CN102212121B

CN102212121B - Pathogenic related protein VdGRP1 from verticillium dahliae kleb and coded gene thereof

Info

Publication number: CN102212121B
Application number: CN 201110090424
Authority: CN
Inventors: 郭惠珊; 周邦军
Original assignee: Institute of Microbiology of CAS
Current assignee: Beijing Zhongke Keshi Silk Biotechnology Co.,Ltd.
Priority date: 2010-04-21
Filing date: 2011-04-11
Publication date: 2013-01-16
Anticipated expiration: 2031-04-11
Also published as: CN102212121A

Abstract

The invention discloses a pathogenic related protein VdGRP1 from verticillium dahliae kleb and a coded gene thereof. The pathogenic related protein is the protein of 1) or 2): 1) the protein consisting of the amino acid sequence shown as sequence 2 in a sequence table; and 2) the protein formed by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid residue sequence shown as sequence 2 in the sequence table, related to pathogenic fungi and derived from 1). A mutant strain vdgrpl of which the pathogenicity is weakened is obtained by screening a verticillium dahliae kleb mutant library mediated by agrobacterium tumefaciens and built through T-DNA insertion technology by the inventor. Southern hybridization proves that the mutant strain is a T-DNA single-insertion mutant. A gene causing mutant phenotype is obtained through TAIL-PCR technology by the inventor. Gene complementation tests prove that the mutation of the gene VdGRP1 weakens the pathogenicity of the strain vdgrpl which means that the gene VdGRP1 is a fungi pathogenic related gene.

Description

Pathogenic associated protein VdGRP1 and encoding gene thereof from verticillium dahliae

Technical field

The present invention relates to pathogenic associated protein and encoding gene thereof from verticillium dahliae.

Background technology

Be the Major Diseases that threatens Cotton Production by the caused cotton verticillium wilt of soil filamentous fungus verticillium dahliae (Verticilliu dahliae Kleb.), having a strong impact on for many years the quality and yield of Cotton in China always.Cotton verticillium wilt Fei Jiniya state first appeared in the U.S. in 1914 is respectively planted cotton state in other state and the world subsequently and is successively found (Shen Qiyi, 1992), and nineteen thirty-five is imported China into introducing U.S. cotton variety, but harm is heavy.After the fifties, local cotton region occurs verticillium successively in China north and south to twentieth century, and the diffusion rate of propagation is accelerated., at the end of the eighties, verticillium has spreaded all over 478 in the whole nation and has planted cotton county (city).Entered since the nineties, the expansion of Cotton in China verticillium spreads swift and violent, especially continuously large generation in China in 1993,1995,1996,2002 years, and loss is serious.So far, the most of main product of China cotton region has become verticillium grave illness district.

The verticillium pathogenic bacterium are verticillium dahliae (Verticillium dahliae Kleb.), belong to Deuteromycotina, and the clump stalk is embraced order, Moniliaceae, and Verticillium belongs to.The host range of verticillium dahliae is very wide, relates to Cruciferae, the Rosaceae, pulse family, Solanaceae, Labiatae, composite family etc., has reached at present 660 various plants, and is enlarging year by year.Mechanism of causing a disease about cotton verticillium wilt has multiple explanation, wherein take conduit stop up and the two kinds of viewpoints of poisoning as main.The sixties, people were because thalline is grown conduit is decided at the higher level but not officially announced to the understanding of this germ mechanism of causing a disease, and amount reproduction, stimulate simultaneously contiguous parenchyma cell generation gelatinoid and tylosis and obstruction conduit, the running of obstruction moisture, thereby cause cotton plant here wither (Garber, 1966).Ma Yuanli etc. (1990) think after to the distribution situation research of each position verticillium wilt pathogen of cotton in conduit, the potential conveyance power of water of normal secondary xylem vessel is considerably beyond the total water requirements of plant, and blocked conduit number accounts for whole fascicular ratio little (maximum has 17.7%), thus conduit to stop up be not to cause cotton the major cause here of withering.Keen etc. (1972) think, the toxin that verticillium wilt pathogen produces in metabolic process is poisonous protein, is a kind of complex body of acidic protein one lipopolysaccharides.This mixture has destruction to the blade of susceptible cotton variety and the cytolemma of root tissue, makes K+ and a large amount of seepages of Na+ in the cell.And the cytolemma of disease-resistant variety does not possess the acceptor site of detoxifying function and not destroyed by toxin.Wang etc. (2004) are separated to new having from the mycelia of the former bacterium of verticillium have the albumen VdNEP that causes the effect of withering to cotton leaf.This albumen can the evoking tobacco blade forms necrotic plaque, also can make Arabidopis thaliana produce disease resistance response, so mutual react of this albumen may participate in that verticillium wilt pathogen infects cotton the time.But it be not immediately clear that whether this albumen be same substance with the toxin protein that has separated in the past.More and more studies show that now, the toxin of verticillium wilt pathogen secretion is the crucial Some Circulating Factors that causes verticillium, and the occlusive effects Water Transportation of tissue tract may aggravate the generation of illness simultaneously.

Verticillium dahliae is a kind of soil-borne fungus, can produce its dormancy structure Microsclerotia under dry rugged environment, thereby survival for many years in soil.So the formation of Microsclerotia is pathogenic closely bound up with it.2004, DobinsonKF etc. (Dobinson, K.F., et al., 2004) utilized the EZ::TN transposon system transformed, to the carrying out of the trypsinase VTP1 success of the verticillium dahliae that derives from tomato orientation knock out.This gene can promote the formation of Microsclerotia, but does not affect its pathogenic and growth characteristics after knocking out.2005, Dobinson KF etc. knocked out the mitogen activated protein kinase gene VMK1 of the verticillium dahliae that derives from lettuce and tomato.Knock out that bacterial strain illustrates that to various hosts' pathogenic slump of disastrous proportions the signal path of map kinase mediation plays an important role at epiphyte pathogenic behind the VMK1.And the generation that the knocking out of gene reduced spore and the formation of Microsclerotia illustrate that this gene may participate in a plurality of cellular processes.2006 (Klimes, A, et al, 2006) such as Dobinson KF utilize again this system that the type 2 hydrophobin genes VDH1 of the verticillium dahliae that derives from tomato are knocked out.This gene knock out the generation that has reduced Microsclerotia, it is pathogenic but do not affect.On the also not impact of generation of spore, but affected the tolerance of spore to dry environment.The function that the VDH1 gene is described is many-sided, may be relevant with verticillium dahliae long-term existence in soil.Dobinson KF in 2008 etc. have studied again regulation and control and the expression of VDH1 gene in the forming process of Microsclerotia, find VDH1 gene specifically expressing in Microsclerotia, mycelia syzygy and spore, have proved that further this gene is relevant with the formation of Microsclerotia.

Because the seriousness of cotton verticillium wilt harm and host's popularity, the scientific worker of many countries conducts in-depth research it in the world.Plant with the long-term coevolution process of pathogen in obtained the defense mechanism protection oneself of series of complex, resistance shows as composing type resistance and induction type resistance, the induction type resistance comprises again weave construction resistance and Physiology and biochemistry resistance.There is some difference aspect the weave construction to cotton variety that resistance to verticillium wilt is different, much be studies confirm that both at home and abroad.The intercellular substance of disease-resistant variety xylem is less, and cell walls is thicker, and contains more pith ray in the xylem.In addition, the fiber core diameter of the catheter lumen of disease-resistant variety and xylem is less than susceptible variety, illustrates that cotton variety has a solid xylem to the resistance of verticillium and its relevant.The Physiological and biochemical disease resistance aspect of cotton had more research, studied more disease-resistant correlation factor and comprised: plant protecting chemical, tannin, soluble sugar, amino acid and multiple enzyme.Cotton plant innerly produces multiple antibacterial substance after suffering germ invasion and attack, mainly comprise gossypol, plant protecting chemical, tannin etc., in addition also with some enzymes, albumen and small-molecule substance such as H ₂O ₂Their effect is non-specialization, and is relevant with the basic resistance of plant.The mechanism of verticillium wilt resistance of cotton by same is a very complicated problem, the many factors that relates to, therefore deepen continuously and study the rule of these disease resistance response products on gene expression dose, significant for further understanding disease-resistant mechanism in depth and utilizing genetic engineering means to transform the cotton variety resistance.

The acquisition of disease-resistant gene is the important foundation of breeding resistant variety, the plant disease resistance genes of having cloned by molecular biology method at present probably has more than 39, wherein disease-resistant fungal pathogens probably has more than 20, such as Arabidopis thaliana mildew-resistance gene RPW8, tomato anti-blight gene is secreted Ve, the anti-Puccinia sorghi of jowar (Puccinia Sorghi) gene Rpl-D, and on sea island cotton, cloned NBS-LRR class disease-resistant gene.On conventional breeding, the cotton breeding person payes attention to screening and the creation in anti-source always both at home and abroad.The 161 pairs 911 parts upland cotton resources such as Lee 1983-1986 Cheng Bao have been carried out the resisting verticillium evaluation, have screened preferably a collection of anti-(anti-) sick kind of resistance.K.V.Srinvasin has identified the resistance of 126 sea island cotton kinds, and the result shows the anti-disease of performance and disease-resistant accounts for 85%.No matter be to seek anti-source by ordinary method, or cloning disease-resistant gene by molecular biology method all makes some progress, but also do not find the effective way of real control cotton verticillium wilt.Basic reason is the crop genetic background complexity such as cotton, be difficult to carry out more deep research at molecular level, the reasons such as verticillium wilt pathogen (verticillium dahliae, Veriicillium dahliae) the microspecies dissociation opposite sex is strong are in addition also brought numerous difficulties for disease-resistant genetic breeding.Therefore, the mutual molecule mechanism of doing of research cotton verticillium wilt cause of disease verticillium dahliae and host plant is just most important.

Agrobacterium tumefaciens is a kind of Grain-negative edaphic bacillus, it can infect vegetable cell in the injury of plant, with its Ti-plasmids (tumor inducing plamid, tl plasmid) (the transfer DNA of the T-DNA on, transfering DNA) changes vegetable cell and be incorporated into the genome of plant over to, finally cause the generation of canker.Because this mechanism, agrobacterium tumefaciens and Ti-plasmids thereof are used to carry out the conversion of vegetable cell, and use till today always.Bundock etc. adopt Agrobacterium tumefaciens mediated method to carry out the conversion of yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) first; DeGroot etc. also utilize Agrobacterium tumefaciens mediated method successfully to realize the genetic transformation of filamentous fungus.The work of these initiatives is applied to other hosts except plant with AMT, and has opened up a brand-new effectively approach for the genetic transformation of filamentous fungus.Constantly perfect along with method, agrobacterium tumefaciens will obtain using more and more widely in the conversion of filamentous fungus, also for making up fungi T-DNA insertion mutation body storehouse, clone's pathogenic related gene, the molecule mechanism that further investigation cotton verticillium wilt cause of disease verticillium dahliae and host plant do is mutually controlled laying a good foundation of verticillium.

Summary of the invention

The object of the present invention is to provide a kind of pathogenic associated protein and encoding gene thereof from verticillium dahliae.

Pathogenic associated protein provided by the invention, called after VdGRP1 (Glutamic acid-Rich Protein 1) from verticillium dahliae (Verticilliu dahliae Kleb.), is following 1) or 2) protein:

1) protein that is formed by the aminoacid sequence shown in the sequence in the sequence table 2;

2) with the amino acid residue sequence of sequence in the sequence table 2 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and cause a disease relevant by 1 with fungi) protein that derives.

The encoding gene of above-mentioned pathogenic associated protein (called after VdGRP1) also belongs within protection scope of the present invention very much.

The encoding gene of above-mentioned pathogenic associated protein is following 1)-4) in arbitrary described gene:

1) its encoding sequence be in the sequence table sequence 1 from 5 ' terminal 132-407 position;

2) its nucleotide sequence is the sequence 1 in the sequence table;

3) under stringent condition with 1) or 2) gene recombination and the gene of encoding said proteins;

4) with 1) or 2) gene have homology more than 90% and the gene of encoding said proteins.

Above-mentioned stringent condition can be that (or the solution of 0.1 * SSC), 0.1%SDS is hybridized under 65 ℃ and washed film with 0.1 * SSPE in DNA or RNA hybrid experiment.

Sequence 1 is comprised of 526 deoxynucleotides, sequence 1 is the ORF district from 5 ' end 132-407 position Nucleotide in sequence table, the protein of amino acid residue sequence described in the encoding sequence 2, with the albumen called after VdGRP1 shown in the sequence 2, with the encoding gene called after VdGRP1 of VdGRP1 albumen.

The primer pair of above-mentioned VdGRP1 full length gene or its arbitrary fragment of increasing also belongs to protection scope of the present invention.

The recombinant vectors, transgenic cell line or the recombinant bacterium that contain above-mentioned VdGRP1 gene also belong to protection scope of the present invention.

Another object of the present invention is to provide a dna fragmentation, its nucleotide sequence be following a) or b):

A) in the sequence table the 22nd of sequence 3 the to the sequence shown in 240;

B) sequence shown in the sequence 3 in the sequence table.

The recombinant vectors, transgenic cell line or the recombinant bacterium that contain above-mentioned dna fragmentation also belong to protection scope of the present invention; Described recombinant vectors preferably inserts the fragment shown in the sequence in the sequence table 3 recombinant vectors of the multiple clone site formation of pSUlPH-TN carrier; Described pSUlPH-TN carrier is that the fragment shown in the sequence 4 is inserted the carrier that the pSULPH-GFP plasmid consists of in the sequence table.

Another purpose of the present invention is to provide a kind of method of cultivating the fungi of pathogenic reduction.

Method provided by the invention comprises the steps: to reduce the expression of the above-mentioned VdGRP1 gene in the described fungi, obtains the fungi of described pathogenic reduction.

Further, the expression that reduces the above-mentioned VdGRP1 gene in the described fungi is to realize by the fragment shown in the sequence in the sequence table 3 is imported in the described fungi.

Further say, the fragment shown in the sequence 3 can import by the recombinant vectors that contains above-mentioned dna fragmentation in the described fungi in the above-mentioned sequence table.

Above-mentioned fungi is to contain the bacterium of stating the VdGRP1 gene, specifically can be verticillium dahliae; Described pathogenic for causing verticillium.

The verticillium dahliae mutant library that the present inventor sets up by the agriculture bacillus mediated T-DNA insertion technology of screening has obtained the pathogenic mutant strain vdgrp1 that weakens.Southern hybridization confirms that this mutant strain is the single insertion mutation body of T-DNA.The present inventor has obtained mutator gene by the TAIL-PCR technology.By the gene complementation test, confirmation is that the sudden change of this gene has caused pathogenic the weakening of bacterial strain vdgrp1, illustrates that this gene is the fungi pathogenic related gene.

In addition, analyze from phenotype, the growth of gene VdGRP1 and sclerotium has certain relation.Northern hybridization confirmation is in the whole etap of bacterial strain from the spore to the mycelia, and gene VdGRP1 has higher expression, prolongs into the gesture that increases progressively along with incubation time.Gene VdGRP1 is in low expression level state in the sclerotium phase.In liquid culture bacterium liquid, add cotton extracting solution, the expression that can improve gene VdGRP1.Show when verticillium dahliae infects cotton, this gene may be induced by cotton, and may play a role in pathogenic course.In addition, the expression of gene VdGRP1 also is subject to environment-stress and coerces inducing such as high density NaCl, high density N.F,USP MANNITOL as lacking sugared and high oozing.Illustrate that gene VdGRP1 has certain function in the process that the verticillium dahliae response environment is coerced.

In order further to verify the function of gene VdGRP1 by gene silent technology, the present inventor has made up again the RNAi knockout carrier of gene VdGRP1.By agriculture bacillus mediated conversion, the present inventor has obtained three strain transgenosis bacterial strains.Northern is hybridized confirmation, the down-regulated expression of VdGRP1 in three RNAi knock-out bacterial strains.Pathogenic qualification result shows, compares pathogenic weakening with wild-type.Explanation can obtain the pathogenic mutant that weakens of verticillium dahliae by gene silent technology.Simultaneously also further illustrating this gene is the fungi pathogenic related gene.

Description of drawings

The relatively diagram of Fig. 1, mutant strain vdgrp1 and wild type strain V592 growth traits.

The pathogenic relatively diagram of Fig. 2, mutant strain vdgrp1 and wild type strain V592.

The southern hybridization diagram of Fig. 3, mutant strain vdgrp1.

Fig. 4, different growth period, the northern hybridization check of VdGRP1 gene expression dose.

Fig. 5, different environment-stress and height ooze coerces down the northern hybridization check of VdGRP1 gene expression dose.

Under Fig. 6, sclerotium phase and the cotton juice inductive condition, the northern hybridization check of VdGRP1 gene expression dose.

The northern hybridization check of VdGRP1 gene expression dose in Fig. 7, mycelia and the spore.

Fig. 8, mutant strain vdgrp1 illustrate through the pathogenic evaluation of the complementary bacterial strain vdgrp1/VdGRP1 that complementary assay obtains.

Among Fig. 1, Fig. 2 and Fig. 8 592 makes up the used wild type strain of mutant library, vdgrp1 is the pathogenic mutant strain that weakens that screens from mutant library, vdgrp1/VdGRP1 be the ORF sequence construct of VdGRP1 gene under the promotor of constitutive expression, change mutant vdgrp1 over to, by the complementary bacterial strain of colony growth proterties and the pathogenic evaluation of recovery, Control is contrast.

The northern hybridization check of VdGRP1 gene expression dose diagram in Fig. 9, wild type strain V592 and the VdGRP1 RNAi knock-out bacterial strain.

The pathogenic evaluation diagram of Figure 10, wild type strain V592 and VdGRP1 RNAi knock-out bacterial strain.

Embodiment

The invention will be further described below in conjunction with specific embodiment, but the present invention is not limited to following examples.

Among the following embodiment, if no special instructions, be ordinary method.

The structure of embodiment 1, verticillium dahliae mutant library

(bacterial strain V592 picks up from the cotton in Xinjiang field to verticillium dahliae bacterial strain V592, the document of putting down in writing this material is the rapid detection of verticillium wilt pathogen Pathogenic Types in the cotton plants. Xinjiang Agricultural Sciences 2010,47 (4): 827-831, the public can obtain from Institute of Micro-biology of the Chinese Academy of Sciences) after 25 ℃ of cultivations on the PDA flat board with spore inoculating in Cha Shi liquid nutrient medium (2g NaNO3,1g KH ₂PO4,1g MgSO ₄.7H ₂O, 1g KCL, 2mg FeSO ₄.7H ₂In O and the 30g sucrose/L) shaking culture 5-8 days until spore concentration is 1.0 * 10 ⁷/ mL, the spore nutrient solution filters to remove mycelia with 4 layers of sterile gauze.The centrifugal 10min of 4000rpm obtains spore and adds AS (second phthalein syringone) 200mM with inducing culture spore concentration is adjusted to 1.0 * 10 ^6-7/ mL.

(this Agrobacterium contains the PLL16 plasmid with Agrobacterium, the PLL16 plasmid is presented by professor Xu Jinrong of Purdue Univ-West Lafayette USA, now be stored in inventor laboratory, need to authorize acquisition by professor Xu Jinrong of Purdue Univ-West Lafayette USA) (contain Kan 50mg/L at 30ml minimum medium (MM), Rif 25mg/L) cultivates 48h for 28 ℃ in, 4000rpm, centrifugal 10min, precipitation is washed twice with inducing culture (IM), resuspended Agrobacterium to OD value is 0.2-0.3 and adds 200mM AS (second phthalein syringone), 40mM MES and Kan (50mg/L), 28 ℃, 200rpm shaking culture 6h.Then draw the above-mentioned culture of 100 μ L and mix with the conidial suspension of 100 μ l, sprinkle in being placed on the cellulose membrane of 47mm diameter that aperture on the common substratum is 45 μ m, cultivate 36h at 28 ℃.Wash film with the 2mL minimum medium, results fungus and bacterium culture, then getting 200 liang is applied on the selection culture medium flat plate that contains 100 μ g/mL chlorimuronethyls (Cholorimuron), suppress the growth of Agrobacterium, the single transformant of picking goes to selects culture medium flat plate to carry out postsearch screening and preserve transformant.

The acquisition of embodiment 2, mutant vdgrp1

Infect the water planting cotton by bacterial strain and identify the pathogenic of mutant, thereby filter out the mutant of pathogenic change.Select full cotton seed (new land early-16, be purchased from agricultural college of Shihezi of Xinjiang university), behind 15% clorox immersion 30min, aseptic water washing 2-3 time, be tiled in after spending the night with the sterilized water Steeping and budding again and cultivate moisturizing in the box, treat that bud grows to 3cm, plant in the germination box.Beat the hole of cut-off footpath 2cm, spacing 3cm at cystose, twine the radical bud intersection of germination cotton seed with sponge strip, fill in the hole of cystose.Cystose is placed on the plastics casing (high 8-10cm) that fills with clear water, in 25 ℃, illumination 16h, the dark lower 8h that cultivates.Treat when true leaf grows clear water to be changed into 1/3 MS nutrient solution, change weekly nutrient solution one time, inoculation when 1 true leaf flattens.The bacterial strain of-80 ℃ of preservations is activated 3-4d through the PDA flat board, put into the Cha Shi nutrient solution from colony edge picking bacterium piece, 25 ℃, 220rpm shakes training 5d, filter, and the centrifugal 5min of filtrate 5000g,, clear water dilution spore, blood counting chamber is counted, and concentration is transferred to 1 * 10 ⁷Individual spore/ml.The spore suspension that mixes up concentration is added in the empty plastics casing, and cotton seedling is inoculated after soaking root 40min.Use afterwards 25 ℃ of illumination 16h of MS nutrient solution of 1/3, the dark lower cotton seedling 8h that continues to cultivate.Plant 12 young plants in every box, 3 repetitions of each kind contrast cotton seedling and soak 40min with clear water.

By aforesaid method, the present inventor has obtained generation and the pathogenic mutant strain vdgrp1 that all weakens (Fig. 1, Fig. 2) of sclerotium.

The acquisition of embodiment 3, mutator gene

1), Southern hybridization determines that mutant T-DNA inserts copy number (Fig. 3)

The extracting method of A, genomic dna is as follows: in liquid Cha Shi substratum, and 200rpm shaking culture mycelia.Use liquid nitrogen grinding behind the centrifugal 10min of liquid 10000rpm that concussion is cultivated.Extraction buffer (the 100mmol/LTris-HCl that adds 500 μ L, PH8.0,100mmol/L EDTA, 250mmol/L NaCl), eddy current makes the bacterium powder fully mix with Extraction buffer, then adds 50 μ L 20%SDS, jog Eppendorf pipe, mixture is mixed, place 37 ℃ of water-bath 1h, take out and adding 75L 5mol/L NaCl, gently mixing, add again 65 μ L 10%CTAB and 0.75mol/LNaCl solution, then mixing puts into 65 ℃ of water incubation 20min gently, adds 700 μ L chloroform/primary isoamyl alcohol (24: 1) solution after taking out, mixing, the centrifugal 12min of 12000rpm gets supernatant liquor, adds the freezing dehydrated alcohol of 2 times of volumes, put at least 30min of-20 ℃ of refrigerators behind the mixing, at the centrifugal 2min of 10000rpm, abandon supernatant, with the 70% alcohol desalinization of soil by flooding or leaching 2 times after taking out, after the drying, add 40 μ L TE dissolving.

The DNA of B, extraction cuts with EcoR I and KpnI enzyme respectively

Enzyme is cut system:

Whether get 5ul electrophoresis detection enzyme cuts complete

Add 3vol dehydrated alcohol precipitation enzyme and cut product, be melted at last approximately among the 40 μ lddH2O, add Loading Buffer; The front 65 ℃ of 5～10min of point sample.

C, electrophoresis

0.9%Agar (0.5 * TBE); 50V, 18～24hr; The last 5min that oppositely runs.

D, Gel Treatment

(1) electrophoresis complete after, take a picture; DdH2O washes gel

(2) 0.2M HCL soaks gel, and places decolorization swinging table to shake gently (attention is too fast, and is cracked with anti-gel); About 20min is until tetrabromophenol sulfonphthalein flavescence (concentrated hydrochloric acid is 10MOL/L, namely dilutes 50 times, and 10ml is to 500ml)

(3) deionization washing is 2 times, adds sex change liquid shaking, and about 40min is until tetrabromophenol sulfonphthalein is blue by xanthochromia

Nacl 1.5M(87.75g/L)

NaOH 0.5M(20g/L)

(4) the deionization washing is 2 times, adds neutralizer shaking, approximately 30min

Nacl 1.5M(87.75g/L)

Tris.cl 0.5M(60.57g/L)

Dense HCL is 23～25ml approximately, transfers PH7.2

E, transferring film

(a) with long and wide all greater than the plate glue of gel as platform, be placed in the vinyl disc, pour 20 * SSC into, cut one with platform wide, length is soaked filter paper one end in vinyl disc first greater than the filter paper of platform, slowly is placed on the platform, until the other end also soaks in 20 * SSC, drive the bubble of filter paper peace interstation out of.

(b) cut a long and wide nylon membrane that all is slightly larger than gel, cut off the upper left corner, soak fully in sterilized water, take out film, immerse again among 20 * SSC at least 5 minutes.

(c) after electrophoresis finishes, cut away the nonuseable part of gel, and cut one jiao in the upper left corner, with as azimuth mark.Gel is placed among 20 * SSC rinsing a moment.

(d) gel is placed upside down in the central authorities of filter paper on the platform, drives the bubble between glue and filter paper out of, around gel, do not run into the sample on the gel with Parafilm.

(e) soak gel with 20 * SSC, moistening nylon membrane is placed on above the gel, the two corner cut is overlapped, drive the bubble between nylon membrane and gel out of.

(f) soak 5 filter paper onesize with nylon membrane with 20 * SSC, be placed on above the nylon membrane, drive the bubble between filter paper and nylon membrane out of.

(g) cut a folded 10cm thick, be slightly less than the paper handkerchief of filter paper, be placed on above the filter paper, put a sheet glass on the paper handkerchief, compress the weight of 500g, transfer is spent the night.

(h) throw off paper handkerchief, filter paper and the Parafilm of gel top, upset gel and nylon membrane, with the gel one side in being placed on a vinyl disc, with the position of pencil mark gel well on nylon membrane.

(i) peel off gel from nylon membrane and abandon it, nylon membrane is immersed in 5min among 20 * SSC, take out nylon membrane, be placed on the moistening filter paper UV-crosslinked fixedly RNA.

(j) use methylene blue staining, until see clearly RNA band, the distilled water flushing decolouring is wrapped with preservative film, is placed on 4 ℃ of preservations stand-by.

F, label probe

(Amersham company random primer labelling test kit, RediprimeTMII Random Primer LabellingSystem).

(a) get DNA 25ng to be marked, add sterilized water, make volume be expanded to 45 μ l.

(b) 98 ℃, be incubated 5 minutes, denatured DNA.

(c) centrifugal, DNA is gathered at the bottom of the centrifuge tube pipe, be placed on ice.

(d) DNA with sex change is added in the mark mixture, and mixing gently is until pellet melts (can not blow and beat with rifle) fully.

(e) add 1 μ l Klenow (preventing the Klenow inactivation in the mark mixture), centrifugal.

(f) add 5 μ l α-32P-dCTP, blow and beat gently evenly with rifle, centrifugal.

(g) 37 ℃, reacted 30 minutes; 98 ℃, 5 minutes, sex change is the good dna probe of mark, and was centrifugal, is placed on ice.

(h) get an amount of probe and be used for hybridization, remaining probe is kept in 4 ℃ of refrigerators.

G, hybridization

Southern Blot Buffer

Be that final concentration is respectively:

5×Denhart’s

5×SSPE

0.5％SDS

(a) prehybridization: hybridization buffer is poured in the hybrid pipe, and 65 ℃ of preheating 15min put into crosslinked fixing film, 65 ℃ of pre-assorted 1～2hr.

(b) hybridization: add the good probe of 20 μ l marks in hybrid pipe, 65 ℃ of hybridization are spent the night.

(c) wash film: with washing film damping fluid 2 * SSC/2%SDS, under 65 ℃/20min condition, wash film twice; With 0.2 * SSC/0.2%SDS, under 65 ℃/20min condition, wash film once.

(d) compressing tablet: will wash,

Film is taken out from hybrid pipe, is transferred in the two-layer plastic film, detects hybridization signal strong and weak, and film is put into dark folder, the X-mating plate is pressed in the dark folder-80 ℃ of compressing tablets in the darkroom.

(e) punching: in the darkroom X-mating plate is taken out respectively photographic fixing in development and the stop bath in developing solution.

The result as shown in Figure 3.Among Fig. 3, right-hand demonstration be PLL16 carrier sketch, the probe of hybridization is the EGFP sequence.The result shows from figure, all can only hybridize to a band with hybridization probe EGFP after cutting DNA with EcoR I and Kpn I enzyme respectively, illustrate that PLL16 singly copies.

2), TAIL-PCR and RACE technology obtain the mutator gene sequence

The present inventor utilizes hot asymmetric interlaced PCR (TAIL-PCR) to obtain the insertion point flanking sequence.According to the known array of carrier about design respectively 3 nested Auele Specific Primer LB1, LB2, LB3 and RB1 that do not wait with its frontier distance, RB2, RB3, the length of Auele Specific Primer is 20bp approximately, Tm is generally 58～68 ℃:

LB1 gggttcctatagggtttcgctcatg

LB2 catgtgttgagcatataagaaaccct

LB3 gaattaattcggcgttaattcagt

RB1 ggcactggccgtcgttttacaac

RB2 aacgtcgtgactgggaaaaccct

RB3 cccttcccaacagttgcacag

Conserved amino acid sequence according to the ubiquitous protein of species designs a series of degenerated primer AD again, and degenerated primer is relatively short, and length is 14bp, and Tm is 30～48 ℃:

AD1 (AGCT)TCGA(GC)T(AT)T(GC)G(AT)GTT

AD2 (AGCT)GTCGA(GC)(AT)GA(AGCT)A(AT)GAA

AD3 (AT)GTG(AGCT)AG(AT)A(AGCT)CA(AGCT)AGA

AD4 TG(AT)G(AGCT)AG(AT)A(AGCT)CA(GC)AGA

AD5 AG(AT)G(AGCT)AG(AT)A(AGCT)CA(AT)CA(AT)AGG

AD6 CA(AT)CGIC(AGCT)GAIA(G/C)GAA

AD7 TC(GC)TICG(AGCT)ACIT(AT)GGA

AD8 (GC)TTG(AGCT)TA(GC)T(AGCT)CT(AGCT)TGC

AD9 (AT)CAG(AGCT)TG(AT)T(AGCT)GT(AGCT)CTG

AD 10TCTTICG(AGCT)ACIT(AGCT)GGA

AD 11TTGIAG(AGCT)ACIA(AGCT)AGG

PCR reaction by three-wheel obtains flanking sequence, and second and third template of taking turns is respectively first and second PCR product of taking turns.Response procedures is as follows:

*, * *, * * *, and * * * * represents respectively * 5, * 10, * 15, * 30 circulations.

Behind the flanking sequence that obtains the insertion point two ends, the possible encoding loci of analytical sequence and promotor site (network address http://www.cbs.dtu.dk/services/Promoter/ and http://genes.mit.edu/cgi-bin/genscan), designed two pairs of chimeric primers:

30ut-P1：GCCCCGACTCTCACCACCCA

3Inner-P2：AAAGCCCTCACCCGCCAACC

50ut-P1：CCAGAGCATCGACCGTCTCGT

5Inner-P2：TCCTCTTCCTCGTCGTCCTCC

Use the FirstChoice RLM-RACE test kit of Ambion company, according to the described step of test kit specification sheets, be 3 ' RACE and 5 ' RACE and obtain gene VdGRP1 cDNA.The VdGRP1 cDNA that obtains is shown in sequence in the sequence table 1.Sequence 1 is comprised of 526 deoxynucleotides, sequence 1 is the ORF district from 5 ' end 132-407 position Nucleotide in sequence table, the protein of amino acid residue sequence described in the encoding sequence 2, with the albumen called after VdGRP1 shown in the sequence 2, with the encoding gene called after VdGRP1 of VdGRP1 albumen.

The complementation checking of embodiment 3, mutant

Primer 1:g TCTAGAATGCCGCCCAAAAAGCC (upstream primer, the line part is Xba I)

Primer 2: c GGATCCTTAATCACTGTCATTGCCATC (downstream primer, the line part is BamH I)

(bacterial strain V592 picks up from the cotton in Xinjiang field to extract verticillium dahliae wild type strain V592, now be stored in inventor laboratory, can buy by signing the material transport contract with contriver place institute) RNA, concrete steps are extracted tela contexta RNA according to implementation column 4Trizol reagent method.Carry out the ORF district of RT-PCR amplification VdGRP1 cDNA with above-mentioned primer 1 and primer 2.Cloning and sequencing proves, the nucleotide sequence of amplified production is shown in the 132-407 position Nucleotide of sequence in the sequence table 1.Sequence 1 is comprised of 526 deoxynucleotides, sequence 1 is the ORF district from 5 ' end 132-407 position Nucleotide in sequence table, the protein of amino acid residue sequence described in the encoding sequence 2, with the albumen called after VdGRP1 shown in the sequence 2, with the encoding gene called after VdGRP1 of VdGRP1 albumen.

Utilize XbaI and BamHI restriction enzyme site that the fragment shown in the sequence in the sequence table 1 is cloned promotor downstream into fungus expression vector pSUlPH-TN-1, obtain recombinant expression vector pSUlPH-TN-VdGRP1.Empirical tests, recombinant expression vector makes up correct.

Wherein the construction process of carrier pSUlPH-TN-1 is as follows: with carrier pSULPH-GFP (researcher of He Chao family of Institute of Microorganism, Academia Sinica) with Pst I and Nco I excision GFP sequence, and between Pst I and Nco I, connect into restriction enzyme site XbaI, Sma I, BamHI make up and form.

Recycle agriculture bacillus mediated conversion and turn into mutant strain vdgrp1, obtain complementary bacterial strain vdgrp1/VdGRP1.Carry out pathogenic evaluation according to the method that embodiment 2 introduces, mutator gene has obtained complementation, and mutant strain vdgrp1 has recovered certain pathogenic (Fig. 8).

The functional study of embodiment 4, gene VdGRP1

Verticillium dahliae bacterial strain V592 is cultivated at the PDA flat board, dig down the bacterium piece from the PDA flat board that covers with spore and sclerotium and insert the Cha Shi substratum, 28 ℃, 200rpm cultivates.Respectively at second day, drew materials in the 3rd day, the 4th day, extract RNA, carry out northern hybridization.Probe is gene VdGRP1 cDNA sequence (sequence 1 holds shown in the 1-526 position from 5 ' in the sequence table).Northern hybridization confirmation is in the whole etap of bacterial strain from the spore to the mycelia, and gene VdGRP1 has higher expression, and prolongs into the gesture (Fig. 4) that increases progressively along with incubation time.Dig down the bacterium piece from the PDA flat board that covers with spore and sclerotium and insert the Cha Shi substratum, 28 ℃, 200rpm cultivates.Drew materials in the 4th day, and leached spore with four layers of gauze, extract respectively the RNA of mycelia and spore, carry out northern hybridization.Northern hybridization confirms that gene VdGRP1 all has expression (Fig. 7) in spore and mycelia.

Dig down the bacterium piece from the PDA flat board that covers with spore and sclerotium and insert the Cha Shi substratum, 28 ℃, 200rpm cultivates.In the time of the 4th day, fungus culture medium is divided into two bottles of equivalent, one bottle in contrast.New land early-16 cotton plants grind to form juice, add in another bottle nutrient solution, continue to cultivate, draw materials respectively at the 4th hour, the 8th hour that certainly adds after the cotton plants juice, extract RNA and carry out cross experiment.Wash spore with sterilized water from the bacterium colony on the flat board, be applied on the PDA substratum that is covered with nitrocellulose filter, be cultured to the generation Microsclerotia.Scrape Microsclerotia, extract RNA and carry out cross experiment.Gene VdGRP1 is in low expression level state in the sclerotium phase.Induced by cotton juice, expression level increase (Fig. 6).

Dig down the bacterium piece from the PDA flat board that covers with spore and sclerotium and insert the Cha Shi substratum, 28 ℃, 200rpm cultivates.In the time of the 3rd day, fungi is carried out respectively nitrogen stress, scarce sugar, high salt concentration, high density N.F,USP MANNITOL and uviolizing process.Nitrogen stress, the implementation step that lacks sugar are: centrifugal 1 minute of fungus culture medium 1200rpm, collect mycothallus, join respectively nitrogen stress and lack in the Cha Shi substratum of sugar.The implementation step of high salt concentration, high density N.F,USP MANNITOL is: add respectively 0.5M NaCl, 0.6M N.F,USP MANNITOL in the 3rd day fungal cultures.The implementation step that uviolizing is processed is: the 3rd day fungus culture medium is poured in the glass dish, placed irradiation cultivation under the ultraviolet lamp.The culture of above-mentioned processing continues to cultivate after 8 hours draws materials, and extracts RNA and carries out northern hybridization.Hybridization confirms that the expression of gene VdGRP1 also is subject to environment-stress as lacking sugar and high induce (Fig. 5) that coerces such as high density NaCl, high density N.F,USP MANNITOL that ooze.Illustrate that gene VdGRP1 has certain function in the process that the verticillium dahliae response environment is coerced.

The implementation step of above-mentioned northern hybridization is as follows:

A, Trizol reagent method are extracted tela contexta RNA

(1) fungal material is used the liquid nitrogen grinding powdered in mortar, per 50～100mg tissue adds 1mlRNAVzol, and homogenate is to fully cracking in centrifuge tube; Room temperature is placed 5min.

(2) add the chloroform (1ml RNAVzol adds the 0.2ml chloroform) of 0.2 times of volume in the centrifuge tube of lysate is housed, with fully vibrate mixing 30 seconds of vibrator, room temperature is placed 2～3min.

(3) 4 ℃, 14000rpm, centrifugal 10min draws in the new centrifuge tube of upper strata water to, and every milliliter of RNAVzol can draw approximately 0.5～0.55ml.

(4) add the 0.5ml Virahol by every milliliter of initial RNAVzol, put upside down for several times mixing, precipitation at room temperature 10min.

(5) 4 ℃, Isosorbide-5-Nitrae 000rpm, centrifugal 10min, the visible RNA precipitation at the pipe end.Abandon supernatant, every milliliter of initial RNAVzol adds 1ml 75% ethanol, puts upside down gently mixing, to clean the RNA precipitation.Discard liquid, carefully do not abandon the RNA precipitation.Room temperature is inverted and is dried (5～10min).

(6) add an amount of 50% deionized formamide dissolving RNA precipitation, deposit in-80 ℃ for subsequent use.

B、mRNA northern blotting

(1) required reagent

(175.3g NaCI, 88.2g trisodium citrate are regulated pH to 7.0 with HCl to 20 * SSC, are settled to 1L, autoclaving.), (20ml 0.5M EDTA regulates pH to 7.0 with NaOH to 10 * MOPS, is settled to 1L, is contained in the brown bottle autoclaving or filtration sterilization for 41.8g MOPS, 6.56g NaAc.Present faint yellow available, yellow unavailable behind the autoclaving.), 37% formaldehyde (Formaldehyde), deionized formamide (Formamidedeionized), methylene blue staining liquid (0.03% methylene blue, 0.3M NaAc, pH5.2).

(2) RNA electrophoresis

The preparation of 1.2% agarose denaturing formaldehyde glue:

Total：200ml	Aequum	Final concentration
			Agarose	2.4g	1.2％
10×MOPS	20ml	1×
			37％ Formaldehyde	5.41ml	1％

The preparation of RNA sample (being dissolved in 50% deionized formamide loading 5-10ug):

Sample buffer mix：	25.5μl
		10×MOPS	5μl
37％ Formaldehyde	8μl
		Formamide deionized	12.5μl

With Sample buffer mix and RNA sample equal-volume mixing, 65 ℃, sex change 5min places 5min on ice, adds sample loading buffer, mixing, loading.

The RNA electrophoresis:

Electrophoretic buffer: 1 * MOPS

Voltage=120V, about 3 hr

(3) transferring film (up capillary transfer method)

(4) label probe

(a) get DNA to be marked (sequence 1 holds the VdGRP1 cDNA sequence shown in the 1-526 position from 5 ' in the sequence table) 25ng, add sterilized water, make volume be expanded to 45 μ l.

(b) 98 ℃, be incubated 5 minutes, denatured DNA.

(5) hybridization

Hybridization buffer: 20.4ml	Volume required	Final concentration
			1M NaHPO4(pH7.2)	8.6ml	43mM
20％ SDS	7ml	7％
			5％ BSA	4ml	1％
0.5 M EDTA	0.8ml	20mM

(d) compressing tablet: washed film is taken out from hybrid pipe, be transferred in the two-layer plastic film, detect hybridization signal strong and weak, film is put into dark folder, in the darkroom, the X-mating plate is pressed in the dark folder-80 ℃ of compressing tablets.

The acquisition of embodiment 5, VdGRP1 RNAi knock-out bacterial strain

According to the cDNA sequence of gene VdGRP1, design two pairs of primers.

VdGRP1i1-s:c AAGCTTAAAGCCCTCACCCGCCAACC (the line part is Hind III)

VdGRP1i1-a:c AGATCTCAGCCCTGTCCTCGTCTCCT (the line part is Bgl II)

VdGRP1i2-s:c GGATCCAAAGCCCTCACCCGCCAACC (the line part is BamH I)

VdGRP1i2-a:g CTGCAGCAGCCCTGTCCTCGTCTCCT (the line part is Pst I)

Sequence shown in the sequence 1 is as template in the sequence table, VdGRP1i1-s and the VdGRP1i1-a forward sequence that is used for increasing, and VdGRP1i2-s and VdGRP1i2-a are used for the reverse complementary sequence that increases.Forward sequence (the 22nd of sequence 3 to shown in 240) and reverse complementary sequence are cloned behind the T carrier, select correct clone, respectively with cutting with HindIII and Bgl II and BamH I and Pst I enzyme, fragment after the recovery is cloned into PSK-int, and (document of record PSK-int carrier is Hui-Shan Guo, Jifeng Fei, Qi Xie and Nam-Hai Chua.2003 Achemical-regulated inducible RNAi system in plants.The Plant Journal, 34,383-392, the public can obtain from Institute of Micro-biology of the Chinese Academy of Sciences), obtain PSK-int-RNAi.PSK-int-RNAi cuts with SalI and Spe I enzyme, the fragment (nucleotide sequence is shown in sequence in the sequence 3) that obtains is cloned into pSUlPH-TN-2 (after pSULPH-GFP cuts with XbaI and HindIII enzyme, be connected into the TN sequence with XbaI and HindIII end shown in the sequence 4 in the sequence table, be built into the pSUlPH-TN-2 carrier; The document of record pSULPH-GFP carrier is Zhuangzhi Zhou, Guihua Li, Chunhua Lin and Chaozu He (2009) ConidiophoreStalk-less1 Encodes a Putative Zinc-Finger Protein Involved in the Early Stage ofConidiation and Mycelial Infection in Magnaporthe oryzae.Molecular Plant-MicrobeInteractions 22:402-410, the public can obtain from Institute of Micro-biology of the Chinese Academy of Sciences), obtain VdGRP1 RNAi knockout carrier pSULPH-TN-RNAi.Recycling agriculture bacillus mediated conversion turns into wild type strain V592 and is built into the RNAi bacterial strain.The northern that the method for introducing according to embodiment 4 is carried out VdGRP1 gene expression dose in wild type strain V592 and 3 the VdGRP1 RNAi knock-out bacterial strains is hybridized (Fig. 9).The method of introducing according to embodiment 2 is again carried out the pathogenic evaluation (Figure 10, contrast is the cotton of not infecting) of wild type strain V592 and VdGRP1 RNAi knock-out bacterial strain.Pathogenic qualification result shows, compares with wild-type, and the pathogenic of recombinant bacterium weakens.Explanation can obtain the pathogenic mutant that weakens of verticillium dahliae by gene silent technology.Simultaneously also further illustrating this gene is the fungi pathogenic related gene.

Claims

1. albumen, the protein that is formed by the aminoacid sequence shown in the sequence in the sequence table 2.

2. the encoding gene of the described albumen of claim 1.

3. encoding gene according to claim 2, it is characterized in that: the encoding gene of described albumen is following 1) or 2) described gene:

2) its nucleotide sequence is the sequence 1 in the sequence table.

4. the recombinant vectors or the recombinant bacterium that contain claim 2 or 3 described genes.

5. dna fragmentation, its nucleotide sequence be following a) or b):

B) sequence shown in the sequence 3 in the sequence table.

6. the recombinant vectors or the recombinant bacterium that contain the described dna fragmentation of claim 5; Described recombinant vectors is the recombinant vectors that the fragment shown in the sequence in the sequence table 3 is inserted the multiple clone site formation of pSULPH-TN carrier; Described pSULPH-TN carrier is that the fragment shown in the sequence 4 is inserted the carrier that the pSULPH-GFP plasmid consists of in the sequence table.

7. method of cultivating the fungi of pathogenic reduction comprises the claim 2 that reduces in the described fungi or the expression of 3 described genes, obtains the fungi of described pathogenic reduction;

Described fungi is verticillium dahliae, and is described pathogenic for causing verticillium.

8. method according to claim 7 is characterized in that: reducing claim 2 in the described fungi or the expression of 3 described genes is to realize by the fragment shown in the sequence in the sequence table 3 is imported in the described fungi.

9. method according to claim 8, it is characterized in that: the fragment shown in the sequence 3 imports in the described fungi by recombinant vectors claimed in claim 6 in the described sequence table.