CN1623999A - Salt Du's algal nitrate transfer protein and its code sequence - Google Patents
Salt Du's algal nitrate transfer protein and its code sequence Download PDFInfo
- Publication number
- CN1623999A CN1623999A CN 200310109020 CN200310109020A CN1623999A CN 1623999 A CN1623999 A CN 1623999A CN 200310109020 CN200310109020 CN 200310109020 CN 200310109020 A CN200310109020 A CN 200310109020A CN 1623999 A CN1623999 A CN 1623999A
- Authority
- CN
- China
- Prior art keywords
- transport protein
- nitrate transport
- sequence
- polypeptide
- polynucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Peptides Or Proteins (AREA)
Abstract
A novel salt resistance associated protein-Du's saline alga nitrate transporter, the polynucleotide for coding it, the process for preparing said protein by recombination, the application of said polynucleotide, and the method for improving the salt resistance of plant by use of said transporter are disclosed.
Description
Technical field
The invention belongs to field of biology, specifically, the present invention relates to the polynucleotide of new coding Dunaliella salina (Dunaliella salina) protein related to salt tolerance-nitrate transport protein, and the polypeptide of this polynucleotide encoding.The invention still further relates to the purposes and the preparation of these polynucleotide and polypeptide.Specifically, polypeptide of the present invention is a kind of new protein related to salt tolerance.
Background technology
At present, world population constantly increases, and constantly reduces and can till the land.Yet, also have the many land resourcess that can't effectively utilize because of salinization on the earth.In order to effectively utilize the land resources of these salinization, people are seeking the plant variety that had both adapted to the growth and had higher economic worth always.Yet, do not have very suitable plant variety up to now.
The method of another kind of exploitation saline alkali tolerant plant is to existing plant variety, and the plant variety that especially has higher economic worth improves.Yet traditional plant improvement method is time-consuming, effort and lack specific aim.
In order to improve the salt tolerance of plant variety effectively, pointedly, this area presses for exploitation gene and the albumen relevant with salt tolerance.
Summary of the invention
An object of the present invention is to provide a kind of new Dunaliella salina protein related to salt tolerance nitrate transport protein with and fragment, analogue and derivative.
Another object of the present invention provides the polynucleotide of these polypeptide of coding.
Another object of the present invention provides method and the purposes of this polypeptide and encoding sequence, the especially purposes aspect the raising plant salt endurance of producing these polypeptide.
Dunaliella salina (Dunaliella salina) belongs to Chlorophyta, Chlorophyceae, volvocales, crinosity algae section, Dunaliella salina genus, mainly grows in the high salinity water body.Cellular form is generally oval, and when extraneous osmotic pressure changed, its form can be changed into spherical to fusiform.It has two isometric flagellums and a cup-shaped chloroplast(id), can accumulate a large amount of β-Hu Luobusu droplets in the outer rim of chloroplast(id), and it is orange red to be that cell is.The acellular wall of cell has the bag quilt that is formed by glycoprotein.Dunaliella salina and chlamydomonas (Chlamydomonas) have nearer sibship.The inventor is by for many years to the research of Dunaliella salina, found in the Dunaliella salina and salt tolerance proteins associated-nitrate transport protein, finished the present invention on this basis.
In a first aspect of the present invention, novel isolated nitrate transport protein is provided, this protein source is from Dunaliella salina, and it comprises: polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative with SEQ ID NO:2 aminoacid sequence.
Preferably, this albumen is selected from down group:
(a) has the polypeptide of SEQ ID NO:2 aminoacid sequence;
(b) SEQ ID NO:2 aminoacid sequence is formed through replacement, disappearance or the interpolation of one or more amino-acid residues, and have the nitrate transport protein function by (a) polypeptides derived.
More preferably, this translocator is the polypeptide with SEQ ID NO:2 aminoacid sequence.
In a second aspect of the present invention, the polynucleotide of the isolating Dunaliella salina nitrate transport protein of coding are provided, these polynucleotide comprise a nucleotide sequence, this nucleotide sequence shows at least 70% with a kind of nucleotides sequence that is selected from down group, preferably at least 80%, at least 90% homogeny more preferably: (a) polynucleotide of the above-mentioned Dunaliella salina nitrate transport protein of coding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 1-1617 position among the SEQ ID NO:1; (b) has the sequence of 1-1620 position among the SEQ ID NO:1.
In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.
In a fourth aspect of the present invention, the method for preparing the Dunaliella salina nitrate transport protein is provided, this method comprises: (a) under conditions suitable for the expression, cultivate the above-mentioned host cell that is transformed or transduce; (b) from culture, isolate the Dunaliella salina nitrate transport protein.
In a fifth aspect of the present invention, provide and above-mentioned Dunaliella salina nitrate transport protein specificity bonded antibody.The nucleic acid molecule that can be used for detecting also is provided, and it contains a successive 15-1620 Nucleotide in the above-mentioned polynucleotide.
In a sixth aspect of the present invention, simulation, promotion, the active compound of antagonism Dunaliella salina nitrate transport protein are provided, and the compound that suppresses the expression of Dunaliella salina nitrate transport protein.The method of screening and/or prepare these compounds also is provided.
In a seventh aspect of the present invention, the method that whether has nitrate transport protein in the test sample is provided, it comprises: sample is contacted with the specific antibody of nitrate transport protein, observe whether form antibody complex, formed antibody complex and just represented to exist in the sample nitrate transport protein.
In a eighth aspect of the present invention, provide the purposes of polypeptide of the present invention and encoding sequence.Polypeptide for example of the present invention can be used to screening and promote the active agonist of Dunaliella salina nitrate transport protein, and perhaps screening suppresses the active antagonist of Dunaliella salina nitrate transport protein or is used to the peptide finger print identification.The encoding sequence of Dunaliella salina nitrate transport protein of the present invention or its fragment can be used as primer and be used for pcr amplification reaction, perhaps are used for hybridization as probe, perhaps are used to make gene chip or microarray.
In a ninth aspect of the present invention, a kind of method of improving plant salt endurance is provided, it comprises step:
(1) provide the Agrobacterium of carrying expression vector, described expression vector contains nitrate transport protein dna encoding sequence, and described nitrate transport protein is selected from down group:
(a) has the polypeptide of SEQ ID NO:2 aminoacid sequence;
(b) SEQ ID NO:2 aminoacid sequence is formed through replacement, disappearance or the interpolation of one or more amino-acid residues, and have the nitrate transport protein function by (a) polypeptides derived.
(2) vegetable cell or tissue or organ are contacted with Agrobacterium in the step (1), thereby make nitrate transport protein dna encoding sequence change vegetable cell over to, and be incorporated on the karyomit(e) of vegetable cell;
(3) select vegetable cell or tissue or the organ that changes nitrate transport protein dna encoding sequence over to;
(4) vegetable cell in the step (3) or tissue or neomorph are become plant.
Preferably, this nitrate transport protein is the polypeptide with SEQ ID NO:2 aminoacid sequence.
Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
Embodiment
In the present invention, term " nitrate transport protein (nitrate transporter) ", " nitrate transport protein polypeptide " or " protein related to salt tolerance nitrate transport protein " are used interchangeably, and all refer to have albumen or the polypeptide of Dunaliella salina protein related to salt tolerance nitrate transport protein aminoacid sequence (SEQ ID NO:2).They comprise the protein related to salt tolerance nitrate transport protein that contains or do not contain initial methionine.
The catalytic reaction of nitrate transport protein is as follows: extracellular nitrate ion is gone in the tenuigenin by cell membrane transporter.
As used herein, " isolating " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.
As used herein, " isolating nitrate transport protein or polypeptide " is meant that nitrate transport protein is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying nitrate transport protein of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.
Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.
The present invention also comprises fragment, derivative and the analogue of Dunaliella salina nitrate transport protein.As used herein, term " fragment ", " derivative " are meant biological function or the active polypeptide that keeps natural Dunaliella salina nitrate transport protein of the present invention identical basically with " analogue ".Polypeptide fragment of the present invention, derivative or analogue can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferred conservative amino acid residue), and the amino-acid residue of such replacement can be also can not encoded by genetic code, or (ii) in one or more amino-acid residues, has a polypeptide of substituted radical, or (iii) mature polypeptide and another compound (such as the compound that prolongs the polypeptide transformation period, polyoxyethylene glycol for example) merges formed polypeptide, or (iv) additional aminoacid sequence is fused to this peptide sequence and the polypeptide that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying, or with the fusion rotein of the segmental formation of antigen I gG).According to the instruction of this paper, these fragments, derivative and analogue belong to the known scope of those skilled in the art.
In the present invention, term " Dunaliella salina nitrate transport protein " refers to have the active SEQ ID of Dunaliella salina nitrate transport protein NO.2 polypeptide of sequence.This term also comprises having and variant form Dunaliella salina nitrate transport protein identical function, SEQ ID NO.2 sequence.These variant forms comprise (but being not limited to): one or more (it is individual to be generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises the active fragments and the reactive derivative of Dunaliella salina nitrate transport protein.
The variant form of this polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, under high or low tight degree condition can with the coded albumen of the DNA of Dunaliella salina nitrate transport protein DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-Dunaliella salina nitrate transport protein to obtain.The present invention also provides other polypeptide, as comprises Dunaliella salina nitrate transport protein or its segmental fusion rotein.Except the polypeptide of total length almost, the present invention has also comprised the soluble fragments of Dunaliella salina nitrate transport protein.Usually, this fragment have Dunaliella salina nitrate transport protein sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.
Invention also provides the analogue of Dunaliella salina nitrate transport protein or polypeptide.The difference of these analogues and natural Dunaliella salina nitrate transport protein can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
In the present invention, " Dunaliella salina nitrate transport protein conservative property variation polypeptide " refers to compare with the aminoacid sequence of SEQ IDNO:2, there are 10 at the most, preferably at the most 8, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best.These conservative property variation polypeptide preferably carry out the amino acid replacement according to table 1 and produce.
Table 1
| Initial residue | Representational replacement | The preferred replacement |
| Ala(A) | Val；Leu；Ile | Val |
| Arg(R) | Lys；Gln；Asn | Lys |
| Asn(N) | Gln；His；Lys；Arg | Gln |
| Asp(D) | Glu | Glu |
| Cys(C) | Ser | Ser |
| Gln(Q) | Asn | Asn |
| Glu(E) | Asp | Asp |
| Gly(G) | Pro；Ala | Ala |
| His(H) | Asn；Gln；Lys；Arg | Arg |
| Ile(I) | Leu；Val；Met；Ala；Phe | Leu |
| Leu(L) | Ile；Val；Met；Ala；Phe | Ile |
| Lys(K) | Arg；Gln；Asn | Arg |
| Met(M) | Leu；Phe；Ile | Leu |
| Phe(F) | Leu；Val；Ile；Ala；Tyr | Leu |
| Pro(P) | Ala | Ala |
| Ser(S) | Thr | Thr |
| Thr(T) | Ser | Ser |
| Trp(W) | Tyr；Phe | Tyr |
| Tyr(Y) | Trp；Phe；Thr；Ser | Phe |
| Val(V) | Ile；Leu；Met；Phe；Ala | Leu |
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.As used herein, " varient of degeneracy " is meant that in the present invention coding has the protein of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.
The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence of an encoding mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.
Term " polynucleotide of coded polypeptide " can be the polynucleotide that comprise this polypeptide of encoding, and also can be the polynucleotide that also comprise additional code and/or non-coding sequence.
The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.
The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 50%, preferably at least 70%, the polynucleotide of at least 80% homogeny more preferably.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 90%, be more preferably 95% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.
The invention still further relates to nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " contains 15 Nucleotide at least, better is at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid to determine and/or to separate the polynucleotide of coding nitrate transport protein.
Polypeptide among the present invention and polynucleotide preferably provide with isolating form, more preferably are purified to homogeneous.
Dunaliella salina nitrate transport protein Nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.
In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.
In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.
At present, can be fully obtain the dna sequence dna of code book invention albumen (or its fragment, or derivatives thereof) by chemosynthesis.This dna sequence dna can be introduced in various existing dna moleculars as known in the art (or as carrier) and the cell then.In addition, also can will suddenly change and introduce in the protein sequence of the present invention by chemosynthesis.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with carrier of the present invention or nitrate transport protein encoding sequence, and the method that produces polypeptide of the present invention through recombinant technology.
Recombinant DNA technology (Science, 1984 by routine; 224:1431), can utilize polymerized nucleoside acid sequence of the present invention to can be used to express or produce the nitrate transport protein of reorganization.In general following steps are arranged:
(1). with the polynucleotide (or varient) of coding Dunaliella salina nitrate transport protein of the present invention, or transform or the transduction proper host cell with the recombinant expression vector that contains these polynucleotide;
(2). the host cell of in suitable medium, cultivating;
(3). separation, protein purification from substratum or cell.
Among the present invention, Dunaliella salina nitrate transport protein polynucleotide sequence can be inserted in the recombinant expression vector.Term " recombinant expression vector " refers to bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus or other carriers.In a word, as long as can duplicate in host and stablize, any plasmid and carrier can be used.A key character of expression vector is to contain replication orgin, promotor, marker gene and translation controlling elements usually.
Method well-known to those having ordinary skill in the art can be used to make up saliferous and give birth to Dunaliella salina nitrate transport protein DNA sequences encoding and suitable transcribing/the translate expression vector of control signal.These methods comprise extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technology of body etc.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance.
Comprise the carrier of above-mentioned suitable dna sequence dna and suitable promotor or control sequence, can be used to transform appropriate host cell, so that it can marking protein.
Host cell can be a prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as vegetable cell.Representative example has: intestinal bacteria, streptomyces, Agrobacterium; Fungal cell such as yeast; Vegetable cell; Insect cell etc.
When polynucleotide of the present invention are expressed in higher eucaryotic cells, be enhanced if will make to transcribe when in carrier, inserting enhancer sequence.Enhanser is the cis acting factor of DNA, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.
Persons skilled in the art all know how to select appropriate carriers, promotor, enhanser and host cell.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results
2Method is handled, and used step is well-known in this area.Another kind method is to use MgCl
2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.Transform plant and also can use methods such as Agrobacterium-mediated Transformation or particle gun conversion, for example leaf dish method.Can use ordinary method regeneration plant for plant transformed cell, tissue or organ, thereby obtain the plant that salt tolerance improves.
The transformant that obtains can be cultivated with ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
The extracellular can be expressed or be secreted into to recombinant polypeptide in the above methods in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation handles, with protein precipitant handle (salt analysis method), centrifugal, the broken bacterium of infiltration, superly handle, the combination of super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
The Dunaliella salina nitrate transport protein or the polypeptide of reorganization are of use in many ways.For example be used to screen antibody, polypeptide or other part that promotes or resist the nitrate transport protein function.Can be used for seeking the valuable peptide molecule that can suppress or stimulate Dunaliella salina nitrate transport protein function with the reorganization Dunaliella salina nitrate transport protein screening peptide library of expressing.
On the other hand, the present invention also comprises Dunaliella salina nitrate transport protein DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Preferably, refer to that those can combine with Dunaliella salina nitrate transport protein gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress the molecule of Dunaliella salina nitrate transport protein, comprise that also those do not influence the antibody of Dunaliella salina nitrate transport protein function.The present invention also comprise those can with modify or without the Dunaliella salina nitrate transport protein gene product bonded antibody of modified forms.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment or chimeric antibody.
Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the Dunaliella salina nitrate transport protein gene product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing Dunaliella salina nitrate transport protein or its has antigenic segmental cell and can be used to immune animal and produce antibody.This type of monoclonal antibody can utilize hybridoma technology to prepare.Each antibody-like of the present invention can utilize the fragment or the functional zone of Dunaliella salina nitrate transport protein gene product, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of Dunaliella salina nitrate transport protein gene product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).
The antibody of anti-Dunaliella salina nitrate transport protein can be used for the Dunaliella salina nitrate transport protein in the test sample.For example pass through detection by quantitative Dunaliella salina nitrate transport protein, and utilize the dependency of nitrate transport protein and salt concn, can determine salt concn in the Dunaliella salina production environment.
Available Dunaliella salina nitrate transport protein of the production of polyclonal antibody or polypeptide immune animal, as rabbit, mouse, rat etc.Multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.
The invention still further relates to the testing method of quantitative and detection and localization Dunaliella salina nitrate transport protein level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.The Dunaliella salina nitrate transport protein level that is detected in the test can be used for explaining Dunaliella salina nitrate transport protein importance aspect salt tolerance.
A kind of method that whether has nitrate transport protein in the test sample that detects is to utilize the specific antibody of nitrate transport protein to detect, and it comprises: sample is contacted with the nitrate transport protein specific antibody; Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample nitrate transport protein.
Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis of tissue gene.Carry out the transcription product that RNA-polymerase chain reaction (RT-PCR) amplification in vitro also can detect nitrate transport protein with the special primer of nitrate transport protein.
In an example of the present invention, a kind of isolating polynucleotide are provided, its coding has the polypeptide of aminoacid sequence shown in the SEQ IDNO:2.Polynucleotide of the present invention are isolated from Dunaliella salina cDNA library.Its sequence is shown in SEQ ID NO:1, and the polynucleotide sequence total length that it comprises is 1620 bases, and its open reading frame is positioned at the 1-1617 position, and the coding total length is 539 amino acid whose Dunaliella salina nitrate transport proteins (SEQ ID NO:2).Nitrate transport protein provides new approach for the salt tolerance of improving plant, thereby has great application prospect.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1
The clone of Dunaliella salina nitrate transport protein gene
1. the collection of Dunaliella salina (Collection)
Dunaliella salina (Dunaliella salina) is available from Wuhan hydrobiont institute algae kind storehouse.
2.Poly A
+The separation of RNA (Poly A
+RNA isolation)
With Trizol reagent (Gibco, NY, USA) total RNA of extraction Dunaliella salina.Identify total RNA quality with the denaturing formaldehyde gel electrophoresis.The test kit process specifications that uses Oligotex mRNA Kits (Qiagen) to provide extracts the mRNA of Dunaliella salina.
3. the structure in Dunaliella salina cDNA library (Cloning of Full-length cDNA)
The test kit specification sheets that uses Smart cDNA Library Construction Kit (ClonTech) to provide is a carrier with λ TriplEX2, makes up the cDNA phage library of Dunaliella salina.
4. the full-length clone of gene (Cloning of Full-length cDNA)
Compare by nitrate transport protein, determined the partial amino-acid conserved sequence a large amount of different plant species (comprising chlamydomonas, yeast, intestinal bacteria etc.).Design primer in view of the above, employing RACE method (Gibco test kit, NY USA) carry out the cDNA full-length clone, divide three phases to carry out:
(1) uses primer, with Poly A
+RNA is a template, carries out the RT-PCR amplification
With oligonucleotide: 5 ' CAACATCATCGTGGCTTACA 3 ' (SEQ ID NO:3) is a forward primer; Oligonucleotide: 5 ' TTCTTGGGTGGTCATCTTCA 3 ' (SEQ ID NO:4) is a reverse primer, with Poly A+RNA is template, carry out the RT-PCR amplification, amplification condition be 94 ℃ 5 minutes, 94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ were carried out 35 circulations in 1 minute subsequently, extended 5 minutes with 72 ℃ at last.The electrophoresis detection pcr amplification product, the fragment length that obtains is about 0.45kb, reclaiming fragment is connected on the T-easy carrier of purchase,, adopt to stop fluorescent mark (Big-Dye, Perkin-Elmer as universal primer with SP6 or T7, USA) method, (Perkin-Elmer checks order on USA), records a 436bp sequence at the ABI377 sequenator.
This sequence and coded protein sequence thereof are carried out Nucleotide and protein homology retrieval with blast program at the Non-redundantGenBank+EMBL+DDBJ+Swissprot+Superdate+PIR database, the nitrate transport protein gene that found that it and Chlamydomonas reinhardtii has higher homology, has confirmed the correct of primer.
(2).RACE
According to above sequential analysis design
5 ' RACE primer: 5 ' AATGGTGCCTCCCAGAGTCTCGTCC 3 ' (SEQ ID NO:5)
3 ' RACE primer: 5 ' CCGCCGATCATATGGAGTAGTGG 3 ' (SEQ ID NO:6)
Use SMART
TMRACE cDNA Amplification Kit (Clontech) carries out according to operational manual, obtains 5 ' and 3 ' terminal sequence of Dunaliella salina nitrate transport protein gene.
(3) the .PCR amplification obtains nitrate transport protein gene coding region (process is with (1)).
Obtain further designing primer on the total length basis of (comprising complete open reading frame) in splicing: with oligonucleotide: CAGACAACATCCACTCCGCCATG (SEQ ID NO:7) is forward primer; Oligonucleotide: CATGGCACGCAATCTACTCTACA (SEQ ID NO:8) is a reverse primer, to be template with the total RNA of the extractive Dunaliella salina of ordinary method, carries out the RT-PCR amplification, clones, checks order with pcr amplification product according to a conventional method then.Result verification the exactness of complete encoding sequence of Dunaliella salina nitrate transport protein.
Dunaliella salina nitrate transport protein full length gene sequence is shown in SEQ ID NO:1, and wherein the frame position is the 1-1617 position.
atggccacat?cggccaaaga?gtccctggag?gtgcccctca?acgcagccac?cgctggcttc??????60
ggtgcgggca?tgccgggtta?cgacagggaa?aagtggggct?ttgacctgga?tggagagaac?????120
aaggccaagg?cgctcctgat?gtggaagctg?cagtctcccc?atgtccgcgc?ttttcatttg?????180
tcgtggatgt?tcttcttttc?cagcttcgtg?gccgcctttg?cgatggctgc?gcttgtgcct?????240
gtagttaggc?agaacctgga?cttgaccaag?gcagacctgg?gtgcctctgg?tatcacgact?????300
gtggtgggag?ccatcggagc?acgtgtggtc?attggtgctg?tctgtgacac?tgttggccca?????360
cgcatggcca?cctcgggcgt?gctgctgctc?atcgccccat?gcgtgttctg?tgcatccctg?????420
attgtggacc?gaggaggcat?cattgctgtg?cgcttcttca?tcggcgtcgg?cctgtgcatt?????480
tttgtctgca?accagttctg?ggctggcact?atgttcagcc?ccaactgtgt?gggcaccgtg?????540
aacgccacct?gcggaggctg?gggcaacctg?ggcggtggtg?ttacccagct?catcatgccc?????600
ctaatttaca?ccggcatcaa?gcagagcggc?gtgcctggct?tcactgcttg?gaggtggtcc?????660
ttcatggtcc?ctggtgccat?gttcctggtg?ctcgcttttg?gctgcctgtg?cttctctcaa?????720
gacgccccca?atggcagcta?ccgtgacatc?cgcaaagcca?ggacagtgca?agtggacggc?????780
aagaagacct?tccttgctgg?catcaggaac?tacaggacct?gggtgctcac?cctgaattat?????840
ggttactgct?ttggcgtgga?gctcaccatc?aacaacatca?tcgtggctta?catgtttgac?????900
cagttcggcc?tgagcattga?gattgcgggc?attgtgggag?ccgtgtttgg?cctcatgaac?????960
atcttctgcc?gctccatggg?cggcattgcg?tccgacgtgg?ctggcaagta?cttcggcatg????1020
cgcgggcgtc?tgtggaccta?cttctgcctg?caactgctgg?tgggcgtctt?ttcaatcgtc????1080
ctgggcactg?tggacgagac?tctgggaggc?accattgcag?tcatgatcat?cttctccgcg????1140
ttcgtacaga?gtgctgaggg?tgcctgctac?ggcgtcgtgc?cttttgtgtc?ccgccgatca????1200
tatggagtag?tggctgggtt?ggtgggcgct?ggaggcaaca?ctgggtcggc?tgtcacccaa????1260
gccctcttct?ttgctgacaa?tgagggtctg?aagatgacca?cccaagaagg?tctgcagtgg????1320
atgggagtga?tggtgatggc?tgtgacctgc?accatttctg?tgctccactg?gcctgcatgg????1380
ggcggcatgt?tcacgcctgc?caaggctggt?gccactgagg?aggactacta?cctggcagag????1440
tgggatgctg?aggaggtggc?tgccaacctg?cacatcccct?ccctgcgctt?tgccatggag????1500
agcagatcca?tgcgcggcaa?gaagttatta?gagacgtact?tggccaagga?ggaggggctg????1560
gagtgctcct?cgcaggatgc?caagaagacc?atagctagca?tccgtgagga?ctcaaactga????1620
(SEQ?ID?NO：1)
One of Dunaliella salina nitrate transport protein genes encoding constitutes nitrate transport protein by 539 amino acid, and its sequence is shown in SEQ ID NO:2.
MATSAKESLE?VPLNAATAGF?GAGMPGYDRE?KWGFDLDGEN?KAKALLMWKL?QSPHVRAFHL??????60
SWMFFFSSFV?AAFAMAALVP?VVRQNLDLTK?ADLGASGITT?VVGAIGARVV?IGAVCDTVGP?????120
RMATSGVLLL?IAPCVFCASL?IVDRGGIIAV?RFFIGVGLCI?FVCNQFWAGT?MFSPNCVGTV?????180
NATCGGWGNL?GGGVTQLIMP?LIYTGIKQSG?VPGFTAWRWS?FMVPGAMFLV?LAFGCLCFSQ?????240
DAPNGSYRDI?RKARTVQVDG?KKTFLAGIRN?YRTWVLTLNY?GYCFGVELTI?NNIIVAYMFD?????300
QFGLSIEIAG?IVGAVFGLMN?IFCRSMGGIA?SDVAGKYFGM?RGRLWTYFCL?QLLVGVFSIV?????360
LGTVDETLGG?TIAVMIIFSA?FVQSAEGACY?GVVPFVSRRS?YGVVAGLVGA?GGNTGSAVTQ?????420
ALFFADNEGL?KMTTQEGLQW?MGVMVMAVTC?TISVLHWPAW?GGMFTPAKAG?ATEEDYYLAE?????480
WDAEEVAANL?HIPSLRFAME?SRSMRGKKLL?ETYLAKEEGL?ECSSQDAKKT?IASIREDSN??????539
(SEQ?ID?N0：2)
Its amino acid is composed as follows:
Ala(A)58???10.8％????Arg(R)22???4.1％????Asn(N)17???3.2％
Asp(D)18??3.3％????Cys(C)15???2.8％????Gln(Q)14???2.6％
Glu(E)21??3.9％????Gly(G)64???11.9％???His(H)4????0.7％
Ile(I)30??5.6％????Leu(L)46???8.5％????Lys(K)18???3.3％
Met(M)22??4.1％????Phe(F)35???6.5％????Pro(P)15???2.8％
Ser(S)31??5.8％????Thr(T)32???5.9％????Trp(W)13???2.4％
Tyr(Y)14??2.6％????Val(V)50???9.3％
Hydrophobic residue accounts for 43.04%, and polar residues accounts for 22.8%, and basic aminoacids accounts for 7.4%, and acidic amino acid accounts for 7.2%.The protein molecular weight predictor is 57.8Kd, and iso-electric point is about 7.54.
Embodiment 2
The 26S Proteasome Structure and Function of Dunaliella salina nitrate transport protein
Dunaliella salina nitrate transport protein full length gene sequence and proteins encoded thereof are carried out Nucleotide and protein homology retrieval with blast program at Non-redundant GenBank+EMBL+DDBJ+PDB and Non-redundant GenBank cdstranslations+PDB+SwissProt+PIR database, and the nitrate transport protein (GenPept Accession No.AJ223296.2) that found that it and Chlamydomonas reinhardtii (Chlamydomonas reinhardtii) has 45% homogeny and 61% similarity.
Amino acid index structure territory (http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml) in Conserved Domain Database database with the Dunaliella salina nitrate transport protein, discovery is the longest frame protein conserved domain in aminoacid sequence, similar to the conserved domain of nitrate transport protein about protein sequence 49-401aa, it is generally acknowledged that the membranin of this family contains 12 membrane spaning domains.All there is this family member to distribute on prokaryotic organism and the Eukaryotic plasma membrane, so think that they have the common origin.
Score value
(bits) E value
COG2223，NarK，Nitrate/nitrite?transporter
gnl|CDD|11930????????????????????????????????????????
124???5e-29
[Inorganic?ion?tran...
COG2271，UhpC，Sugar?phosphate?permease
gnl|CDD|11977????????????????????????????????????????
47.1??7e-06
[Carbohydrate?transpor...
pfam00083，sugar_tr，Sugar(and?other)
gnl|CDD|16613????????????????????????????????????????
42.9??1e-04
transporter
The protein membrane spaning domain is analyzed: with amino acid index structure territory in blocks database (http://www.blocks.fhcrc.org) of Dunaliella salina nitrate transport protein.This protein has 12 membrane spaning domains, is respectively:
1???57-79???(23)
2???97-113??(17)
3???123-142?(20)
4???147-167?(21)
5???187-206?(20)
6???219-235?(17)
7???274-299?(26)
8???304-323?(20)
9???344-363?(20)
10??367-385?(19)
11??401-425?(25)
12??437-455?(19)
In this aminoacid sequence, there is the nitrate transport protein functional module, therefore can predicts the corresponding function that it has nitrate transport protein.
Embodiment 3
The structure of Dunaliella salina cDNA library large scale sequencing and chip of expression spectrum (High ThroughputSequencing of cDNA Library and Construction of Expression Microarray)
Clone in the Dunaliella salina cDNA library of gained is carried out sequencing, with measured target sequence construction expression spectrum chip.Clone's of order-checking gained is dissolved in 3 * SSC solution, uses Cartesian 7500 point sample instruments of Cartesian company and the silanization slide of TeleChem company, operate by the working instructions that company provides.Slide is used SDS, water treatment 10 minutes respectively again through hydration, drying, UV commissure behind the point sample, dries standby.
Embodiment 4
The screening of Dunaliella salina chip of expression spectrum (Screening of the Expression Microarry)
Use the NaCl solution of 0.5mol/l, 1.5mol/l, 4.5mol/l concentration to handle Dunaliella salina respectively after 2 hours, extract the Dunaliella salina mRNA after different salt concn are handled, use Cy3-dUTP and Cy5-dUTP mark respectively, hybridize with chip of expression spectrum, with the ScanArray 3000 scanning chips of General Scanning company, with the Genepix 3.01 software analysis fluorescence signal intensities of Axon company.
The chip of expression spectrum results of hybridization shows, has the growth salt concn of some expression of gene amounts and Dunaliella salina to be height correlation.Wherein, the nitrate transport protein gene is wherein one.Its concrete data are divided into three groups: first group is cy5 (4M), cy3 (1.5M) mark; Second group is cy5 (4M), cy3 (0.5M) mark; The 3rd group is cy5 (1.5M), cy3 (0.5M) mark.The mean value of the natural logarithm ln of three group echo fluorescence signal intensities (cy5/cy3) is 1.1, and this explanation is along with the variation of salt concn, and this expression of gene difference is about 3 times.
In sum, nitrate transport protein is a novel protein related to salt tolerance that does not appear in the newspapers.
Embodiment 5
The structure of Dunaliella salina nitrate transport protein expression vector
Complete encoding sequence according to Dunaliella salina nitrate transport protein gene, design amplifies complete coding and reads the primer of frame (corresponding to the most preceding 20bp among the SEQ ID NO:1 and last 20bp), behind pcr amplification, with Dunaliella salina nitrate transport protein gene cDNA clone to intermediate carrier pBluescript (available from Stratagene company), further be cloned into binary expression vector pBI 121 (available from Clontech company), under the prerequisite that guarantees the reading frame, identify good expression vector, in it being changed over to Agrobacterium (Agrobacteriumtumefaciens), obtain positive colony, be used for the transformation mode plant tobacco.
Embodiment 6
Utilize leaf dish method transformation of tobacco
Transformation of tobacco as follows:
(1) with the Agrobacterium positive colony of preparation among the embodiment 5 on the aseptic toothpick picking YEB selection flat board, is inoculated in 2M LYEB liquid (Sm
+, Kan
+), 28 ℃, 200rpm shaking culture 24-36 hour;
(2) under the room temperature 4, centrifugal 10 minutes of 000g;
(3) abandon supernatant, thalline suspends with the 1/2MS liquid nutrient medium, is diluted to 5-20 times of original volume, makes the OD of bacterium liquid
600About 0.5;
(4) get the aseptic blade of the tobacco of growth about two weeks, remove its main lobe arteries and veins, it is cut into about 1cm
2Square vanelets;
(5) blade is put into the bacterium liquid for preparing, soaked 2-5 minute, on aseptic filter paper, blot bacterium liquid;
(6) blade through infecting is put on the MS substratum 28 ℃ of dark cultivations 48 hours;
(7) blade is forwarded on the callus substratum (MS+6-BA 1.0mg/L+NAA 0.1mg/L+Kan 50mg/L+ carboxylic Bian penicillin 250mg/L), the formation of 7-15 days visible callus is cultivated in 25-28 ℃ of illumination down;
(8) visible differentiation bud grows after about 20 days, after the band bud is grown up, downcuts, and places on the root media (1/2MS+NAA 0.5mg/L+Kan 25mg/L) and carries out root culture, takes root about 2-7 days;
After treating well developed root system, plant is taken out, clean the solid medium that adheres to, move in the soil, just begun to treat to take off lens again behind the robust plant, cultivate in the greenhouse with lens cover several days with sterilized water.
PRELIMINARY RESULTS shows that the salt tolerance that changes the tobacco of Dunaliella salina nitrate transport protein gene over to is higher than the contrast tobacco.
Embodiment 7
The expression of nitrate transport protein
(1) expression vector establishment
According to the complete encoding sequence (SEQ ID NO:1) of Dunaliella salina nitrate transport protein gene, design amplifies the primer of complete coding frame
Forward primer is
5′CAGACAACATCCACTCCGCCATG3’(SEQ?ID?NO：7)
Reverse primer is:
5′CATGGCACGCAATCTACTCTACA3′(SEQ?ID?NO：8)
And on positive anti-primer, introduce BamH I and Xho I restriction enzyme site respectively.The full-length gene of Dunaliella salina nitrate transport protein gene is behind pcr amplification, be cloned into expression vector pRS426-CUP (available from Clontech company), guaranteeing to identify expression vector under the correct prerequisite of reading frame, change it over to model animals yeast saccharomyces cerevisiae (Saccharomyces cerevisiae).
(2) electrotransformation transformed saccharomyces cerevisiae
A. use that yeast saccharomyces cerevisiae list bacterium colony is in 2mL liquid YEPD substratum in the aseptic toothpick picking YEPD flat board, 28 ℃, the 200rpm shaking culture is spent the night.
B. change in the 200mLYEPD substratum 28 ℃ next day over to, the 200rpm shaking culture is between OD600=1.0～1.3.
C. with cell transfer 4000rpm to the 50mL centrifuge tube, 4 ℃ of centrifugal 10min abandon or adopt supernatant.
D. isopyknic deionized water is added in the centrifuge tube re-suspended cell, 4000rpm, 4 ℃ of centrifugal 10min.Abandon or adopt supernatant.
E. the deionized water with half volume adds in the centrifuge tube re-suspended cell, 4000rpm, 4 ℃ of centrifugal 10min.Abandon or adopt supernatant.
F. the 1M sorbyl alcohol with half volume adds in the centrifuge tube re-suspended cell, 4000rpm, 4 ℃ of centrifugal 10min.Abandon or adopt supernatant.
G. the 1M sorbyl alcohol with 500 μ L adds centrifuge tube.
H. with 100 μ L competence yeast cell and 100ng plasmid DNA mixing, be added to ice bath 20min in the 0.1cm electric shock cup, be positioned in the BioRed electroporation apparatus by 25 μ F the 1500V electric shock.
I. add 1mL 1M sorbyl alcohol then rapidly, behind the mixing part cell is coated dull and stereotyped (the no uridylic substratum) 30 ℃ of going up of selection and cultivated 3～6 days, thereby acquisition changes the yeast strain of nitrate transport protein over to.
The cell lysate that changes the yeast strain of nitrate transport protein over to is having a tangible nitrate transport protein band corresponding to about 58KDa place.
Embodiment 8
The separation of Dunaliella salina nitrate transport protein, purifying and determination of activity
1, proteic purifying
All chromatography processes are all carried out in the FPLC of Pharmacia company system (III type) in room temperature (about 20 ℃).
1.1 culture condition
The cultivation of Dunaliella salina is divided into three phases: 0.17M NaCl: successive illumination cultivation, 1 week; 0.5M NaCl: the inoculum size with 5% or 10% is seeded in the salt algae of fs on the new substratum, same culture conditions, 1 week; 1.0M NaCl: the salt algae of two-stage was connected on the substratum of 1.0M NaCl cultured continuously 5 days, during shaking table cultivate, periodicity of illumination is light: dark=16: 8h, intensity of illumination is 150umolm
-2S
-1, to lead to 5% CO in the process of cultivation
2The about 6L of culture cumulative volume.1.2 proteicly slightly carry
The algae of getting 1 week of cultivation gets the about 6g of fresh weight in the centrifugal collection of 4500 * g.Add 100mL A liquid (TDG buffer (pH6.9): 100mM Tris, 1mM DTT, 2.5% (v/v) glycerine).The ice-bath ultrasonic fragmentation, ultrasonic power 200W, each action time 8s, 30s acts on 10 times altogether at interval.4 ℃ of centrifugal 30min of 40000 * g get supernatant liquor as crude extract.
1.3PEG classification
At the PEG8000 liquid storage that does not stop slowly to add under the stirring condition 50%, to the PEG final concentration be 15%, leave standstill 30min.The centrifugal 30min of 40000 * g gets supernatant, adds MgCl
2To 10mmol/L, adding PEG liquid storage to final concentration again is 25%, leaves standstill 60min.Above all operations all carries out under ice bath.4 ℃ of centrifugal 30min of 40000 * g get precipitation and redissolve in 60mL A liquid, are used for the DEAE ion exchange chromatography.
1.4DEAE ion exchange chromatography
DEAE Sepharose Fast Flow post (10cm * 1.6cm) after A liquid balance, add extracting solution, flow velocity 1mL/min.The albumen that does not adsorb with 40mL A liquid flush away earlier behind the upper prop carries out 0～1.0mol/L NaCl linear gradient elution, flow velocity 1.5mL/min with 100mLA liquid to 100mL B liquid (A liquid+1.0mol/L NaCl) then.The nitrate transport protein active part is about the NaCl place of 0.24～0.3mol/L wash-out.
1.5Blue Sepharose CL-6B intends affinity chromatography
The nitrate transport protein liquid of collecting wash-out on the DEAE Sepharose Fast Flow post does not stop to add MgCl under the stirring condition at 4 ℃
2To 10mmol/L, slowly add PEG 8000 liquid storages again, to the PEG final concentration be 25%, leave standstill 60min.4 ℃ of centrifugal 30min of 40000 * g get precipitation and redissolve in 6mLA liquid.(2cm * 0.8cm), last sample flow velocity is 0 to the Blue Sepharose CL-6B post of crossing to A liquid balance on the extracting solution.Use C liquid (A liquid+5mmol/L NADH) wash-out again, elution flow rate 0.2mL/min.The extracting solution that collection elutes.
1.6QHP column chromatography
All solution are bled before the upper prop, filter, with A liquid balance QHP post.Extracting solution 10000 * g that Blue Sepharose chromatography is collected is centrifugal to remove upper prop behind the insolubles.Earlier wash post, with A liquid B liquid is carried out 0～1.0mol/L NaCl linear gradient in conjunction with staged ground wash-out, flow velocity 0.5mL/min then with 2mL A liquid.Nitrate transport protein elutes about 0.33mol/L NaCl place.
2, active mensuration
Carry out enzyme activity determination according to the method described in the reference (THE JOURNAL OF BIOLOGICAL CHEMISTRY, Vol.271 (4): 2088-2092,1996).The result shows that isolated nitrate transport protein has the nitrate transport activity.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
＜110〉Guangyao Biological Engineering Co., Ltd., Sichuan Univ.
＜120〉Dunaliella salina nitrate transport protein and encoding sequence thereof
<130>037215
<160>8
<170>PatentIn?version?3.1
<210>1
<211>1620
<212>DNA
＜213〉Dunaliella salina (Dunaliella salina)
<400>1
atggccacat?cggccaaaga?gtccctggag?gtgcccctca?acgcagccac?cgctggcttc???60
ggtgcgggca?tgccgggtta?cgacagggaa?aagtggggct?ttgacctgga?tggagagaac??120
aaggccaagg?cgctcctgat?gtggaagctg?cagtctcccc?atgtccgcgc?ttttcatttg??180
tcgtggatgt?tcttcttttc?cagcttcgtg?gccgcctttg?cgatggctgc?gcttgtgcct??240
gtagttaggc?agaacctgga?cttgaccaag?gcagacctgg?gtgcctctgg?tatcacgact??300
gtggtgggag?ccatcggagc?acgtgtggtc?attggtgctg?tctgtgacac?tgttggccca??360
cgcatggcca?cctcgggcgt?gctgctgctc?atcgccccat?gcgtgttctg?tgcatccctg??420
attgtggacc?gaggaggcat?cattgctgtg?cgcttcttca?tcggcgtcgg?cctgtgcatt??480
tttgtctgca?accagttctg?ggctggcact?atgttcagcc?ccaactgtgt?gggcaccgtg??540
aacgccacct?gcggaggctg?gggcaacctg?ggcggtggtg?ttacccagct?catcatgccc??600
ctaatttaca?ccggcatcaa?gcagagcggc?gtgcctggct?tcactgcttg?gaggtggtcc??660
ttcatggtcc?ctggtgccat?gttcctggtg?ctcgcttttg?gctgcctgtg?cttctctcaa??720
gacgccccca?atggcagcta?ccgtgacatc?cgcaaagcca?ggacagtgca?agtggacggc??780
aagaagacct?tccttgctgg?catcaggaac?tacaggacct?gggtgctcac?cctgaattat??840
ggttactgct?ttggcgtgga?gctcaccatc?aacaacatca?tcgtggctta?catgtttgac??900
cagttcggcc?tgagcattga?gattgcgggc?attgtgggag?ccgtgtttgg?cctcatgaac??960
atcttctgcc?gctccatggg?cggcattgcg?tccgacgtgg?ctggcaagta?cttcggcatg??1020
cgcgggcgtc?tgtggaccta?cttctgcctg?caactgctgg?tgggcgtctt?ttcaatcgtc??1080
ctgggcactg?tggacgagac?tctgggaggc?accattgcag?tcatgatcat?cttctccgcg??1140
ttcgtacaga?gtgctgaggg?tgcctgctac?ggcgtcgtgc?cttttgtgtc?ccgccgatca??1200
tatggagtag?tggctgggtt?ggtgggcgct?ggaggcaaca?ctgggtcggc?tgtcacccaa??1260
gccctcttct?ttgctgacaa?tgagggtctg?aagatgacca?cccaagaagg?tctgcagtgg??1320
atgggagtga?tggtgatggc?tgtgacctgc?accatttctg?tgctccactg?gcctgcatgg??1380
ggcggcatgt?tcacgcctgc?caaggctggt?gccactgagg?aggactacta?cctggcagag??1440
tgggatgctg?aggaggtggc?tgccaacctg?cacatcccct?ccctgcgctt?tgccatggag??1500
agcagatcca?tgcgcggcaa?gaagttatta?gagacgtact?tggccaagga?ggaggggctg??1560
gagtgctcct?cgcaggatgc?caagaagacc?atagctagca?tccgtgagga?ctcaaactga??1620
<210>2
<211>539
<212>PRT
＜213〉Dunaliella salina (Dunaliella salina)
<400>2
Met?Ala?Thr?Ser?Ala?Lys?Glu?Ser?Leu?Glu?Val?Pro?Leu?Asn?Ala?Ala
1???????????????5???????????????????10??????????????????15
Thr?Ala?Gly?Phe?Gly?Ala?Gly?Met?Pro?Gly?Tyr?Asp?Arg?Glu?Lys?Trp
20??????????????????25??????????????????30
Gly?Phe?Asp?Leu?Asp?Gly?Glu?Asn?Lys?Ala?Lys?Ala?Leu?Leu?Met?Trp
35??????????????????40??????????????????45
Lys?Leu?Gln?Ser?Pro?His?Val?Arg?Ala?Phe?His?Leu?Ser?Trp?Met?Phe
50??????????????????55??????????????????60
Phe?Phe?Ser?Ser?Phe?Val?Ala?Ala?Phe?Ala?Met?Ala?Ala?Leu?Val?Pro
65??????????????????70??????????????????75??????????????????80
Val?Val?Arg?Gln?Asn?Leu?Asp?Leu?Thr?Lys?Ala?Asp?Leu?Gly?Ala?Ser
85??????????????????90??????????????????95
Gly?Ile?Thr?Thr?Val?Val?Gly?Ala?Ile?Gly?Ala?Arg?Val?Val?Ile?Gly
100?????????????????105?????????????????110
Ala?Val?Cys?Asp?Thr?Val?Gly?Pro?Arg?Met?Ala?Thr?Ser?Gly?Val?Leu
115?????????????????120?????????????????125
Leu?Leu?Ile?Ala?Pro?Cys?Val?Phe?Cys?Ala?Ser?Leu?Ile?Val?Asp?Arg
130?????????????????135?????????????????140
Gly?Gly?Ile?Ile?Ala?Val?Arg?Phe?Phe?Ile?Gly?Val?Gly?Leu?Cys?Ile
145?????????????????150?????????????????155?????????????????160
Phe?Val?Cys?Asn?Gln?Phe?Trp?Ala?Gly?Thr?Met?Phe?Ser?Pro?Asn?Cys
165?????????????????170?????????????????175
Val?Gly?Thr?Val?Asn?Ala?Thr?Cys?Gly?Gly?Trp?Gly?Asn?Leu?Gly?Gly
180?????????????????185?????????????????190
Gly?Val?Thr?Gln?Leu?Ile?Met?Pro?Leu?Ile?Tyr?Thr?Gly?Ile?Lys?Gln
195?????????????????200?????????????????205
Ser?Gly?Val?Pro?Gly?Phe?Thr?Ala?Trp?Arg?Trp?Ser?Phe?Met?Val?Pro
210?????????????????215?????????????????220
Gly?Ala?Met?Phe?Leu?Val?Leu?Ala?Phe?Gly?Cys?Leu?Cys?Phe?Ser?Gln
225?????????????????230?????????????????235?????????????????240
Asp?Ala?Pro?Asn?Gly?Ser?Tyr?Arg?Asp?Ile?Arg?Lys?Ala?Arg?Thr?Val
245?????????????????250?????????????????255
Gln?Val?Asp?Gly?Lys?Lys?Thr?Phe?Leu?Ala?Gly?Ile?Arg?Asn?Tyr?Arg
260?????????????????265?????????????????270
Thr?Trp?Val?Leu?Thr?Leu?Asn?Tyr?Gly?Tyr?Cys?Phe?Gly?Val?Glu?Leu
275?????????????????280?????????????????285
Thr?Ile?Asn?Asn?Ile?Ile?Val?Ala?Tyr?Met?Phe?Asp?Gln?Phe?Gly?Leu
290?????????????????295?????????????????300
Ser?Ile?Glu?Ile?Ala?Gly?Ile?Val?Gly?Ala?Val?Phe?Gly?Leu?Met?Asn
305?????????????????310?????????????????315?????????????????320
Ile?Phe?Cys?Arg?Ser?Met?Gly?Gly?Ile?Ala?Ser?Asp?Val?Ala?Gly?Lys
325?????????????????330?????????????????335
Tyr?Phe?Gly?Met?Arg?Gly?Arg?Leu?Trp?Thr?Tyr?Phe?Cys?Leu?Gln?Leu
340?????????????????345?????????????????350
Leu?Val?Gly?Val?Phe?Ser?Ile?Val?Leu?Gly?Thr?Val?Asp?Glu?Thr?Leu
355?????????????????360?????????????????365
Gly?Gly?Thr?Ile?Ala?Val?Met?Ile?Ile?Phe?Ser?Ala?Phe?Val?Gln?Ser
370?????????????????375?????????????????380
Ala?Glu?Gly?Ala?Cys?Tyr?Gly?Val?Val?Pro?Phe?Val?Ser?Arg?Arg?Ser
385?????????????????390?????????????????395?????????????????400
Tyr?Gly?Val?Val?Ala?Gly?Leu?Val?Gly?Ala?Gly?Gly?Asn?Thr?Gly?Ser
405?????????????????410?????????????????415
Ala?Val?Thr?Gln?Ala?Leu?Phe?Phe?Ala?Asp?Asn?Glu?Gly?Leu?Lys?Met
420?????????????????425?????????????????430
Thr?Thr?Gln?Glu?Gly?Leu?Gln?Trp?Met?Gly?Val?Met?Val?Met?Ala?Val
435?????????????????440?????????????????445
Thr?Cys?Thr?Ile?Ser?Val?Leu?His?Trp?Pro?Ala?Trp?Gly?Gly?Met?Phe
450?????????????????455?????????????????460
Thr?Pro?Ala?Lys?Ala?Gly?Ala?Thr?Glu?Glu?Asp?Tyr?Tyr?Leu?Ala?Glu
465?????????????????470?????????????????475?????????????????480
Trp?Asp?Ala?Glu?Glu?Val?Ala?Ala?Asn?Leu?His?Ile?Pro?Ser?Leu?Arg
485?????????????????490?????????????????495
Phe?Ala?Met?Glu?Ser?Arg?Ser?Met?Arg?Gly?Lys?Lys?Leu?Leu?Glu?Thr
500?????????????????505?????????????????510
Tyr?Leu?Ala?Lys?Glu?Glu?Gly?Leu?Glu?Cys?Ser?Ser?Gln?Asp?Ala?Lys
515?????????????????520?????????????????525
Lys?Thr?Ile?Ala?Ser?Ile?Arg?Glu?Asp?Ser?Asn
530?????????????????535
<210>3
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>3
caacatcatc?gtggcttaca????????????????????????????????????????????????20
<210>4
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>4
ttcttgggtg?gtcatcttca????????????????????????????????????????????????20
<210>5
<211>25
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>5
aatggtgcct?cccagagtct?cgtcc??????????????????????????????????????????25
<210>6
<211>23
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>6
ccgccgatca?tatggagtag?tgg????????????????????????????????????????????23
<210>7
<211>23
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>7
cagacaacat?ccactccgcc?atg????????????????????????????????????????????23
<210>8
<211>23
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>8
catggcacgc?aatctactct?aca????????????????????????????????????????????23
Claims (10)
1. isolating Dunaliella salina nitrate transport protein is characterized in that this albumen is selected from down group:
(a) has the polypeptide of SEQ ID NO:2 aminoacid sequence;
(b) SEQ ID NO:2 aminoacid sequence is formed through replacement, disappearance or the interpolation of one or more amino-acid residues, and have the nitrate transport function by (a) polypeptides derived.
2. nitrate transport protein as claimed in claim 1 is characterized in that, this nitrate transport protein is the polypeptide with SEQ ID NO:2 aminoacid sequence.
3. isolating polynucleotide is characterized in that, it comprises a nucleotide sequence, and this nucleotide sequence is selected from down group:
(a) polynucleotide of coding Dunaliella salina nitrate transport protein as claimed in claim 1;
(b) with polynucleotide (a) complementary polynucleotide.
4. polynucleotide as claimed in claim 3 is characterized in that this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ IDNO:2.
5. polynucleotide as claimed in claim 3 is characterized in that, the sequence of these polynucleotide is selected from down a kind of of group:
(a) has the sequence of 1-1617 position among the SEQ ID NO:1;
(b) has the sequence of 1-1620 position among the SEQ ID NO:1.
6. a carrier is characterized in that, it contains the described polynucleotide of claim 3.
7. a genetically engineered host cell is characterized in that, it contains the described carrier of claim 6.
8. the preparation method of a peptide species is characterized in that, this method comprises:
(a) under conditions suitable for the expression, cultivate the described host cell of claim 7;
(b) from culture, isolate the Dunaliella salina nitrate transport protein.
9. method of improving plant salt endurance is characterized in that it comprises step:
(1) provide the Agrobacterium of carrying expression vector, described expression vector contains nitrate transport protein dna encoding sequence, and described nitrate transport protein is selected from down group: the polypeptide that (a) has SEQ ID NO:2 aminoacid sequence; (b) SEQ ID NO:2 aminoacid sequence is formed through replacement, disappearance or the interpolation of one or more amino-acid residues, and have the nitrate transport protein function by (a) polypeptides derived.
(2) vegetable cell or tissue or organ are contacted with Agrobacterium in the step (1), thereby make nitrate transport protein dna encoding sequence change vegetable cell over to, and be incorporated on the karyomit(e) of vegetable cell;
(3) select vegetable cell or tissue or the organ that changes nitrate transport protein dna encoding sequence over to;
(4) vegetable cell in the step (3) or tissue or neomorph are become plant.
10. method as claimed in claim 9 is characterized in that, this nitrate transport protein is the polypeptide with SEQID NO:2 aminoacid sequence.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200310109020 CN1623999A (en) | 2003-12-03 | 2003-12-03 | Salt Du's algal nitrate transfer protein and its code sequence |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200310109020 CN1623999A (en) | 2003-12-03 | 2003-12-03 | Salt Du's algal nitrate transfer protein and its code sequence |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1623999A true CN1623999A (en) | 2005-06-08 |
Family
ID=34758808
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200310109020 Pending CN1623999A (en) | 2003-12-03 | 2003-12-03 | Salt Du's algal nitrate transfer protein and its code sequence |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1623999A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102121026A (en) * | 2010-12-11 | 2011-07-13 | 郑州大学 | Method for constructing Dunaliella salina chloroplast transformation vector |
| CN101693892B (en) * | 2009-09-25 | 2012-11-07 | 上海大学 | Ammonia transport protein gene, protein coded by same and application thereof |
-
2003
- 2003-12-03 CN CN 200310109020 patent/CN1623999A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101693892B (en) * | 2009-09-25 | 2012-11-07 | 上海大学 | Ammonia transport protein gene, protein coded by same and application thereof |
| CN102121026A (en) * | 2010-12-11 | 2011-07-13 | 郑州大学 | Method for constructing Dunaliella salina chloroplast transformation vector |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1252273C (en) | DNA encoding plant deoxyhypusine synthase, plant eukaryotic intiation factor 5A, transgenic plants and method for controlling senescence and apoptosis in plants | |
| CN101037693A (en) | New CkNHX gene and shearing decorative gene CkNHXn, method for cultivating inverse-resistant plant | |
| CN1842592A (en) | Gene imparting redifferentiation ability of plant, and utilization of the same | |
| CN1289523C (en) | Paddy rice potassium, sodium ion transport gene and its application | |
| CN1807611A (en) | Alfalfa cysteine prolease and its coding gene and uses | |
| CN101033472A (en) | Transformed plant capable of producing polyglutamic acid | |
| CN1623999A (en) | Salt Du's algal nitrate transfer protein and its code sequence | |
| CN1566146A (en) | Paddy rice stalk extension gene, coded protein and application thereof | |
| CN1266163C (en) | Cotton verticillium wilt germ secreted exciton gene and its application | |
| CN1232530C (en) | Ethane cyclic amp receptor protein of wheat and its coding sequence | |
| CN1289664C (en) | EPSP synthase of variable halomonas high resistance glyphosate and its encoding sequence | |
| CN1303102C (en) | Method for diagnosing and curing alopecia utilizing the Rhor gene of human and rat and the encoding products | |
| CN1295334C (en) | Wheat antidisense related gene TaEDR1 and its application | |
| CN1769436A (en) | Nanjing bass 3-hydroxyl-3-methyl glutaryl coenzyme A reductase protein encoding sequence | |
| CN1546666A (en) | Bacterial leaf spot resistance related gene of rice, protein and its uses | |
| CN1252270C (en) | Taxaceae 3-hydroxy-3-methylpentadiacyl cozymase A synthetic zymoprotein coding sequence | |
| CN1216989C (en) | A novel penicillin G acylase and use thereof | |
| CN1281962C (en) | Tumor relevant secretory protein as a liver cancer marker and uses thereof | |
| CN1557952A (en) | Solanum lycopersicoides dun. S1Ve1 receptor protein encoding sequence and use thereof | |
| CN1760363A (en) | Coded sequence of reductase enzyme protein of eucommia 3-hydroxy-3-coenzyme of methyl glutaryl A | |
| CN100341891C (en) | Tanscription activating factor genes of candida albicans and their use | |
| CN1546665A (en) | Rice blast resistance related gene of wild rice, protein and uses | |
| CN1786158A (en) | Paddg rice anti reverse related gene trehalose-6-phosphoric acid phosphorylase gene and its application | |
| CN1320103C (en) | Yeast engineering bacterium of high productive glycerin | |
| CN1786027A (en) | Paddy rice anti contravariance related gene-anchor series repetitive protein gene and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |