CN102212121A

CN102212121A - Pathogenic related protein VdGRP1 from verticillium dahliae kleb and coded gene thereof

Info

Publication number: CN102212121A
Application number: CN2011100904248A
Authority: CN
Inventors: 郭惠珊; 周邦军
Original assignee: Institute of Microbiology of CAS
Current assignee: Beijing Zhongke Keshi Silk Biotechnology Co.,Ltd.
Priority date: 2010-04-21
Filing date: 2011-04-11
Publication date: 2011-10-12
Anticipated expiration: 2031-04-11
Also published as: CN102212121B

Abstract

The invention discloses a pathogenic related protein VdGRP1 from verticillium dahliae kleb and a coded gene thereof. The pathogenic related protein is the protein of 1) or 2): 1) the protein consisting of the amino acid sequence shown as sequence 2 in a sequence table; and 2) the protein formed by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid residue sequence shown as sequence 2 in the sequence table, related to pathogenic fungi and derived from 1). A mutant strain vdgrpl of which the pathogenicity is weakened is obtained by screening a verticillium dahliae kleb mutant library mediated by agrobacterium tumefaciens and built through T-DNA insertion technology by the inventor. Southern hybridization proves that the mutant strain is a T-DNA single-insertion mutant. A gene causing mutant phenotype is obtained through TAIL-PCR technology by the inventor. Gene complementation tests prove that the mutation of the gene VdGRP1 weakens the pathogenicity of the strain vdgrpl which means that the gene VdGRP1 is a fungi pathogenic related gene.

Description

Come pathogenic associated protein VdGRP1 and the encoding gene thereof of arrogant beautiful Verticillium

Technical field

The present invention relates to pathogenic associated protein and the encoding gene thereof of arrogant beautiful Verticillium.

Background technology

By the caused cotton verticillium wilt of the big beautiful Verticillium of soil filamentous fungus (Verticilliu dahliae Kleb.) is the main disease that threatens Cotton Production, is having a strong impact on the quality and yield of Cotton in China for many years always.Cotton verticillium wilt 1914 beginning sees the Fei Jiniya state of the U.S., respectively plants cotton state in other state and the world subsequently and successively finds (Shen Qiyi, 1992), and nineteen thirty-five is imported China into introducing U.S. cotton variety, but harm is heavy.After the fifties, local cotton region takes place verticillium successively in China north and south to twentieth century, and the diffusion rate of propagation is accelerated., at the end of the eighties, verticillium has spreaded all over 478 in the whole nation and has planted cotton county (city).Entered since the nineties, the expansion of Cotton in China verticillium spreads swift and violent, especially big continuously in China generation in 1993,1995,1996,2002 years, and loss is serious.So far, the most of main product of China cotton region has become verticillium grave illness district.

The verticillium pathogenic bacterium are big beautiful Verticillium (Verticillium dahliae Kleb.), belong to Deuteromycotina, and the clump stalk is embraced order, light color spore section, and Verticillium belongs to.The host range of big beautiful Verticillium is very wide, relates to Cruciferae, the Rosaceae, pulse family, Solanaceae, Labiatae, composite family etc., has reached 660 various plants at present, and is enlarging year by year.Mechanism of causing a disease about cotton verticillium wilt has multiple explanation, wherein stops up and the two kinds of viewpoints of poisoning based on conduit.The sixties, people were because thalline is grown in that conduit is decided at the higher level but not officially announced to the understanding of this germ mechanism of causing a disease, and a large amount of breedings, stimulate contiguous parenchyma cell to produce gelatinoid and tylosis simultaneously and stop up conduit, hinder the running of moisture, thereby cause cotton plant here wither (Garber, 1966).Ma Yuanli etc. (1990) think after to the distribution situation research of each position verticillium wilt pathogen of cotton in conduit, the potential conveyance power of water of normal secondary xylem vessel is considerably beyond the total water requirements of plant, and blocked conduit number accounts for whole fascicular ratio little (maximum has 17.7%), thus conduit to stop up be not to cause cotton the major cause here of withering.Keen etc. (1972) think that the toxin that verticillium wilt pathogen produces is deleterious protein in metabolic process, be a kind of complex body of acidic protein one lipopolysaccharides.This mixture has destruction to the blade of susceptible cotton variety and the cytolemma of root tissue, makes K+ and a large amount of seepages of Na+ in the cell.And the cytolemma of disease-resistant variety does not possess the acceptor site of detoxifying function and not destroyed by toxin.Wang etc. (2004) are separated to new having from the mycelia of the former bacterium of verticillium have the albumen VdNEP that causes the effect of withering to cotton leaf.This albumen can the evoking tobacco blade forms necrotic plaque, also can make Arabidopis thaliana produce disease resistance response, so mutual react of this albumen may participate in that verticillium wilt pathogen infects cotton the time.But it be not immediately clear that whether this albumen be same substance with isolating toxin protein in the past.Studies show that more and more that now verticillium wilt pathogen excretory toxin is the crucial biochemical factor that causes verticillium, the occlusive effects moisture of tissue tract transportation simultaneously may aggravate the generation of illness.

Big beautiful Verticillium is a kind of soil-borne fungus, can produce its dormancy structure germ nuclear under dry rugged environment, thereby survival for many years in soil.So the formation of germ nuclear is pathogenic closely bound up with it.2004, DobinsonKF etc. (Dobinson, K.F., et al., 2004) utilized the EZ::TN transposon system transformed, to the carrying out of the trypsinase VTP1 success of the big beautiful Verticillium that derives from tomato orientation knock out.This gene can promote the formation of germ nuclear, but does not influence its pathogenic and growth characteristics after knocking out.2005, Dobinson KF etc. knocked out the mitogen activated protein kinase gene VMK1 of the big beautiful Verticillium that derives from lettuce and tomato.Knock out that bacterial strain illustrates that to various hosts' pathogenic slump of disastrous proportions the signal path of map kinase mediation plays an important role on epiphyte pathogenic behind the VMK1.And the formation of generation that the knocking out of gene reduced spore and germ nuclear illustrates that this gene may participate in a plurality of cell processes.2006 (Klimes, A, et al, 2006) such as Dobinson KF utilize this system that the type 2 hydrophobin genes VDH1 of the big beautiful Verticillium that derives from tomato are knocked out again.The knocking out of this gene reduced the generation of germ nuclear, and it is pathogenic but do not influence.To the also not influence of generation of spore, but influenced the tolerance of spore to dry environment.The function that the VDH1 gene is described is many-sided, may be relevant in the existence of soil midium or long term with big beautiful Verticillium.Dobinson KF in 2008 etc. have studied the regulation and control and the expression of VDH1 gene in the forming process of germ nuclear again, find VDH1 gene specifically expressing in germ nuclear, mycelia syzygy and spore, have proved that further this gene is relevant with the formation of germ nuclear.

Because the seriousness of cotton verticillium wilt harm and host's popularity, the scientific worker of many countries furthers investigate it in the world.Plant with the long-term coevolution process of pathogen in obtained the defense mechanism protection oneself of a series of complexity, resistance shows as composing type resistance and induction type resistance, the induction type resistance comprises weave construction resistance and Physiology and biochemistry resistance again.There is some difference aspect the weave construction to cotton variety that resistance to verticillium wilt is different, much be studies confirm that both at home and abroad.The intercellular substance of disease-resistant variety xylem is less, and cell walls is thicker, and contains more pith ray in the xylem.In addition, the fiber core diameter of the catheter lumen of disease-resistant variety and xylem is less than susceptible variety, and it is relevant to illustrate that cotton variety has a solid xylem to the resistance of verticillium and its.The Physiology and biochemistry disease resistance aspect of cotton had more research, studied more disease-resistant correlation factor and comprised: plant protecting chemical, tannin, soluble sugar, amino acid and multiple enzyme.Cotton plant innerly produces multiple antibacterial substance after suffering germ invasion and attack, mainly comprise gossypol, plant protecting chemical, tannin etc., in addition also with some enzymes, albumen and small-molecule substance such as H ₂O ₂Their effect is non-specialization, and is relevant with the basic resistance of plant.The mechanism of verticillium wilt resistance of cotton by same is a very complicated problems, the factor that relates to is numerous, therefore deepen continuously and study the rule of these disease resistance response products on gene expression dose, significant for further understanding disease-resistant mechanism in depth and utilizing genetic engineering means to transform the cotton variety resistance.

The acquisition of disease-resistant gene is the important foundation of breeding resistant variety, the plant disease resistance genes of having cloned by molecular biology method at present probably has more than 39, wherein disease-resistant fungal pathogens probably has more than 20, as Arabidopis thaliana mildew-resistance gene RPW8, tomato anti-blight gene is secreted Ve, jowar resists common rust (Puccinia Sorghi) gene Rpl-D, and has cloned NBS-LRR class disease-resistant gene on sea island cotton.On conventional breeding, the cotton breeding person payes attention to the screening and the creation in anti-source always both at home and abroad.161 pairs 911 parts upland cotton resources such as Lee 1983-1986 Cheng Bao have been carried out the resisting verticillium evaluation, have screened a collection of preferably anti-(anti-) the sick kind of resistance.K.V.Srinvasin has identified the resistance of 126 sea island cotton kinds, and the result shows the anti-disease of performance and disease-resistant accounts for 85%.No matter be to seek anti-source, still all obtained certain progress, but also do not found the effective way of real control cotton verticillium wilt by molecular biology method clone disease-resistant gene by ordinary method.Basic reason is crop genetic background complexity such as cotton, be difficult in molecular level and carry out more deep research, reasons such as verticillium wilt pathogen (big beautiful Verticillium, Veriicillium dahliae) the microspecies dissociation opposite sex is strong are in addition also brought numerous difficulties for disease-resistant genetic breeding.Therefore, the mutual molecule mechanism of doing of research big beautiful Verticillium of cotton verticillium wilt cause of disease and host plant is just most important.

Agrobacterium tumefaciens is a kind of Grain-negative edaphic bacillus, it can infect vegetable cell in the injury of plant, with its Ti-plasmids (tumor inducing plamid, tl plasmid) (the transfer DNA of the T-DNA on, transfering DNA) changes vegetable cell and be incorporated into the genome of plant over to, finally cause the generation of canker.Because this mechanism, agrobacterium tumefaciens and Ti-plasmids thereof are used to carry out the conversion of vegetable cell, and use till today always.Bundock etc. adopt Agrobacterium tumefaciens mediated method to carry out the conversion of yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) first; DeGroot etc. also utilize Agrobacterium tumefaciens mediated method successfully to realize the genetic transformation of filamentous fungus.The work of these initiatives is applied to other hosts except plant with AMT, and has opened up a brand-new valid approach for the genetic transformation of filamentous fungus.Constantly perfect along with method, agrobacterium tumefaciens will obtain application more and more widely in the conversion of filamentous fungus, also insert mutant library for making up fungi T-DNA, clone's pathogenic related gene, the molecule mechanism that further investigation big beautiful Verticillium of cotton verticillium wilt cause of disease and host plant do is mutually controlled laying a good foundation of verticillium.

Summary of the invention

The object of the present invention is to provide pathogenic associated protein and the encoding gene thereof of a kind of next arrogant beautiful Verticillium.

Pathogenic associated protein provided by the invention, called after VdGRP1 (Glutamic acid-Rich Protein 1) comes arrogant beautiful Verticillium (Verticilliu dahliae Kleb.), is following 1) or 2) protein:

1) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 2;

2) with the amino acid residue sequence of sequence in the sequence table 2 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and cause a disease relevant with fungi by 1) deutero-protein.

The encoding gene of above-mentioned pathogenic associated protein (called after VdGRP1) also belongs within protection scope of the present invention very much.

The encoding gene of above-mentioned pathogenic associated protein is following 1)-4) in arbitrary described gene:

1) its encoding sequence be in the sequence table sequence 1 from 5 ' terminal 132-407 position;

2) its nucleotide sequence is the sequence 1 in the sequence table;

3) under stringent condition with 1) or 2) gene recombination and the gene of encoding said proteins;

4) with 1) or 2) gene have the homology more than 90% and the gene of encoding said proteins.

Above-mentioned stringent condition can be that (or 0.1 * SSC), the solution of 0.1%SDS is hybridized under 65 ℃ and washed film with 0.1 * SSPE in DNA or RNA hybrid experiment.

Sequence 1 is made up of 526 deoxynucleotides, sequence 1 is the ORF district from 5 ' end 132-407 position Nucleotide in sequence table, the protein of amino acid residue sequence described in the encoding sequence 2, with the albumen called after VdGRP1 shown in the sequence 2, with the proteic encoding gene called after of VdGRP1 VdGRP1.

Increase above-mentioned VdGRP1 full length gene or its arbitrary segmental primer to also belonging to protection scope of the present invention.

The recombinant vectors, transgenic cell line or the reorganization bacterium that contain above-mentioned VdGRP1 gene also belong to protection scope of the present invention.

Another object of the present invention is to provide a dna fragmentation, its nucleotide sequence be following a) or b):

A) in the sequence table the 22nd of sequence 3 the to the sequence shown in 240;

B) sequence shown in the sequence 3 in the sequence table.

The recombinant vectors, transgenic cell line or the reorganization bacterium that contain above-mentioned dna fragmentation also belong to protection scope of the present invention; Described recombinant vectors preferably inserts the fragment shown in the sequence in the sequence table 3 recombinant vectors of the multiple clone site formation of pSUlPH-TN carrier; Described pSUlPH-TN carrier is that the fragment shown in the sequence 4 is inserted the carrier that the pSULPH-GFP plasmid constitutes in the sequence table.

Another purpose of the present invention is to provide a kind of method of cultivating the fungi of pathogenic reduction.

Method provided by the invention comprises the steps: to reduce the above-mentioned VdGRP1 expression of gene in the described fungi, obtains the fungi of described pathogenic reduction.

Further, the above-mentioned VdGRP1 expression of gene that reduces in the described fungi is to realize by the fragment shown in the sequence in the sequence table 3 is imported in the described fungi.

Say that further the fragment shown in the sequence 3 can import by the recombinant vectors that contains above-mentioned dna fragmentation in the described fungi in the above-mentioned sequence table.

Above-mentioned fungi is to contain the bacterium of stating the VdGRP1 gene, specifically can be big beautiful Verticillium; Described pathogenic for causing verticillium.

The big beautiful Verticillium mutant library that the present inventor sets up by the agriculture bacillus mediated T-DNA insertion technology of screening has obtained the pathogenic mutant strain vdgrp1 that weakens.Southern hybridization confirms that this mutant strain is the single mutant that inserts of T-DNA.The present inventor has obtained mutator gene by the TAIL-PCR technology.By the gene complementation test, confirmation is that the sudden change of this gene has caused pathogenic the weakening of bacterial strain vdgrp1, illustrates that this gene is the fungi pathogenic related gene.

In addition, analyze from phenotype, the growth of gene VdGRP1 and sclerotium has certain relation.Northern hybridization confirms that gene VdGRP1 has higher expression, prolongs the gesture that becomes to increase progressively along with incubation time in the whole etap of bacterial strain from the spore to the mycelia.Gene VdGRP1 is in low expression level state in the sclerotium phase.In liquid culture bacterium liquid, add cotton extracting solution, the expression that can improve gene VdGRP1.Show that when big beautiful Verticillium was infected cotton, this gene may be induced by cotton, and may play a part certain in pathogenic course.In addition, the expression of gene VdGRP1 also is subjected to environment-stress and coerces inducing as high density NaCl, high density N.F,USP MANNITOL as lacking sugared and high oozing.Illustrate that gene VdGRP1 has certain function in the process that big beautiful Verticillium response environment is coerced.

In order further to verify the function of gene VdGRP1 by gene silent technology, the present inventor has made up the RNAi knockout carrier of gene VdGRP1 again.By agriculture bacillus mediated conversion, the present inventor has obtained three strain transgenosis bacterial strains.Northern is hybridized confirmation, the down-regulated expression of VdGRP1 in three RNAi knock-out bacterial strains.Pathogenic qualification result shows, compares pathogenic weakening with wild-type.Explanation can obtain the pathogenic mutant that weakens of big beautiful Verticillium by gene silent technology.Simultaneously also further illustrating this gene is the fungi pathogenic related gene.

Description of drawings

The relatively diagram of Fig. 1, mutant strain vdgrp1 and wild type strain V592 growth traits.

The pathogenic relatively diagram of Fig. 2, mutant strain vdgrp1 and wild type strain V592.

The southern hybridization diagram of Fig. 3, mutant strain vdgrp1.

Fig. 4, different growth period, the northern hybridization of VdGRP1 gene expression dose detects.

Fig. 5, different environment-stress and height ooze coerces down, and the northern hybridization of VdGRP1 gene expression dose detects.

Under Fig. 6, sclerotium phase and the cotton juice inductive condition, the northern of VdGRP1 gene expression dose is hybridized detection.

The northern of VdGRP1 gene expression dose hybridization detects in Fig. 7, mycelia and the spore.

Fig. 8, mutant strain vdgrp1 illustrate through the pathogenic evaluation of the complementary bacterial strain vdgrp1/VdGRP1 that complementary assay obtains.

Among Fig. 1, Fig. 2 and Fig. 8 592 makes up the used wild type strain of mutant library, vdgrp1 is the pathogenic mutant strain that weakens that screens from mutant library, vdgrp1/VdGRP1 be VdGRP1 gene ORF sequence construct under the promotor of constitutive expression, change mutant vdgrp1 over to, by the complementary bacterial strain of colony growth proterties and the pathogenic evaluation of recovery, Control is contrast.

The northern of VdGRP1 gene expression dose hybridization detects diagram in Fig. 9, wild type strain V592 and the VdGRP1 RNAi knock-out bacterial strain.

The pathogenic evaluation diagram of Figure 10, wild type strain V592 and VdGRP1 RNAi knock-out bacterial strain.

Embodiment

The invention will be further described below in conjunction with specific embodiment, but the present invention is not limited to following examples.

Among the following embodiment, if no special instructions, be ordinary method.

The structure of embodiment 1, big beautiful Verticillium mutant library

(bacterial strain V592 picks up from cotton field, Xinjiang to big beautiful lecanii strain V592, the document of putting down in writing this material is the rapid detection of the pathogenic type of verticillium wilt pathogen in the cotton plants. Xinjiang agricultural sciences 2010,47 (4): 827-831, the public can obtain from Institute of Micro-biology of the Chinese Academy of Sciences) after 25 ℃ of cultivations on the PDA flat board with spore inoculating in Cha Shi liquid nutrient medium (2g NaNO3,1g KH ₂PO4,1g MgSO ₄.7H ₂O, 1g KCL, 2mg FeSO ₄.7H ₂Shaking culture 5-8 days is 1.0 * 10 until spore concentration in O and the 30g sucrose/L) ⁷/ mL, the spore nutrient solution filters to remove mycelia with 4 layers of sterile gauze.The centrifugal 10min of 4000rpm obtains spore and adds AS (second phthalein syringone) 200mM with inducing culture spore concentration is adjusted to 1.0 * 10 ^6-7/ mL.

(this Agrobacterium contains the PLL16 plasmid with Agrobacterium, the PLL16 plasmid is presented by professor Xu Jinrong of Purdue Univ-West Lafayette USA, now be stored in inventor laboratory, need authorize acquisition by professor Xu Jinrong of Purdue Univ-West Lafayette USA) (contain Kan 50mg/L at 30ml minimum medium (MM), Rif 25mg/L) cultivates 48h for 28 ℃ in, 4000rpm, centrifugal 10min, precipitation is washed twice with inducing culture (IM), resuspended Agrobacterium to OD value is 0.2-0.3 and adds 200mM AS (second phthalein syringone), 40mM MES and Kan (50mg/L), 28 ℃, 200rpm shaking culture 6h.Draw the above-mentioned culture of 100 μ L then and mix, sprinkle, cultivate 36h at 28 ℃ in being placed on the cellulose membrane of 47mm diameter that aperture on the common substratum is 45 μ m with the conidial suspension of 100 μ l.Wash film with the 2mL minimum medium, results fungi and bacterial cultures, getting 200 liang then is applied on the selection culture medium flat plate that contains 100 μ g/mL chlorimuronethyls (Cholorimuron), suppress growth of Agrobacterium, the single transformant of picking goes to selects culture medium flat plate to carry out postsearch screening and preserve transformant.

The acquisition of embodiment 2, mutant vdgrp1

Infect the water planting cotton by bacterial strain and identify the pathogenic of mutant, thereby filter out the mutant of pathogenic change.Select full cotton seed (new land early-16, purchase), behind 15% clorox immersion 30min in Xinjiang agricultural college of Shihezi Univ, aseptic water washing 2-3 time, soak to be tiled in to cultivate in the box after vernalization is spent the night with sterilized water again and preserve moisture, treat that bud grows to 3cm, plant in the germination box.On cystose, beat the hole of cut-off footpath 2cm, spacing 3cm,, fill in the hole of cystose with the radical bud intersection of sponge strip winding germination cotton seed.Cystose is placed on the plastics casing (high 8-10cm) that fills with clear water, in 25 ℃, illumination 16h, the dark 8h that cultivates down.Treat when true leaf grows clear water to be changed into 1/3 MS nutrient solution, change nutrient solution weekly one time, inoculation when 1 true leaf flattens.The bacterial strain of-80 ℃ of preservations is activated 3-4d through the PDA flat board, put into the Cha Shi nutrient solution from colony edge picking bacterium piece, 25 ℃, 220rpm shakes training 5d, filter, and the centrifugal 5min of filtrate 5000g,, clear water dilution spore, blood counting chamber is counted, and concentration is transferred to 1 * 10 ⁷Individual spore/ml.The spore suspension that mixes up concentration is added in the empty plastics casing, and cotton seedling is inoculated after soaking root 40min.Use 25 ℃ of illumination 16h of MS nutrient solution of 1/3 afterwards, the dark cotton seedling 8h of cultivation that continues down.Plant 12 young plants in every box, 3 repetitions of each kind contrast cotton seedling and soak 40min with clear water.

By aforesaid method, the present inventor has obtained the generation and the pathogenic mutant strain vdgrp1 that all weakens (Fig. 1, Fig. 2) of sclerotium.

The acquisition of embodiment 3, mutator gene

1), Southern hybridization determines that mutant T-DNA inserts copy number (Fig. 3)

The extracting method of A, genomic dna is as follows: in liquid Cha Shi substratum, and 200rpm shaking culture mycelia.Use liquid nitrogen grinding behind the centrifugal 10min of liquid 10000rpm that concussion is cultivated.The extraction damping fluid (100mmol/LTris-HCl, PH8.0, the 100mmol/L EDTA that add 500 μ L, 250mmol/L NaCl), eddy current makes the bacterium powder and extracts the damping fluid thorough mixing, adds 50 μ L 20%SDS then, jog Eppendorf pipe, mixture is mixed, place 37 ℃ of water-bath 1h, take out and adding 75L 5mol/L NaCl, mixing gently, add 65 μ L 10%CTAB and 0.75mol/LNaCl solution again, mixing is put into 65 ℃ of water incubation 20min then gently, takes out the back and adds 700 μ L chloroform/primary isoamyl alcohol (24: 1) solution, mixing, the centrifugal 12min of 12000rpm gets supernatant liquor, adds the freezing dehydrated alcohol of 2 times of volumes, put into-20 ℃ of refrigerators 30min at least behind the mixing, take out the back at the centrifugal 2min of 10000rpm, abandon supernatant, with the 70% alcohol desalinization of soil by flooding or leaching 2 times, after the drying, add 40 μ L TE dissolving.

The DNA of B, extraction cuts with EcoR I and KpnI enzyme respectively

Enzyme is cut system:

Whether get 5ul electrophoresis detection enzyme cuts complete

Add 3vol dehydrated alcohol precipitation enzyme and cut product, be melted at last among about 40 μ lddH2O, add Loading Buffer; The preceding 65 ℃ of 5～10min of point sample.

C, electrophoresis

0.9%Agar (0.5 * TBE); 50V, 18～24hr; The last 5min that oppositely runs.

D, Gel Treatment

(1) after electrophoresis finishes, takes a picture; DdH2O washes gel

(2) 0.2M HCL soaks gel, and places decolorization swinging table to shake (attention is too fast, in case gel is cracked) gently; About 20min is until tetrabromophenol sulfonphthalein flavescence (concentrated hydrochloric acid is 10MOL/L, promptly dilutes 50 times, and 10ml is to 500ml)

(3) deionization washing is 2 times, adds sex change liquid shaking, about 40min, until tetrabromophenol sulfonphthalein by xanthochromia indigo plant

Nacl?1.5M(87.75g/L)

NaOH?0.5M(20g/L)

(4) the deionization washing is 2 times, adds neutralizer shaking, about 30min

Nacl 1.5M(87.75g/L)

Tris.cl?0.5M(60.57g/L)

About 23～the 25ml of dense HCL transfers PH7.2

E, commentaries on classics film

(a) with long and wide all greater than the plate glue of gel as platform, be placed in the vinyl disc, pour 20 * SSC into, cut one with platform wide, length is soaked filter paper one end in vinyl disc earlier greater than the filter paper of platform, slowly is placed on the platform, also soak in 20 * SSC up to the other end, drive the bubble of filter paper peace interstation out of.

(b) cut a long and wide nylon membrane that all is slightly larger than gel, cut off the upper left corner, soak fully in sterilized water, take out film, immerse among 20 * SSC at least 5 minutes again.

(c) after electrophoresis finishes, cut away the nonuseable part of gel, and cut one jiao, with as azimuth mark in the upper left corner.Gel is placed among 20 * SSC rinsing a moment.

(d) gel is placed upside down in the central authorities of filter paper on the platform, drives the bubble between glue and filter paper out of, around gel, do not run into the sample on the gel with Parafilm.

(e) soak gel with 20 * SSC, moistening nylon membrane is placed on above the gel, the two corner cut is overlapped, drive the bubble between nylon membrane and gel out of.

(f) soak 5 filter paper onesize with 20 * SSC, be placed on above the nylon membrane, drive the bubble between filter paper and nylon membrane out of with nylon membrane.

(g) it is thick to cut a folded 10cm, is slightly less than the paper handkerchief of filter paper, is placed on above the filter paper, puts a sheet glass on the paper handkerchief, compresses the weight of 500g, and transfer is spent the night.

(h) throw off paper handkerchief, filter paper and the Parafilm of gel top, upset gel and nylon membrane are placed in the vinyl disc last with the gel one side, with the position of pencil mark gel well on nylon membrane.

(i) peel off gel from nylon membrane and abandon it, nylon membrane is immersed in 5min among 20 * SSC, take out nylon membrane, be placed on the moistening filter paper UV-crosslinked fixedly RNA.

(j) use methylene blue staining, up to seeing RNA band clearly, the distilled water flushing decolouring is wrapped with preservative film, and it is stand-by to be placed on 4 ℃ of preservations.

F, label probe

(Amersham company random primer labelling test kit, RediprimeTMII Random Primer LabellingSystem).

(a) get DNA 25ng to be marked, add sterilized water, make volume be expanded to 45 μ l.

(b) 98 ℃, be incubated 5 minutes, denatured DNA.

(c) centrifugal, DNA is accumulated at the bottom of the centrifuge tube pipe, be placed on ice.

(d) DNA with sex change is added in the mark mixture, and mixing melts (can not blow and beat with rifle) fully up to pellet gently.

(e) add 1 μ l Klenow (preventing the Klenow inactivation in the mark mixture), centrifugal.

(f) add 5 μ l α-32P-dCTP, blow and beat gently evenly with rifle, centrifugal.

(g) 37 ℃, reacted 30 minutes; 98 ℃, 5 minutes, sex change is the good dna probe of mark, and was centrifugal, is placed on ice.

(h) get an amount of probe and be used for hybridization, remaining probe is kept in 4 ℃ of refrigerators.

G, hybridization

Southern?Blot?Buffer

Be that final concentration is respectively:

5×Denhart’s

5×SSPE

0.5％SDS

(a) prehybridization: hybridization buffer is poured in the hybrid pipe, and 65 ℃ of preheating 15min put into crosslinked fixed film, 65 ℃ of pre-assorted 1～2hr.

(b) hybridization: add the good probe of 20 μ l marks in hybrid pipe, 65 ℃ of hybridization are spent the night.

(c) wash film:, under 65 ℃/20min condition, wash film twice with washing film damping fluid 2 * SSC/2%SDS; With 0.2 * SSC/0.2%SDS, under 65 ℃/20min condition, wash film once.

(d) compressing tablet: will wash,

Film is taken out from hybrid pipe, is transferred in the two-layer plastic film, detects the hybridization signal power, and film is put into dark folder, the X-mating plate is pressed in the dark folder-80 ℃ of compressing tablets in the darkroom.

(e) punching: in the darkroom X-mating plate is taken out photographic fixing in development and the stop bath in developing solution respectively.

The result as shown in Figure 3.Among Fig. 3, right-hand demonstration be PLL16 carrier sketch, the probe of hybridization is the EGFP sequence.The result shows from figure, all can only hybridize to a band with hybridization probe EGFP after cutting DNA with EcoR I and Kpn I enzyme respectively, illustrate that PLL16 singly copies.

2), TAIL-PCR and RACE technology obtain the mutator gene sequence

The present inventor utilizes hot asymmetric interlaced PCR (TAIL-PCR) to obtain to insert the site flanking sequence.According to the known array of carrier about design 3 nested Auele Specific Primer LB1, LB2, LB3 and RB1 that do not wait with its frontier distance respectively, RB2, RB3, the about 20bp of the length of Auele Specific Primer, Tm are generally 58～68 ℃:

LB1?gggttcctatagggtttcgctcatg

LB2?catgtgttgagcatataagaaaccct

LB3?gaattaattcggcgttaattcagt

RB1?ggcactggccgtcgttttacaac

RB2?aacgtcgtgactgggaaaaccct

RB3?cccttcccaacagttgcacag

Design a series of degenerated primer AD according to the ubiquitous proteinic conserved amino acid sequence of species again, degenerated primer is shorter relatively, and length is 14bp, and Tm is 30～48 ℃:

AD1?(AGCT)TCGA(GC)T(AT)T(GC)G(AT)GTT

AD2?(AGCT)GTCGA(GC)(AT)GA(AGCT)A(AT)GAA

AD3?(AT)GTG(AGCT)AG(AT)A(AGCT)CA(AGCT)AGA

AD4?TG(AT)G(AGCT)AG(AT)A(AGCT)CA(GC)AGA

AD5?AG(AT)G(AGCT)AG(AT)A(AGCT)CA(AT)CA(AT)AGG

AD6?CA(AT)CGIC(AGCT)GAIA(G/C)GAA

AD7?TC(GC)TICG(AGCT)ACIT(AT)GGA

AD8?(GC)TTG(AGCT)TA(GC)T(AGCT)CT(AGCT)TGC

AD9?(AT)CAG(AGCT)TG(AT)T(AGCT)GT(AGCT)CTG

AD 10TCTTICG(AGCT)ACIT(AGCT)GGA

AD 11TTGIAG(AGCT)ACIA(AGCT)AGG

PCR reaction by three-wheel obtains flanking sequence, and second and third template of taking turns is respectively first and second PCR product of taking turns.Response procedures is as follows:

*, * *, * * * and * * * * represent respectively * 5, * 10, * 15, * 30 circulations.

After obtaining to insert the flanking sequence at two ends, site, may encode site and promotor site (the network address http://www.cbs.dtu.dk/services/Promoter/ and the http://genes.mit.edu/cgi-bin/genscan) of analytical sequence, designed two pairs of chimeric primers:

30ut-P1：GCCCCGACTCTCACCACCCA

3Inner-P2：AAAGCCCTCACCCGCCAACC

50ut-P1：CCAGAGCATCGACCGTCTCGT

5Inner-P2：TCCTCTTCCTCGTCGTCCTCC

Use the FirstChoice RLM-RACE test kit of Ambion company,, be 3 ' RACE and 5 ' RACE and obtain gene VdGRP1 cDNA according to the described step of test kit specification sheets.The VdGRP1 cDNA that obtains is shown in sequence in the sequence table 1.Sequence 1 is made up of 526 deoxynucleotides, sequence 1 is the ORF district from 5 ' end 132-407 position Nucleotide in sequence table, the protein of amino acid residue sequence described in the encoding sequence 2, with the albumen called after VdGRP1 shown in the sequence 2, with the proteic encoding gene called after of VdGRP1 VdGRP1.

The complementation checking of embodiment 3, mutant

Primer 1:g TCTAGAATGCCGCCCAAAAAGCC (upstream primer, the line part is Xba I)

Primer 2: c GGATCCTTAATCACTGTCATTGCCATC (downstream primer, the line part is BamH I)

(bacterial strain V592 picks up from cotton field, Xinjiang to extract big beautiful Verticillium wild type strain V592, now be stored in inventor laboratory, can buy by signing the material transport contract with contriver place institute) RNA, concrete steps are extracted tela contexta RNA according to implementation column 4Trizol reagent method.Carry out the ORF district of RT-PCR amplification VdGRP1 cDNA with above-mentioned primer 1 and primer 2.Cloning and sequencing proves that the nucleotide sequence of amplified production is shown in the 132-407 position Nucleotide of sequence in the sequence table 1.Sequence 1 is made up of 526 deoxynucleotides, sequence 1 is the ORF district from 5 ' end 132-407 position Nucleotide in sequence table, the protein of amino acid residue sequence described in the encoding sequence 2, with the albumen called after VdGRP1 shown in the sequence 2, with the proteic encoding gene called after of VdGRP1 VdGRP1.

Utilize XbaI and BamHI restriction enzyme site that the fragment cloning shown in the sequence in the sequence table 1 is entered the promotor downstream of expressed in fungi carrier pSUlPH-TN-1, obtain recombinant expression vector pSUlPH-TN-VdGRP1.Empirical tests, recombinant expression vector makes up correct.

Wherein the construction process of carrier pSUlPH-TN-1 is as follows: with carrier pSULPH-GFP (researcher of He Chao family of Institute of Microorganism, Academia Sinica) with Pst I and Nco I excision GFP sequence, and between Pst I and Nco I, connect into restriction enzyme site XbaI, Sma I, BamHI make up and form.

Utilize agriculture bacillus mediated conversion to change into mutant strain vdgrp1 again, obtain complementary bacterial strain vdgrp1/VdGRP1.Carry out pathogenic evaluation according to the method that embodiment 2 introduces, mutator gene has obtained complementation, and mutant strain vdgrp1 has recovered certain pathogenic (Fig. 8).

The functional study of embodiment 4, gene VdGRP1

Big beautiful lecanii strain V592 is cultivated on the PDA flat board, dig down the bacterium piece from the PDA flat board that covers with spore and sclerotium and insert the Cha Shi substratum, 28 ℃, 200rpm cultivates.Draw materials respectively at second day, the 3rd day, the 4th day, extract RNA, carry out northern hybridization.Probe is gene VdGRP1 cDNA sequence (sequence 1 holds shown in the 1-526 position from 5 ' in the sequence table).Northern hybridization confirms that gene VdGRP1 has higher expression, and prolongs the gesture (Fig. 4) that becomes to increase progressively along with incubation time in the whole etap of bacterial strain from the spore to the mycelia.Dig down the bacterium piece from the PDA flat board that covers with spore and sclerotium and insert the Cha Shi substratum, 28 ℃, 200rpm cultivates.Drew materials in the 4th day, and leached spore, extract the RNA of mycelia and spore respectively, carry out northern hybridization with four layers of gauze.Northern hybridization confirms that gene VdGRP1 all has expression (Fig. 7) in spore and mycelia.

Dig down the bacterium piece from the PDA flat board that covers with spore and sclerotium and insert the Cha Shi substratum, 28 ℃, 200rpm cultivates.In the time of the 4th day, two bottles of the fungus culture medium div in par aeq, one bottle in contrast.New land early-16 cotton plants grind to form juice, add in another flask culture liquid, continue to cultivate, draw materials respectively at the 4th hour, the 8th hour that adds certainly after the cotton plants juice, extract RNA and carry out cross experiment.Wash spore with sterilized water from the bacterium colony on the flat board, be applied on the PDA substratum that is covered with nitrocellulose filter, be cultured to and produce germ nuclear.Scrape germ nuclear, extract RNA and carry out cross experiment.Gene VdGRP1 is in low expression level state in the sclerotium phase.Induced by cotton juice, expression level increase (Fig. 6).

Dig down the bacterium piece from the PDA flat board that covers with spore and sclerotium and insert the Cha Shi substratum, 28 ℃, 200rpm cultivates.In the time of the 3rd day, fungi is carried out nitrogen stress, scarce sugar, high salt concentration, high density N.F,USP MANNITOL and uviolizing respectively handle.Nitrogen stress, the concrete implementation step that lacks sugar are: centrifugal 1 minute of fungus culture medium 1200rpm, collect mycothallus, join nitrogen stress respectively and lack in the Cha Shi substratum of sugar.The concrete implementation step of high salt concentration, high density N.F,USP MANNITOL is: add 0.5M NaCl, 0.6M N.F,USP MANNITOL in the 3rd day fungal cultures respectively.The concrete implementation step that uviolizing is handled is: the 3rd day fungus culture medium is poured in the glass dish, placed irradiation cultivation under the ultraviolet lamp.The culture of above-mentioned processing continues to cultivate after 8 hours draws materials, and extracts RNA and carries out northern hybridization.Hybridization confirms that the expression of gene VdGRP1 also is subjected to environment-stress as lacking sugar and high induce (Fig. 5) that coerces as high density NaCl, high density N.F,USP MANNITOL that ooze.Illustrate that gene VdGRP1 has certain function in the process that big beautiful Verticillium response environment is coerced.

The concrete implementation step of above-mentioned northern hybridization is as follows:

A, Trizol reagent method are extracted tela contexta RNA

(1) fungal material is used the liquid nitrogen grinding powdered in mortar, per 50～100mg tissue adds 1mlRNAVzol, and homogenate is to cracking fully in centrifuge tube; Room temperature is placed 5min.

(2) add the chloroform (1ml RNAVzol adds the 0.2ml chloroform) of 0.2 times of volume in the centrifuge tube of lysate is housed, with fully vibrate mixing 30 seconds of vibrator, room temperature is placed 2～3min.

(3) 4 ℃, 14000rpm, centrifugal 10min draws in the new centrifuge tube of upper strata water to, and every milliliter of RNAVzol can draw about 0.5～0.55ml.

(4) add the 0.5ml Virahol by every milliliter of initial RNAVzol, put upside down for several times mixing, precipitation at room temperature 10min.

(5) 4 ℃, 1,4000rpm, centrifugal 10min, visible RNA precipitation at the pipe end.Abandon supernatant, every milliliter of initial RNAVzol adds 1ml 75% ethanol, puts upside down mixing gently, to clean the RNA precipitation.Discard liquid, carefully do not abandon the RNA precipitation.Room temperature is inverted and is dried (5～10min).

(6) add an amount of 50% deionized formamide dissolving RNA precipitation, deposit in-80 ℃ standby.

B、mRNA?northern?blotting

(1) required reagent

(175.3g NaCI, 88.2g trisodium citrate are regulated pH to 7.0 with HCl to 20 * SSC, are settled to 1L, autoclaving.), (20ml 0.5M EDTA regulates pH to 7.0 with NaOH to 10 * MOPS, is settled to 1L, is contained in the brown bottle autoclaving or filtration sterilization for 41.8g MOPS, 6.56g NaAc.Present faint yellow available, yellow unavailable behind the autoclaving.), 37% formaldehyde (Formaldehyde), deionized formamide (Formamidedeionized), methylene blue staining liquid (0.03% methylene blue, 0.3M NaAc, pH5.2).

(2) RNA electrophoresis

The preparation of 1.2% agarose denaturing formaldehyde glue:

?Total：200ml	Aequum	Final concentration
			Agarose	2.4g	1.2％
?10×MOPS	20ml	1×
			?37％?Formaldehyde	5.41ml	1％

The preparation of RNA sample (being dissolved in 50% deionized formamide last sample 5-10ug):

Sample?buffer?mix：	25.5μl
		10×MOPS	5μl
37％?Formaldehyde	8μl
		Formamide?deionized	12.5μl

With Sample buffer mix and RNA sample equal-volume mixing, 65 ℃, sex change 5min places 5min on ice, adds sample loading buffer, mixing, last sample.

The RNA electrophoresis:

Electrophoretic buffer: 1 * MOPS

Voltage=120V, about 3 hr

(3) change film (up capillary transfer method)

(4) label probe

(a) get DNA to be marked (sequence 1 holds the VdGRP1 cDNA sequence shown in the 1-526 position from 5 ' in the sequence table) 25ng, add sterilized water, make volume be expanded to 45 μ l.

(b) 98 ℃, be incubated 5 minutes, denatured DNA.

(5) hybridization

Hybridization buffer: 20.4ml	Volume required	Final concentration
			1M?NaHPO4(pH7.2)	8.6ml	43mM
20％?SDS	7ml	7％
			5％?BSA	4ml	1％
0.5?M?EDTA	0.8ml	20mM

(d) compressing tablet: washed film is taken out from hybrid pipe, be transferred in the two-layer plastic film, detect the hybridization signal power, film is put into dark folder, in the darkroom, the X-mating plate is pressed in the dark folder-80 ℃ of compressing tablets.

The acquisition of embodiment 5, VdGRP1 RNAi knock-out bacterial strain

According to the cDNA sequence of gene VdGRP1, design two pairs of primers.

VdGRP1i1-s:c AAGCTTAAAGCCCTCACCCGCCAACC (the line part is Hind III)

VdGRP1i1-a:c AGATCTCAGCCCTGTCCTCGTCTCCT (the line part is Bgl II)

VdGRP1i2-s:c GGATCCAAAGCCCTCACCCGCCAACC (the line part is BamH I)

VdGRP1i2-a:g CTGCAGCAGCCCTGTCCTCGTCTCCT (the line part is Pst I)

With the sequence shown in the sequence in the sequence table 1 is template, VdGRP1i1-s and the VdGRP1i1-a forward sequence that is used for increasing, and VdGRP1i2-s and VdGRP1i2-a are used for the reverse complementary sequence that increases.After forward sequence (the 22nd of sequence 3 to shown in 240) and reverse complementary sequence are cloned into the T carrier, select correct clone, respectively with cutting with HindIII and Bgl II and BamH I and Pst I enzyme, (document of record PSK-int carrier is Hui-Shan Guo to fragment cloning after the recovery to PSK-int, Jifeng Fei, Qi Xie and Nam-Hai Chua.2003 Achemical-regulated inducible RNAi system in plants.The Plant Journal, 34,383-392, the public can obtain from Institute of Micro-biology of the Chinese Academy of Sciences), obtain PSK-int-RNAi.PSK-int-RNAi cuts with SalI and Spe I enzyme, the fragment (nucleotide sequence is shown in sequence in the sequence 3) that obtains is cloned into pSUlPH-TN-2 (after pSULPH-GFP cuts with XbaI and HindIII enzyme, be connected into the TN sequence shown in the sequence 4 in the sequence table, be built into the pSUlPH-TN-2 carrier with XbaI and HindIII end; The document of record pSULPH-GFP carrier is Zhuangzhi Zhou, Guihua Li, Chunhua Lin and Chaozu He (2009) ConidiophoreStalk-less1 Encodes a Putative Zinc-Finger Protein Involved in the Early Stage ofConidiation and Mycelial Infection in Magnaporthe oryza

Claims

1. an albumen is following 1) or 2) protein:

2. the described proteic encoding gene of claim 1.

3. encoding gene according to claim 2 is characterized in that: described proteic encoding gene is following 1)-4) in arbitrary described gene:

2) its nucleotide sequence is the sequence 1 in the sequence table;

3) under stringent condition with 1) or 2) gene recombination and the described proteic gene of coding claim 1;

4) with 1) or 2) gene have the homology 90% or more and the described proteic gene of claim 1 of encoding.

4. the recombinant vectors, transgenic cell line or the reorganization bacterium that contain claim 2 or 3 described genes.

5. dna fragmentation, its nucleotide sequence be following a) or b):

B) sequence shown in the sequence 3 in the sequence table.

6. the recombinant vectors, transgenic cell line or the reorganization bacterium that contain the described dna fragmentation of claim 5; Described recombinant vectors is the recombinant vectors that the fragment shown in the sequence in the sequence table 3 is inserted the multiple clone site formation of pSUlPH-TN carrier; Described pSUlPH-TN carrier is that the fragment shown in the sequence 4 is inserted the carrier that the pSULPH-GFP plasmid constitutes in the sequence table.

7. a method of cultivating the fungi of pathogenic reduction comprises the steps: to reduce claim 2 or 3 described expression of gene in the described fungi, obtains the fungi of described pathogenic reduction.

8. method according to claim 7 is characterized in that: the claim 2 or the 3 described expression of gene that reduce in the described fungi are to realize by the fragment shown in the sequence in the sequence table 3 is imported in the described fungi.

9. method according to claim 8 is characterized in that: the fragment shown in the sequence 3 imports in the described fungi by the described recombinant vectors of claim 6 in the described sequence table.

10. according to claim 7 or 8 or 9 described methods, it is characterized in that: described fungi is the bacterium that contains claim 2 or 3 described genes, preferably big beautiful Verticillium; Described pathogenic for causing verticillium.