CN1506467A - SCAR marker linked with the acidic character of peach fruit and its application - Google Patents
SCAR marker linked with the acidic character of peach fruit and its application Download PDFInfo
- Publication number
- CN1506467A CN1506467A CNA021553882A CN02155388A CN1506467A CN 1506467 A CN1506467 A CN 1506467A CN A021553882 A CNA021553882 A CN A021553882A CN 02155388 A CN02155388 A CN 02155388A CN 1506467 A CN1506467 A CN 1506467A
- Authority
- CN
- China
- Prior art keywords
- acid
- primer
- sequence
- detection kit
- component
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The SCAR marker linked with the acidic character of peach fruit has the nucleotide sequence of: 5'-TAACTAATCAATAAAAGAAAGAGTAATTGGAGTCAGACAGAGTAAGAACCACAACGTGTGAACAGTGAACATGAATTATATTTTGTTGAAAATCAATAAACAATGGGACGTTGTGAAGATCTATAAACAATAQGACCTGTAATATCCACTTCACATGGTTATGGTTTCATGAATT-3'. Hereby, PCR amplification primer and detection kit containing the primer are designed for peach molecular marker breeding, peach variety identification and seedling purity identification. The present invention has high repeatability, high reliability, low detection cost and saving in time and labor.
Description
Technical field
The present invention relates to the characteristic sequence amplification chain (Sequence Characterized AmplifiedRegion, SCAR) mark and the application in breeding, kind discriminating, seedling purity are identified thereof with the non-acid of peach fruit/acid shape.
Background technology
The non-acid of peach fruit/acid shape is the important factor that influences its local flavor and economic worth, also is an important measurement index of cross-breeding.At present, can only carry out behind the peach result for the research of this proterties, breeding process is long, efficient is low.Therefore, pressing for a kind of systems approach quickens this proterties is selected.
According to Yoshiba (1970), Monet reports such as (1979), that control the nonacid shape of peach fruit is a dominance key-gene D.(YoshidaM, 1970.Genetical studies on the fruit quality of peach varieties.Bull.Hort.Res Sta A9 Japon, 1-15; Monet R, 1979.Genetic transmission of the ` ' fruit sweetness ' character.Incidence on selection for quality.EucarpiaSymposiumTreeFruitBreeding (INRA ed), Angers, 273-276) Dirlewanger (1998) etc. once used the 63 strain F of Ferjalou Jalousia (anormally acid) and Fantasia (acid)
2Segregating population has been located D gene, with this assignment of genes gene mapping on the 5th linkage group, be respectively 3cM and 6cM with the genetic distance of two ends mark, (Dirlewanger E, Pronier V, Parvery C, Rothan C, Guye A, Monet R, 1998.Genetic linkage map ofpeach[Prunus persica (L.) Batsch] using morphological and molecularmarkers.TheorAppl Genet, 97:888-895) but up to the present also not with the report of the chain SCAR mark of D gene.
Summary of the invention
The purpose of this invention is to provide a kind of and the chain SCAR mark of the non-acid of peach fruit/acid shape.
Another object of the present invention provides the PCR primer sequence that is obtained by described SCAR mark.
The 3rd purpose of the present invention provides a kind of easy to use, highly sensitive detection kit that comprises above-mentioned primer.
For achieving the above object, the present invention is by the following technical solutions:
The characteristic sequence amplification chain with the non-acid of peach fruit/acid shape (this label has following nucleotide sequence for Sequence Characterized Amplified Region, SCAR) mark:
5′-TAACTAATCAATAAAAGAAAGAGTAATTGGAGTCAGACAGAGTAAGAACCACAACGTGTGAACAGTGAACATGAATTATATTTTGTTGAAAATCAATAAACAATGGGACGTTGTGAAGATCTATAAACAATAQGACCTGTAATATCCACTTCACATGGTTATGGTTTCATGAATT-3′。This mark obtains by the AFLP technology, be initially one with the chain AFLP mark of the acid shape of fruit, change into the SCAR mark after, show codominance, therefore, this sequence is and non-acid of peach fruit or the chain SCAR mark of acid shape.
According to PCR specific amplification primer described and the characteristic sequence amplification label design that the non-acid of peach fruit/acid shape is chain.
Described primer has following sequence:
D1??5′-AAA?GAA?AGA?GTA?ATT?GGA?GTC?AG-3′；
D2??5′-CCA?TGT?GAA?GTG?GAT?ATT?ACA?GG-3′。
A kind of detection kit that is used to detect the non-acid of peach fruit/acid shape, it contains described PCR specific amplification primer.
Described test kit comprises following component:
Component I reaction buffered soln 630 μ l;
Component I I TaqDNA polysaccharase 100U
Component III aseptic double-distilled water (ddH
2O) 1.25ml.
Described component I contains 50mMKCl, 10mM Tris-Cl (pH9.0), 0.1%TritonX-100,1.5mM Mg
2+, the positive strand primer D1 of 0.375 μ M, 0.375 μ M minus strand primer D2 and 200 μ M dNTP.
The concentration of described component I I Taq archaeal dna polymerase is 5U/ μ l.
The sequence of described positive strand primer D1 is: 5 '-AAA GAA AGA GTA ATT GGA GTC AG-3 '.
The sequence of described minus strand primer D2 is: 5 '-CCA TGT GAA GTG GAT ATT ACA GG-3 '.
Advantage of the present invention is: the present invention is the first SCAR mark chain with the non-acid of peach fruit/acid shape that transforms successfully, and the linkage distance of this mark and non-acid/acid shape only is 2.9cM, can be widely used in the breeding of peach molecular marker assisted selection, the discriminating of peach kind and seedling purity and identify.The present invention can carry out seedling stage to individuality by the special primer pcr amplification and identify, has improved breeding efficiency greatly, has shortened breeding process.The detection kit that contains primer of the present invention is easy to use, good reproducibility, and the reliability height, testing cost is low, and is time saving and energy saving.
Figure of description
Fig. 1 is the qualification result of PCR primer to the filial generation individual plant
Embodiment
Embodiment 1, with the acquisition of chain amplified fragment length polymorphism (AFLP) mark of acid shape
One, material: the reciprocal cross offspring of 69 strains " capital jade " and " delicious food ", cultivates by this.
Two, method: (Amplified Fragment Length Polymorphism, AFLP) molecular marking technique screens the non-acid of peach fruit/acid shape to utilize amplified fragment length polymorphism.Aflp analysis is with reference to the AFLP of GIBCO BRL company
TMThe test kit specification sheets carries out, and change is arranged slightly.
1, extracting genome DNA
(1) get put into about young leaflet tablet 0.2g 1.5ml from increasing, add liquid nitrogen with the rapid grind into powder of little pestle, CTAB damping fluid (the 2%CRAB (hexadecyl-trimethylammonium-brometo de amonio) that adds 0.7ml immediately, 1.4mol/L NaCl (sodium-chlor), (0.02mol/LEDTA ethylenediamine tetraacetic acid (EDTA)), 0.1mol/L Tris-HCl (three (methylol) aminomethane, pH8.0), 2%PVP (polyvinylpyrrolidone)) and the beta-mercaptoethanol of 2% damping fluid volume, mixing, 65 ℃ of water-bath 30min, mixing 2～3 times turns upside down in this process, 7000r/min then, centrifugal 10min;
(2) get supernatant liquor, add isopyknic CI (chloroform: primary isoamyl alcohol=24: 1), the mixing that turns upside down gently, 12000r/min, centrifugal 10min;
(3) repeating step (2) once;
(4) get supernatant liquor, add the dehydrated alcohol of 2 times of volumes of the NaAc (sodium-acetate) of 0.1 times of volume and precooling, and mixing gently ,-20 ℃ leave standstill the centrifugal 10min of 12000r/min after half an hour;
(5) abandon supernatant, will precipitate with 75% washing with alcohol twice natural air drying one hour;
(6) add the dissolving of an amount of TE (10mMTris-HCl (pH=8.0), lmM EDTA) damping fluid, and add the RNase (ribonuclease A) of 0.2 μ l10mg/ml;
(7) preserve standby with putting into-20 ℃ of refrigerators after the concentration of 0.7% sepharose and UV spectrophotometer measuring DNA and the purity.
2, enzyme is cut genomic dna: add 6.5 μ l ddH in the 0.5mL Eppendorf tube
2O, 2.5 μ l, 5 * reaction buffer, 2.5 μ l template DNAs (containing the about 125ng of DNA), EcoRI and MseI restriction endonuclease 1 μ l are to cumulative volume 12.5 μ l.The centrifugal 5s of 12000rpm, thorough mixing, 37 ℃ of temperature are bathed 2h, 70 ℃ of 15min, inactivator.
3, manual splice connects: among the DNA after enzyme is cut, add 12 μ l joints and connect liquid, 0.5 μ l T
4Dna ligase, the centrifugal 5s of 12000rpm, thorough mixing, 20 ℃ connect 2h (or spending the night), 70 ℃ of 15min, inactivator.Connect liquid with the TE damping fluid by 1: 10 dilution proportion, diluent promptly can be used as the template that pre-expansion increases reaction.
4, pre-amplification: add the template DNA 2.5 μ l of dilution in the 25.5 μ l reaction systems, the primer mixed solution 20 μ l that increase in advance, 10 * PCR damping fluid, 2.5 μ l (contain Mg
2+), Taq enzyme 0.5 μ l (1U/ μ l).The reaction amplification condition is 94 ℃, 30s; 56 ℃, 60s; 72 ℃, 60s, 25 circulations.Pre-expansion volume increase thing is by 1: 20 dilution proportion, as the template of selective amplification.
5, selective amplification: add EcoRI primer (27.8ng/ μ l) 0.18 μ l in the 20 μ l reaction systems, MseI primer (6.7ng/ μ l) 4.48 μ l, 10 * PCR damping fluid, 2.5 μ l (contain Mg
2+) 2 μ l, Taq enzyme 0.2 μ l (5U/ μ l), template DNA 5 μ l, ddH
2O 8.14 μ l, EcoRI primer and Mse I primer 3 ' end is respectively 3 selectivity bases.Amplification condition is: 94 ℃, and 30s; 65 ℃, 30s; 72 ℃, 60s, 1 circulation; 94 ℃, 30s; 65 ℃, 30s; 72 ℃, 60s (each cycle annealing temperature reduces by 0.7 ℃), 12 circulations; 94 ℃, 30s; 56 ℃, 30s; 72 ℃, 60s, 23 circulations.Amplified production is electrophoresis on 6% polyacrylamide gel, and silver dyes colour developing.
Three, result: 31 strain The Characters are that (E represents the EcoRI primer to combination of primers E+AT/M+CTA, and AT is the selectivity base among the offspring of acid; M is the MseI primer, and CTA is the selectivity base) in 29 strains, amplify specific fragment, 38 strain The Characters are then not have this specific fragment among the sweet offspring.
Four, conclusion: obtain and the chain specific fragment of acid shape, the molecular weight size is 175bp.
Embodiment 2, with the acquisition and the evaluation of the chain SCAR mark of non-acid/acid shape
One, material: the reciprocal cross offspring of 69 strains " capital jade " and " delicious food ".
Two, method:
1, segmental recovery: the specific fragment that pcr amplification goes out is given birth to the centrifugal DNA glue recovery of the UNIQ-5 post test kit recovery that the worker produces with Shanghai behind 1.2% agarose gel electrophoresis, operation is carried out according to the test kit explanation.
2, ligation: the ligation volume is 10 μ l, wherein contain recovery DNA 5 μ l (20～50ng), pUCm-T Vector (Shanghai give birth to worker produce) 1 μ l (50ng), T4 ligase enzyme 1 μ l connects damping fluid 1 μ l, 50%PEG 1 μ l, aqua sterilisa 1 μ l.Behind the abundant mixing of reaction mixture, in 16～20 ℃ cryogenic thermostat water-bath, connect 5 hours or spend the night.
3, transform:
(1) from-70 ℃ of refrigerators, gets 200 μ l bacillus coli DH 5 alphas (preserve in this laboratory) competent cell (or prepared fresh), under the room temperature it is thawed, place on ice immediately after thawing.
(2) add 10 μ l and connect mixture, place 30min after shaking up on ice.
(3) at 42 ℃ of following thermal shock mixture 90s, be transferred to cooled on ice 2～3min behind the thermal shock fast.
(4) in centrifuge tube, add 800 μ lLB substratum, behind 37 ℃ of 200rpm vibration 90min, concentrate bacterium liquid, remove supernatant, get on the flat board that 200 μ l transformation mixtures are laid on a previously prepd solid LB substratum.Contain the X-gal (5-bromo-4-chloro-3-indoles-β-D-galactoside) of 40 μ l 20mg/ml and the IPTG (isopropyl-) of 4ul 200mg/ml on the flat board, the Amp of 100 μ g/ml (penbritin).With coated flat board at room temperature face up place 30min after, be inverted dull and stereotypedly, put into 37 ℃ of constant incubators and cultivated 16～24 hours.Treat blue look bacterium colony manifest clear after, the picking white colony places the LB liquid nutrient medium about 30 nl, 37 ℃ of 200rpm overnight incubation are to mid-log phase.Use the alkaline lysis method of extracting plasmid, identify, the fresh bacterium liquid of positive colony is delivered to Shanghai give birth to the order-checking of worker company with the method that PCR and enzyme are cut.With MAPMAKER computed in software genetic distance.
Three, result: obtained the sequence of specific fragment, this sequence is:
5′-TAACTAATCAATAAAAGAAAGAGTAATTGGAGTCAGACAGAGTAAGAACCACAACGTGTGAACAGTGAACATGAATTATATTTTGTTGAAAATCAATAAACAATGGGACGTTGTGAAGATCTATAAACAATAQGACCTGTAATATCCACTTCACATGGTTATGGTTTCATGAATT-3′。
Four, conclusion: the SCAR mark lengths is 145bp, with non-acid/acid shape distance be 2.9cM, be the codominant marker.
Embodiment 3, the PCR primer sequence that obtains by the SCAR mark
One, method: by PC gene software design primer.
Two, design of primers principle:
1, the per-cent of G+C base pair should be similar as far as possible in two primers;
2, tangible secondary structure is avoided having in primer inside;
3, the complementary sequence that do not have between two primers is avoided forming " primer dimer ";
4, the pairing of primer and target dna fragment must be accurate, strict, especially 3 ' end;
5, special primer should have certain annealing temperature (being not less than 50 ℃) and certain length (being no less than 20 bp).
Three, result: designed special primer according to the SCAR flag sequence, its sequence is:
D1??5′-AAA?GAA?AGA?GTA?ATT?GGA?GTC?AG-3′；
D2??5′-CCA?TGT?GAA?GTG?GAT?ATT?ACA?GG-3′。
The advantage of this primer: the band of amplification is clear, and amplification is stable, good reproducibility.
Embodiment 4, PCR primer sequence are used to detect the non-acid of peach fruit/acid shape
One, material: the reciprocal cross offspring of 69 strains " capital jade " and " delicious food ";
D1/D2 special primer combination (it is synthetic to give birth to the worker by Shanghai)
Two, method: utilize the combination of D1/D2 special primer that 69 strain offsprings are carried out pcr amplification and identify, and mensuration can be dripped acid number.
1, amplification condition: the pcr amplification system is 20 μ l, 10 * buffer, 2 μ l wherein, 25mM MgCl
21.2 μ l, 2.5mMdNTP1.6 μ l, the positive strand primer D1 0.75 μ l of 10 μ M, 10 μ M minus strand primer D2,0.75 μ l, the about 20ng of template DNA, the Taq enzyme 0.2 μ l of 5U/ μ l, aseptic ddH
2O 12.5 μ l.
2, the PCR cycling program is 94 ℃, 4min; 94 ℃, 45s; 58 ℃, 1min; 72 ℃, 2min; 72 ℃, 5min; Totally 35 circulations.
3, amplified production electrophoresis on 3% Agrose gel, EB dyeing.
Three, result: see Table 1.Can drip determination of acid value and show that fruit properties shows as non-acid, only amplifies the band of about 175bp of molecular weight; Fruit properties shows as acid, amplifies two bands, and molecular weight is respectively about 175bp and 145bp.
As shown in Figure 1, swimming lane: 1,2,3,4,5,6,7,8 for The Characters is the offspring of non-acid, swimming lane: 10,11,12,13,14,15,16,17 for The Characters is the offspring of acid, and 15 is crossover (proterties and bands of a spectrum are inconsistent, and this individual plant The Characters is acid, but does not amplify specific band).
Table one, utilize D1/D2 special primer combination that 69 strain offsprings are carried out the pcr amplification qualification result
| The individual plant numbering | Can drip sour % | Banding pattern | The individual plant numbering | Can drip sour % | Banding pattern | The individual plant numbering | Can drip sour % | Banding pattern |
| ??4-13 | ??0.1815 | ????0 | ??3-16 | ??0.2986 | ????0 | ??3-37 | ??0.6356 | ????1 |
| ??3-34 | ??0.1991 | ????0 | ??4-26 | ??0.2986 | ????0 | ??4?40 | ??0.6399 | ????1 |
| ??4-25 | ??0.209 | ????0 | ??3-19 | ??0.3128 | ????0 | ??4-17 | ??0.6541 | ????1 |
| ??4-28 | ??0.2204 | ????0 | ??4-10 | ??0.3128 | ????0 | ??4-11 | ??0.6825 | ????1 |
| ??4-43 | ??0.2332 | ????0 | ??3-4 | ??0.3128 | ????0 | ??3-11 | ??0.7209 | ????1 |
| ??3-9 | ??0.2333 | ????0 | ??3-42 | ??0.3214 | ????0 | ??4-20 | ??0.7309 | ????1 |
| ??4-5 | ??0.2333 | ????0 | ??3-6 | ??0.3241 | ????0 | ??4-16 | ??0.7679 | ????1 |
| ??4-19 | ??0.2417 | ????0 | ??3-36 | ??0.3271 | ????0 | ??3-3 | ??0.7679 | ????1 |
| ??4-9 | ??0.2463 | ????0 | ??4-6 | ??0.3271 | ????0 | ??4-34 | ??0.7935 | ????1 |
| ??3-38 | ??0.256 | ????0 | ??3-22 | ??0.3384 | ????0 | ??3-32 | ??0.8037 | ????1 |
| ??4-30 | ??0.256 | ????0 | ??3-7 | ??0.3629 | ????0 | ??4-12 | ??0.8105 | ????1 |
| ??3-27 | ??0.2574 | ????0 | ??4-33 | ??0.4266 | ????0 | ??3-5 | ??0.839 | ????1 |
| ??4-15 | ??0.2645 | ????0 | ??3-12 | ??0.4266 | ????1 | ??4-31 | ??0.8532 | ????1 |
| ??3-15 | ??0.2702 | ????0 | ??3-33 | ??0.4773 | ????0 | ??4-37 | ??0.8532 | ????1 |
| ??3-30 | ??0.2722 | ????0 | ??4-7 | ??0.4977 | ????1 | ??3-39 | ??0.9812 | ????1 |
| ??3-20 | ??0.2722 | ????0 | ??3-41 | ??0.5176 | ????1 | ??3-8 | ??0.2138 | ????0 |
| ??4-42 | ??0.2844 | ????0 | ??4-39 | ??0.2574 | ????0 | ??3-43 | ??0.2432 | ????0 |
| ??4-35 | ??0.2844 | ????0 | ??3-18 | ??0.5703 | ????1 | ??4-38 | ??0.1972 | ????0 |
| ??3-1 | ??0.2844 | ????0 | ??3-25 | ??0.583 | ????1 | ??3-10 | ??0.6996 | ????1 |
| ??3-13 | ??0.2844 | ????0 | ??4-14 | ??0.583 | ????0 | ??3-14 | ??0.5307 | ????1 |
| ??4-21 | ??0.2844 | ????0 | ??4-36 | ??0.5972 | ????1 | ??3-23 | ??0.5863 | ????1 |
| ??3-21 | ??0.2852 | ????0 | ??3-17 | ??0.6299 | ????1 | ??3-24 | ??0.687 | ????1 |
| ??4-27 | ??0.2852 | ????0 | ??3-40 | ??0.6352 | ????1 | ??4-32 | ??0.7358 | ????1 |
Annotate: 0 expression amplifies a band; 1 expression amplifies two bands; Wherein 3-33 and 4-14 are crossover
Four, conclusion: utilize this special primer to carry out pcr amplification, can be used as the effective ways that the non-acid of peach fruit/acid shape is identified.
The present invention can carry out seedling stage to individuality by the special primer pcr amplification and identify, improves breeding efficiency greatly, shortens breeding process.This mark can be widely used in the breeding of peach molecular marker assisted selection, the peach kind is differentiated and seedling purity is identified.
The test kit of embodiment 5, the non-acid of detection peach/acid shape
One, the component of detection kit:
Contain the detection kit of the nonacid shape SCAR of peach fruit mark special primer, it comprises the various components of following content:
Component I buffer solution (reaction buffer) 630 μ l
Component I I Taq DNA Polymerase (Taq archaeal dna polymerase) (5U/ μ l) 100U
Component III ddH
2O (aseptic double-distilled water) 1.25ml
Wherein component I contains: (50mMKCl, 10mM Tris-Cl (pH9.0), 0.1%TritonX-100,1.5mM Mg
2+, the positive strand primer D1 of 0.375 μ M, 0.375 μ M minus strand primer D2,200 μ M dNTP)
Two, using method:
In 20 μ l PCR reaction detection systems, add 6.3 μ l buffer solution, 1U Taq DNA Polymerase, 12.5 μ lddH
2O and 1 μ l (about 20ng) template DNA (extracting with reference to the extracting method among the embodiment 1), increase with following PCR cycling program: 94 ℃, 4min; 94 ℃, 45s; 58 ℃, 1min; 72 ℃, 2min; 72 ℃, 5min; Totally 35 circulations.Amplified production is electrophoresis on 3% Agrose gel, EB dyeing.
Three, specification: this detection kit can be carried out 100 secondary responses.
Advantage: this detection kit is easy to use, and amplification method is simple, good reproducibility, reliability height.Testing cost is low, and is time saving and energy saving.
Sequence table
＜110〉Inst. of Forestry ﹠ Fruit Tree, Beijing City Academy of Agricultural ﹠. Forestry
＜120〉with chain SCAR mark and the application thereof of the non-acid of peach fruit/acid shape
<130>
<160>3
<170>PatentIn?version?3.1
<210>1
<211>175
<212>DNA
＜213〉Rosaceae Prunus cultivation peach kind [Prunus persica (L.) Batsch.]
<400>1
taactaatca?ataaaagaaa?gagtaattgg?agtcagacag?agtaagaacc?acaacgtgtg????60
aacagtgaac?atgaattata?ttttgttgaa?aatcaataaa?caatgggacg?ttgtgaagat????120
ctataaacaa?Taqgacctgt?aatatccact?tcacatggtt?atggtttcat?gaatt?????????175
<210>2
<211>23
<212>DNA
＜213〉artificial sequence＜400〉2
aaagaaagag?taat?tggagt?cag???????????????????????????????????????????23
<210>3
<211>23
<212>DNA
＜213〉artificial sequence
<400>3
ccatgtgaag?tggatat?tac?agg?????????????????????????????????????????????????23
Claims (9)
1, with the non-acid of peach fruit/acid shape chain characteristic sequence amplification (Sequence Characterized Amplified Region, SCAR) mark is characterized in that: this label has following nucleotide sequence:
5′-TAACTAATCAATAAAAGAAAGAGTAATTGGAGTCAGACAGAGTAAGAACCACAACGTGTGAACAGTGAACATGAATTATATTTTGTTGAAAATCAATAAACAATGGGACGTTGTGAAGATCTATAAACAATAQGACCTGTAATATCCACTTCACATGGTTATGGTTTCATGAATT-3′。
2, the PCR specific amplification primer of the chain characteristic sequence amplification label of the according to claim 1 and non-acid of peach fruit/acid shape design.
3, PCR specific amplification primer according to claim 2, it is characterized in that: described primer has following sequence:
D1??5′-AAA?GAA?AGA?GTA?ATT?GGA?GTC?AG-3′：
D2??5′-CCA?TGT?GAA?GTG?GAT?ATT?ACA?GG-3′。
4, a kind of detection kit that is used to detect the non-acid of peach fruit/acid shape is characterized in that it contains claim 2 or 3 described PCR specific amplification primers.
5, detection kit according to claim 4 is characterized in that: described test kit comprises following component
Component I reaction buffered soln 630 μ l;
Component I IT aqDNA polysaccharase 100U;
Component III aseptic double-distilled water (ddH
2O) 1.25ml.
6, detection kit according to claim 5 is characterized in that: described component I contains 50mMKCl, 10mM Tris-Cl (pH9.0), 0.1%Triton X-100,1.5mM Mg
2+, the positive strand primer D1 of 0.375 μ M, 0.375 μ M minus strand primer D2 and 200 μ MdNTP.
7, detection kit according to claim 5 is characterized in that: the concentration of described component I I Taq archaeal dna polymerase is 5U/ μ l.
8, detection kit according to claim 6 is characterized in that: the sequence of described positive strand primer D1 is:
5′-AAA?GAA?AGA?GTA?ATT?GGA?GTC?AG-3′。
9, detection kit according to claim 6 is characterized in that: the sequence of described minus strand primer D2 is:
5′-CCA?TGT?GAA?GTG?GAT?ATTACA?GG-3′。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB021553882A CN1202249C (en) | 2002-12-11 | 2002-12-11 | SCAR marker linked with the acidic character of peach fruit and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB021553882A CN1202249C (en) | 2002-12-11 | 2002-12-11 | SCAR marker linked with the acidic character of peach fruit and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1506467A true CN1506467A (en) | 2004-06-23 |
| CN1202249C CN1202249C (en) | 2005-05-18 |
Family
ID=34235886
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB021553882A Expired - Fee Related CN1202249C (en) | 2002-12-11 | 2002-12-11 | SCAR marker linked with the acidic character of peach fruit and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1202249C (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102242208A (en) * | 2011-07-05 | 2011-11-16 | 福建出入境检验检疫局检验检疫技术中心 | SCAR-PCR identification method of Agaricus bisporus No. 333 strain |
| CN105132562A (en) * | 2015-09-15 | 2015-12-09 | 中国农业科学院郑州果树研究所 | Molecular marker and primer pair for authenticating non-sour property of peach fruit, and application of molecular marker and primer pair |
-
2002
- 2002-12-11 CN CNB021553882A patent/CN1202249C/en not_active Expired - Fee Related
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102242208A (en) * | 2011-07-05 | 2011-11-16 | 福建出入境检验检疫局检验检疫技术中心 | SCAR-PCR identification method of Agaricus bisporus No. 333 strain |
| CN102242208B (en) * | 2011-07-05 | 2013-02-13 | 福建出入境检验检疫局检验检疫技术中心 | SCAR-PCR identification method of Agaricus bisporus No. 333 strain |
| CN105132562A (en) * | 2015-09-15 | 2015-12-09 | 中国农业科学院郑州果树研究所 | Molecular marker and primer pair for authenticating non-sour property of peach fruit, and application of molecular marker and primer pair |
| CN105132562B (en) * | 2015-09-15 | 2018-04-13 | 中国农业科学院郑州果树研究所 | For identifying molecular labeling, primer pair and its application of the non-acid character of Peach fruits |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1202249C (en) | 2005-05-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107502663B (en) | Channel catfish microsatellite family identification method | |
| CN112646917B (en) | SNP molecular marker related to Chinese cabbage flower color characters, detection primer, detection kit and application thereof | |
| CN111304337B (en) | SRAP molecular marker, kit and method for identifying pelteobagrus fulvidraco, pelteobagrus vachelli and filial generation and application | |
| CN116356038A (en) | Breeding method for screening Fugu rubripes individuals with rapid growth performance | |
| CN108753987A (en) | A kind of method of the general microsatellite Multiplex fluorescent PCR of silver carp flathead | |
| CN105177143A (en) | Method for identifying hippocampus kelloggi family by virtue of microsatelite | |
| CN112746116B (en) | Litopenaeus vannamei female DNA label sequence, primer and application thereof in sex identification | |
| CN107475414B (en) | Method for screening parent oysters with high glycogen content | |
| CN102586451B (en) | Method for matching and breeding jian carps | |
| CN117265168A (en) | Molecular marker related to protein content in soybean and application thereof | |
| CN1202249C (en) | SCAR marker linked with the acidic character of peach fruit and its application | |
| CN107988410A (en) | Identify molecular labeling, identification method and the application of rice blast resistant gene Pita | |
| CN108531642B (en) | SSR molecular markers for identifying corn varieties and application thereof | |
| CN102643914A (en) | Method for detecting depression sheep fecundity | |
| CN113832251B (en) | SNP locus combination for detecting tomato mosaic virus resistance and application thereof | |
| Kyaligonza et al. | Identification of F1 cassava (Manihot esculenta Crantz) progeny using microsatellite markers and capillary electrophoresis | |
| CN108841983A (en) | A kind of SSR primer of sugarcane overall length transcript profile data large-scale development | |
| CN113981103A (en) | Microsatellite primer pair for parent-child identification of macrobrachium rosenbergii microsatellites, detection kit and identification method | |
| CN108913784B (en) | Detection method of EC12 SNP marker of exopalaemon carinicauda | |
| CN108411022B (en) | EST-SSR labeled primer developed based on Sophora japonica transcriptome sequence and application | |
| CN105483281A (en) | SNP molecular marker for identifying Shanghai colorful waxy corn NO.1 and identifying method thereof | |
| CN111593129A (en) | Primer for identifying zander family and method for identifying zander family | |
| CN116042843B (en) | Marking kit for parent identification of procambarus clarkia based on four-base microsatellite marking and application method | |
| CN113736906B (en) | SNP locus combination for detecting verticillium wilt resistance of tomatoes and application thereof | |
| CN107034297B (en) | Molecular marker related to growth traits of meat ducks and application thereof, nucleic acid combination and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |