L (mix α-
32P-dCTP), 37 ℃ of temperature were bathed 1 hour.The probe of mark is with QIAquick NucleotideRemoval Kit purifying.
Prehybridization and hybridization:
Commentaries on classics is had total RNA nitrocellulose filter, immerses in the 10mL prehybridization solution, in hybrid heater 42 ℃ prehybridization 2-4 hour.With the probe after the sex change, all add in the above-mentioned prehybridization solution, hybridized 24 hours for 42 ℃.
Wash film and compressing tablet:
Hybridization is poured out hybridization solution after finishing.Wash film according to following program:
1) 2 * SSC, 0.1%SDS room temperature washing twice, each 5min,
2) 0.2 * SSC, 0.1%SDS room temperature washing twice, each 5min,
3) 0.2 * SSC, 0.1%SDS, 42 ℃ of washed twice, each 15min,
4) 2 * SSC, the of short duration rinsing of room temperature.
Film is placed on the paper handkerchief, to remove most of liquid.Film is wrapped up smooth being pressed under the X-ray sheet, additional intensifying screen ,-70 ℃ of times that exposure is suitable, general 2-3 days with preservative film.According to ordinary method towards X-ray sheet developing.
Northern blot analyzes:
From the big beautiful Verticillium mycelia of different incubation times, extract RNA, quantitatively.Add ethidium bromide in the sample, so that finish the applied sample amount that the back preliminary observation is adjusted RNA simultaneously at electrophoresis.Every swimming lane application of sample amount is the total RNA of 15 μ g, and electrophoresis uses 1.2% agarose, 1 * MOPS electrophoretic buffer, and strength of electric field 8V/cm, the half to dye migration to gel finishes.Gel builds the transfer platform behind 20 * SSC balance 45min, in 20 * SSC, RNA is transferred to (24 hours) on the Hybond-XL film.After shift finishing, on film, mark the position of well, and the upper left corner that cuts off film serves as a mark with pencil.Film is clipped between the two layers of filter paper after the of short duration rinsing of 6 * SSC solution, and after 2 hours, hybridization is preserved or is directly used in sealing 80 ℃ of bakings.Probe mark and hybridization are analyzed with Southern blot.
The result:
To the Southern analysis revealed of VdNEP gene, this gene is single copy in big beautiful Verticillium.And the Northern analysis revealed, the expression level under this gene earthquake culture condition is not high, and expression amount is slightly high when the 7th day left and right sides.
Embodiment 7
The proteic structural analysis of VdNEP
With the method for the Megaprimer of routine, be template with the VdNEP gene, design different primers and carry out PCR, obtain the point mutation sequence.Designing primer simultaneously, is template with the VdNEP gene, obtains the various two ends of VdNEP gene deletion sequence.Enzyme is cut, and connects to import pET32a (+) plasmid, and the heat shock method changes bacillus coli DH 5 alpha over to, selects positive colony, shakes bacterium and extracts plasmid, sequence verification.
The abduction delivering mutain is injected tobacco leaf behind the purifying.Can to cause the hypersensitive necrosis spot on tobacco leaf be the exciton activity that standard is judged mutain.
The result:
Point mutation analysis shows that proteic 3 cysteine residues of VdNEP and several conservative amino-acid residue (C56 among the SEQ ID NO:2, C82, C218 and 122-128 position GHRHDWE) are necessary for proteic exciton activity.And the experimental result of two ends disappearance shows that proteic integrity is to the active no less important of its exciton.Have only the N end to follow 5 amino-acid residues in the signal peptide back to lack, promptly the absence type VdNEP of 24-233 position still has the exciton activity among the SEQIDNO:2.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
＜110〉Shanghai Inst. of Life Science, CAS
＜120〉verticillium dahliae secretor type exciton gene and application thereof
<130>036260
<160>8
<170>PatentIn?version?3.1
<210>1
<211>903
<212>DNA
＜213〉big beautiful Verticillium (Verticillium dahliae)
<220>
<221>CDS
<222>(19)..(717)
<223>
<400>1
gccatctgca?cctgctac?atg?ctt?ccc?tcc?gca?gtc?ttc?tcg?gtc?ttt?gcc?????51
Met?Leu?Pro?Ser?Ala?Val?Phe?Ser?Val?Phe?Ala
1???????????????5????????????????????10
ctc?gtc?ggc?agc?gcc?ttg?gct?cag?cag?ccc?ccc?aag?gtt?aac?cac?gac?????99
Leu?Val?Gly?Ser?Ala?Leu?Ala?Gln?Gln?Pro?Pro?Lys?Val?Asn?His?Asp
15??????????????20??????????????????????25
agt?atc?aac?ccc?gtc?cgc?gat?act?ctg?ggg?ccc?aac?ggc?gac?atg?atc????147
Ser?Ile?Asn?Pro?Val?Arg?Asp?Thr?Leu?Gly?Pro?Asn?Gly?Asp?Met?Ile
30??????????????????35???????????????????40
agg?aag?ttc?cag?cct?ctg?ctt?cac?att?gcc?cac?ggt?tgc?cag?cct?tac????195
Arg?Lys?Phe?Gln?Pro?Leu?Leu?His?Ile?Ala?His?Gly?Cys?Gln?Pro?Tyr
45??????????????????50???????????????????55
tcc?gct?gtc?aac?acc?cgc?ggt?gag?gtc?aac?gcc?ggt?ctc?caa?gac?agc????243
Ser?Ala?Val?Asn?Thr?Arg?Gly?Glu?Val?Asn?Ala?Gly?Leu?Gln?Asp?Ser
60???????????????????65??????????????????70??????????????????75
ggt?acc?acc?gca?ggc?ggc?tgc?aag?gaa?acc?agc?aag?ggc?cag?acc?tac????291
Gly?Thr?Thr?Ala?Gly?Gly?Cys?Lys?Glu?Thr?Ser?Lys?Gly?Gln?Thr?Tyr
80???????????????????85??????????????????90
gcc?cgc?tcc?atg?acc?ctg?aac?ggc?cag?ttc?ggc?atc?atg?tac?gcc?tgg????339
Ala?Arg?Ser?Met?Thr?Leu?Asn?Gly?Gln?Phe?Gly?Ile?Met?Tyr?Ala?Trp
95???????????????????100?????????????????105
tac?tgg?ccc?aag?gac?cag?ccc?gcc?gac?ggc?aac?ctc?gcc?agc?ggc?cac????387
Tyr?Trp?Pro?Lys?Asp?Gln?Pro?Ala?Asp?Gly?Asn?Leu?Ala?Ser?Gly?His
110?????????????????115?????????????????120
cgc?cac?gac?tgg?gag?aac?gtc?gtc?atc?tgg?ttc?aac?tcg?aac?aac?gca??????435
Arg?His?Asp?Trp?Glu?Asn?Val?Val?Ile?Trp?Phe?Asn?Ser?Asn?Asn?Ala
125??????????????????130?????????????????135
aac?cag?gcc?ggc?atc?ctg?cgc?ggc?gcc?gcc?tcg?ggc?cac?ggc?gac?tac??????483
Asn?Gln?Ala?Gly?Ile?Leu?Arg?Gly?Ala?Ala?Ser?Gly?His?Gly?Asp?Tyr
140?????????????????145?????????????????150?????????????????155
aag?aag?gtc?aac?aac?ccc?cag?cgc?aac?aac?aac?aac?ctc?cac?gtc?gag??????531
Lys?Lys?Val?Asn?Asn?Pro?Gln?Arg?Asn?Asn?Asn?Asn?Leu?His?Val?Glu
160?????????????????165?????????????????170
tac?ttc?acc?agc?ctc?ggc?aag?aac?cac?gag?ctg?cag?ttc?aag?acg?tcg??????579
Tyr?Phe?Thr?Ser?Leu?Gly?Lys?Asn?His?Glu?Leu?Gln?Phe?Lys?Thr?Ser
175?????????????????180?????????????????185
ccc?ggc?cgc?acc?tac?tgg?atc?tgg?gac?tgg?gac?agg?atg?gac?acc?acc??????627
Pro?Gly?Arg?Thr?Tyr?Trp?Ile?Trp?Asp?Trp?Asp?Arg?Met?Asp?Thr?Thr
190?????????????????195?????????????????200
gtc?cag?ggc?gcc?ctc?aac?cgc?gcc?gac?ttt?ggc?agc?gcc?aac?tgc?ccc??????675
Val?Gln?Gly?Ala?Leu?Asn?Arg?Ala?Asp?Phe?Gly?Ser?Ala?Asn?Cys?Pro
205?????????????????210?????????????????215
ttc?aac?aac?aac?aac?ttt?gag?agg?aac?atg?cgc?gcc?gcg?ttt??????????????717
Phe?Asn?Asn?Asn?Asn?Phe?Glu?Arg?Asn?Met?Arg?Ala?Ala?Phe
220?????????????????225?????????????????230
taaaggctcg?acgcgcggct?cgccagtcct?ggattccatc?tgggcacgca?ccttggctct????777
ttctcctccc?gccttggctt?ggcttcttga?ggctagtcga?gtgctagcat?aggtcctgta????837
catagcttgt?tctgaattac?atacaactct?gcctgtcgaa?aaaaaaaaaa?aaaaaaaaaa????897
ctcgag???????????????????????????????????????????????????????????????903
<210>2
<211>233
<212>PRT
＜213〉big beautiful Verticillium (Verticillium dahliae)
<400>2
Met?Leu?Pro?Ser?Ala?Val?Phe?Ser?Val?Phe?Ala?Leu?Val?Gly?Ser?Ala
1???????????????5???????????????????10??????????????????15
Leu?Ala?Gln?Gln?Pro?Pro?Lys?Val?Asn?His?Asp?Ser?Ile?Asn?Pro?Val
20??????????????????25???????????????????30
Arg?Asp?Thr?Leu?Gly?Pro?Asn?Gly?Asp?Met?Ile?Arg?Lys?Phe?Gln?Pro
35??????????????????40??????????????????45
Leu?Leu?His?Ile?Ala?His?Gly?Cys?Gln?Pro?Tyr?Ser?Ala?Val?Asn?Thr
50??????????????????55??????????????????60
Arg?Gly?Glu?Val?Asn?Ala?Gly?Leu?Gln?Asp?Ser?Gly?Thr?Thr?Ala?Gly
65???????????????????70??????????????????75??????????????????80
Gly?Cys?Lys?Glu?Thr?Ser?Lys?Gly?Gln?Thr?Tyr?Ala?Arg?Ser?Met?Thr
85??????????????????90??????????????????95
Leu?Asn?Gly?Gln?Phe?Gly?Ile?Met?Tyr?Ala?Trp?Tyr?Trp?Pro?Lys?Asp
100?????????????????105?????????????????110
Gln?Pro?Ala?Asp?Gly?Asn?Leu?Ala?Ser?Gly?His?Arg?His?Asp?Trp?Glu
115?????????????????120?????????????????125
Asn?Val?Val?Ile?Trp?Phe?Asn?Ser?Asn?Asn?Ala?Asn?Gln?Ala?Gly?Ile
130?????????????????135?????????????????140
Leu?Arg?Gly?Ala?Ala?Ser?Gly?His?Gly?Asp?Tyr?Lys?Lys?Val?Asn?Asn
145?????????????????150?????????????????155?????????????????160
Pro?Gln?Arg?Asn?Asn?Asn?Asn?Leu?His?Val?Glu?Tyr?Phe?Thr?Ser?Leu
165?????????????????170?????????????????175
Gly?Lys?Asn?His?Glu?Leu?Gln?Phe?Lys?Thr?Ser?Pro?Gly?Arg?Thr?Tyr
180?????????????????185?????????????????190
Trp?Ile?Trp?Asp?Trp?Asp?Arg?Met?Asp?Thr?Thr?Val?Gln?Gly?Ala?Leu
195?????????????????200?????????????????205
Asn?Arg?Ala?Asp?Phe?Gly?Ser?Ala?Asn?Cys?Pro?Phe?Asn?Asn?Asn?Asn
210?????????????????215?????????????????220
Phe?Glu?Arg?Asn?Met?Arg?Ala?Ala?Phe
225?????????????????230
<210>3
<211>24
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(1)..(24)
＜223〉primer
<400>3
gaattccagc?agccccccaa?ggtt???????????????????????????????????????????24
<210>4
<211>27
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(1)..(27)
＜223〉primer
<400>4
gcggccgctt?aaaacgcggc?gcgcatg????????????????????????????????????????27
<210>5
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(1)..(20)
＜223〉primer
<400>5
tcccgctcaa?ccgccaaaag????????????????????????????????????????????????20
<210>6
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(1)..(20)
＜223〉primer
<400>6
acggaggcac?aaccaagtcg????????????????????????????????????20
<210>7
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(1)..(20)
＜223〉primer
<400>7
cataagtgtt?gcggaagtaa????????????????????????????????????20
<210>8
<211>16
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(1)..(16)
＜223〉primer
<400>8
ggcaatggaa?cgaacc????????????????????????????????????????16
Claims (10)
1. isolating VdNEP polypeptide is characterized in that this polypeptide is selected from down group:
(a) has 1-233 position among the SEQ ID NO:2,19-233 position, or 24-233 amino acids polypeptide of sequence;
(b) with 1-233 position among the SEQ ID NO:2, the 19-233 position, or the described aminoacid sequence in 24-233 position forms through replacement, disappearance or the interpolation of one or more amino-acid residues, and have cause hypersensitive necrosis spot function by (a) polypeptides derived.
2. polypeptide as claimed in claim 1 is characterized in that, this polypeptide has 1-233 position among the SEQ ID NO:2,19-233 position, or the aminoacid sequence of 24-233 position.
3. isolating polynucleotide is characterized in that, it comprises a nucleotide sequence, and this nucleotide sequence is selected from down group:
(a) polynucleotide of polypeptide according to claim 1 of encoding;
(b) with polynucleotide (a) complementary polynucleotide.
4. polynucleotide as claimed in claim 3 is characterized in that this polynucleotide encoding has 1-233 position among the SEQ IDNO:2,19-233 position, or the polypeptide of aminoacid sequence shown in the 24-233 position.
5. polynucleotide as claimed in claim 3 is characterized in that, the sequence of these polynucleotide is selected from down a kind of of group:
(a) has the sequence of 19-717 position among the SEQ ID NO:1;
(b) has the sequence of 1-903 position among the SEQ ID NO:1;
(c) has the sequence of 73-717 position among the SEQ ID NO:1.
6. a carrier is characterized in that, it contains the described polynucleotide of claim 3.
7. a genetically engineered host cell is characterized in that, it contains the described carrier of claim 6.
8. the preparation method of a VdNEP polypeptide is characterized in that, this method comprises:
(a) under expression condition, cultivate the described host cell of claim 7;
(b) from culture, isolate the VdNEP polypeptide.
9. energy and the described VdNEP specificity of claim 1 bonded antibody.
10. method of improving disease resistance of plant is characterized in that it comprises step:
(1) provide the Agrobacterium of carrying expression vector, described expression vector contains VdNEP polypeptid DNA encoding sequence, and described VdNEP polypeptide has 1-233 position among the SEQ ID NO:2,19-233 position, or the aminoacid sequence of 24-233 position;
(2) vegetable cell or tissue or organ are contacted with Agrobacterium in the step (1), thereby make VdNEP polypeptid DNA encoding sequence change vegetable cell over to, and be incorporated on the karyomit(e) of vegetable cell;
(3) select vegetable cell or tissue or the organ that changes VdNEP polypeptid DNA encoding sequence over to;
(4) vegetable cell in the step (3) or tissue or neomorph are become plant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200310108076 CN1266163C (en) | 2003-10-22 | 2003-10-22 | Cotton verticillium wilt germ secreted exciton gene and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200310108076 CN1266163C (en) | 2003-10-22 | 2003-10-22 | Cotton verticillium wilt germ secreted exciton gene and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1609120A true CN1609120A (en) | 2005-04-27 |
| CN1266163C CN1266163C (en) | 2006-07-26 |
Family
ID=34758456
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200310108076 Expired - Fee Related CN1266163C (en) | 2003-10-22 | 2003-10-22 | Cotton verticillium wilt germ secreted exciton gene and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1266163C (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102212121A (en) * | 2010-04-21 | 2011-10-12 | 中国科学院微生物研究所 | Pathogenic related protein VdGRP1 from verticillium dahliae kleb and coded gene thereof |
| WO2012079370A1 (en) * | 2010-12-17 | 2012-06-21 | 中国农业科学院植物保护研究所 | Verticillium dahliae protein elicitor gene, protein sequence and use thereof |
| CN103193874A (en) * | 2012-01-10 | 2013-07-10 | 中国科学院微生物研究所 | Secretory elicitor protein from Verticillium dahliae and coding gene and application thereof |
| US20180235229A1 (en) * | 2015-10-22 | 2018-08-23 | Pherobio Technology Co., Ltd | Applications of protein vdal in improving output, product quality and drought resistance of plant and in improving fruit coloring of plant |
-
2003
- 2003-10-22 CN CN 200310108076 patent/CN1266163C/en not_active Expired - Fee Related
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102212121A (en) * | 2010-04-21 | 2011-10-12 | 中国科学院微生物研究所 | Pathogenic related protein VdGRP1 from verticillium dahliae kleb and coded gene thereof |
| CN102212121B (en) * | 2010-04-21 | 2013-01-16 | 中国科学院微生物研究所 | Pathogenic related protein VdGRP1 from verticillium dahliae kleb and coded gene thereof |
| WO2012079370A1 (en) * | 2010-12-17 | 2012-06-21 | 中国农业科学院植物保护研究所 | Verticillium dahliae protein elicitor gene, protein sequence and use thereof |
| CN102558320A (en) * | 2010-12-17 | 2012-07-11 | 中国农业科学院植物保护研究所 | Protein polynucleotide with separated verticillium dahliae and application thereof |
| CN102558320B (en) * | 2010-12-17 | 2014-03-26 | 中国农业科学院植物保护研究所 | Protein polynucleotide with separated verticillium dahliae and application thereof |
| CN103193874A (en) * | 2012-01-10 | 2013-07-10 | 中国科学院微生物研究所 | Secretory elicitor protein from Verticillium dahliae and coding gene and application thereof |
| US20180235229A1 (en) * | 2015-10-22 | 2018-08-23 | Pherobio Technology Co., Ltd | Applications of protein vdal in improving output, product quality and drought resistance of plant and in improving fruit coloring of plant |
| US10806145B2 (en) * | 2015-10-22 | 2020-10-20 | Pherobio Technology Co., Ltd | Applications of protein VdAL in improving output, product quality and drought resistance of plant and in improving fruit coloring of plant |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1266163C (en) | 2006-07-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1181202C (en) | Bacillus thuringiensis cryl gene, gene combination and expression vector | |
| CN1793172A (en) | Non-inducing expressing gene engineering strain and structural process and application thereof | |
| CN1854154A (en) | Rice blast resistant related protein, its coding gene and use | |
| CN1202254C (en) | Paddy rice anti bacterial leaf-blight gene Xa26(t) | |
| CN1246464C (en) | Novel transcriptional factor enhancing resistance of plants to osmotic stress | |
| CN1266163C (en) | Cotton verticillium wilt germ secreted exciton gene and its application | |
| CN1289523C (en) | Paddy rice potassium, sodium ion transport gene and its application | |
| CN1289664C (en) | EPSP synthase of variable halomonas high resistance glyphosate and its encoding sequence | |
| CN1566146A (en) | Paddy rice stalk extension gene, coded protein and application thereof | |
| CN1232530C (en) | Ethane cyclic amp receptor protein of wheat and its coding sequence | |
| CN1557952A (en) | Solanum lycopersicoides dun. S1Ve1 receptor protein encoding sequence and use thereof | |
| CN1295334C (en) | Wheat antidisense related gene TaEDR1 and its application | |
| CN1191354C (en) | Method for producing transgene paddy with amount of spikelet being increased | |
| CN1257271C (en) | Serine proteinase and coded sequence thereof | |
| CN1276085C (en) | Coding sequence and application of konjaku agglutinic protein | |
| CN1778813A (en) | Plant epidermic hair control gene | |
| CN1259417C (en) | Coding sequence of arisaema agglutinant protein and its application | |
| CN1266272C (en) | Cotton laccase transgenic plant and its application | |
| CN1464055A (en) | A novel penicillin G acylase and use thereof | |
| CN1623999A (en) | Salt Du's algal nitrate transfer protein and its code sequence | |
| CN1219060C (en) | Cabbage rape BnBDC1 protein coding sequence | |
| CN100341891C (en) | Tanscription activating factor genes of candida albicans and their use | |
| CN1712531A (en) | High-molecular glutelin By8 gene of flint wheat and use thereof | |
| CN1594570A (en) | Protein coded sequence of protein kinase 1 activated by Brassica napus L. cell mitogen | |
| CN1590405A (en) | White candidas transcription factor gene and its use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20060726 Termination date: 20161022 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |