CN102586451B

CN102586451B - Method for matching and breeding jian carps

Info

Publication number: CN102586451B
Application number: CN2012100607072A
Authority: CN
Inventors: 李建林; 俞菊华; 唐永凯; 李红霞
Original assignee: Freshwater Fisheries Research Center of Chinese Academy of Fishery Sciences
Current assignee: Freshwater Fisheries Research Center of Chinese Academy of Fishery Sciences
Priority date: 2012-03-09
Filing date: 2012-03-09
Publication date: 2013-09-04
Anticipated expiration: 2032-03-09
Also published as: CN102586451A

Abstract

The invention relates to a method for matching and breeding jian carps. The method comprises the following steps of: sampling blood or fin rays of a jian carp breeding population to extract genome DNA; detecting the genotype of SNPs (Single Nucleotide Polymorphisms) by a PCR-RFLP (Polymerase Chain Reaction-Restriction Fragment Length Polymorphism) method constructed by taking the extracted genomeDNA as a template according six SNP sites related to jian carp weight increment; carrying out genotype determination by using a sepharose gel electrophoresis enzyme slitting strip; selecting individuals containing more than four genotypes with rapid weight increment as candidate parents; carrying out digital treatment on the candidate parents by using the PCR-RFLP sepharose gel electrophoresis enzyme slitting strip; analyzing by using genetic analysis software to obtain genetic distances between every two individuals; constructing an evolutionary tree; and selecting an individual which has a larger genetic distance and better gonad development and can enrich more than four genotypes with rapid weight increment. The method is helpful to improving the production performance of jian carps, avoiding inbreeding and accelerating the breeding process of jian carps.

Description

A kind of method of jian carp combo breeding

Technical field

The invention belongs to fish molecular mark field, relate to a kind of method of jian carp combo breeding.

Background technology

Jian carp (Cyprinus carplo vat.jian) has that growth is fast, build is good, Steel Gray, advantages such as the meat meat flavour is good, feed conversion rate is high, adaptability high-output stress-resistance, it is by family selective breeding, and the comprehensive breeding technology that multiple cross and gynogenesis combine is cultivated a carp kind of successful stabilization characteristics of genetics.Though jian carp has more comprehensive good character, because expansion and the raising technology of the face of breed are lack of standardization, make jian carp the inbreeding depression phenomenon occur, diminish as decreased growth, disease resistance decline, sexual maturity individuality etc.Molecular marker assisted selection, be following assisting of molecular genetic marker, comprehensive utilization genetic marker information, individual amount proterties information, genetic distance etc. are matched parental combination by linkage analysis, can improve production performance, avoid inbreeding, can shorten breeding process.

Summary of the invention

The purpose of this invention is to provide a kind of method of jian carp combo breeding, help to improve the jian carp production performance, avoid inbreeding, keep higher genetic diversity, in jian carp breeding and germplasm protection, great using value is arranged.

To achieve these goals, the technical solution used in the present invention is: a kind of method of jian carp combo breeding, it is characterized in that, and comprise the steps:

(1) to jian carp reproductive population blood sampling or fin ray, adopt the DNA extraction method to extract genomic dna;

(2) according to 6 SNP sites relevant with jian carp weightening finish, be template with the genomic dna of step (1), structure PCR-RFLP method is carried out genotype detection to its SNPs;

(3) select to contain 4～6 very fast genotypic individualities of weightening finish as the candidate parent;

(4) to candidate parent PCR-RFLP method electrophoresis detection enzyme slitting band, carry out digital assay with genetic analysis software and handle, obtain the genetic distance between each individuality, and make up evolutionary tree;

(5) select candidate parent genetic distance can carry out the combo breeding by the very fast genotypic individuality of 4 above weight gains of enrichment greater than the offspring of colony's average genetic, gonadal maturation and combo.

In described step (2) the PCR-RFLP method, the pcr amplification condition is: cumulative volume 12.5 μ L, include genomic dna 50～100ng, all the other components add according to Taq enzyme specification sheets, and reaction finishes to get 3～5 μ L PCR liquid and detects its concentration and band unicity at 1.0% agarose gel electrophoresis.

In step (2) the PCR-RFLP method, the pcr amplification program is: 94 ℃ of pre-sex change 2min; 94 ℃ of sex change 30s, annealing 40s, 72 ℃ are extended 1min, 30 circulations; 72 ℃ were extended 4 ℃ of preservations 8 minutes.

In step (2) the PCR-RFLP method, the RFLP testing conditions is: 5 μ L PCR liquid carry out enzyme and cut in cumulative volume 10 μ L, include restriction enzyme 2U, cut 3～5h according to the temperature enzyme that operation instruction is recommended, stop endonuclease reaction then, detect enzyme slitting band with 1.2～2.0% agarose gel electrophoresis, carry out genotype and judge.

In the step (4), the genetic analysis software that uses is populations software and MEGA software.

In step (2) the PCR-RFLP method, cut in product band and the step (3) with jian carp weightening finish related SNP site title, primer sequence, restriction enzyme and enzyme for 6, select as shown in the table with the jian carp weightening finish related SNP site genotype that increases weight faster for 6:

Beneficial effect: adopt jian carp combo propagation method provided by the invention, help avoid the jian carp inbreeding, keep the higher genetic diversity of jian carp, improve the jian carp production performance, accelerate the seed selection process of jian carp.

Description of drawings

Fig. 1 is that jian carp candidate parent population 220 tails (male 107 tails, female 113 tails) use MEGA software according to D _AThe evolutionary tree that genetic distance makes up.

Embodiment

Genomic dna reference literature in the following example (Sa nurse Brooker J, Russell D W work. molecular cloning test guide [M] .3 version. Huang Peitang, Wang Jiaxi, Zhu Houchu, etc., translate. Beijing: Science Press, 2002:463-471) extract.

Wherein 6 with jian carp weightening finish related SNP site title, detect that primer sequence, restriction enzyme and enzyme are cut the product band and the very fast genotype that increases weight is selected as shown in the table:

Embodiment 1: the structure of jian carp candidate parent selection and evolutionary tree

Jian carp reproductive population 937 tails (male 486 tails, female 451 tails) are for cultivating in fishing ground, China Aquatic Science Research Academy Fresh Water Fishery Research Center Yixing.From the tail vein blood 0.5mL of every tail fish, get 30 μ L hemocyte extracting genomic dnas.Be template with got genomic dna, use the PCR-RFLP method to carry out genotype detection to each individual 6 with the jian carp relevant SNP sites of increasing weight.PCR cumulative volume 12.5 μ L include genomic dna 50～100ng, and all the other components add according to Taq enzyme specification sheets, and the PCR reaction conditions is: 94 ℃ of 2min; 94 ℃ of 30s, annealing 40s, 72 ℃ of 1min, 30 circulations; 72 ℃ were extended 4 ℃ of preservations 8 minutes.。Reaction finishes to get 3～5 μ L PCR liquid and detects its concentration and band unicity at 1.0% agarose gel electrophoresis, getting 5 μ LPCR liquid then carries out enzyme and cuts in cumulative volume 10 μ L, include restriction enzyme 2U, cut 3～5h according to the temperature enzyme that operation instruction is recommended, stop endonuclease reaction then, detect enzyme slitting band in 1.2～2.0% agarose gel electrophoresis, carrying out genotype judges, select contain 4～6 the weightening finish very fast genotype bases individuality 220 tails (male 107 tails, female 113 tails) as the candidate parent.220 tail candidate parents' PCR-RFLP method electrophoresis detection enzyme slitting band is carried out digitized processing, use the populations software analysis, obtain the D between each individuality _AGenetic distance is between 0.0451～0.4747, and average out to 0.1794 uses MEGA software according to D _AGenetic distance makes up evolutionary tree (Fig. 1).

Embodiment 2:

The structure of jian carp candidate parent selection and evolutionary tree is with embodiment 1, therefrom select genetic distance more than 0.3, be on the different branch of evolutionary tree, very fast genotypic female, male individual and 10 tails of 5～6 weightening finishes of offspring's enrichment of gonadal maturation and combo, carry out combo breeding one to one, detected result to their offsprings shows, average genetic is 0.3978, increase weight 5～6 of very fast genotype of enrichment.

Embodiment 3:

The structure of jian carp candidate parent selection and evolutionary tree is with embodiment 1, therefrom select genetic distance more than 0.3, offspring's enrichment 4～6 individual weights of gonadal maturation and combo increase weight very fast genotypic raun 40, milter 30 tails, carry out colony's combo breeding (experimental group), picked at random raun 10, milter 10 tails from non-candidate parent simultaneously, carry out colony's combo breeding (control group), under identical cultivating condition, experimental group on average grows fast 13.52% than control group.

Embodiment 4:

The structure of jian carp candidate parent selection and evolutionary tree is with embodiment 1, therefrom select genetic distance more than 0.3, heavy very fast genotypic female, male individual each 5 tail of weightening finish of 6 of offspring's enrichments of gonadal maturation and combo, carry out one to one combo breeding (experimental group), select in addition genetic distance 0.1 below, 6 of offspring's enrichments of gonadal maturation and combo heavily very fast genotypic female, male individual respectively 5 tails of weightening finish carry out one to one combo and breed (control group).Offspring to institute's combo detects analysis, and the result shows, experimental group offspring's average D _AGenetic distance 0.3541, control group offspring's average D _AGenetic distance 0.0901.

Sequence table

＜110〉China Aquatic Science Research Academy Fresh Water Fishery Research Center

＜120〉a kind of method of jian carp combo breeding

<130>

<160> 12

<170> PatentIn version 3.3

<210> 1

<211> 25

<212> DNA

＜213〉artificial sequence

<400> 1

caattcgcat cctgctatat attcg 25

<210> 2

<211> 24

<212> DNA

＜213〉artificial sequence

<400> 2

ttagtatccc acgagtttgt ccca 24

<210> 3

<211> 23

<212> DNA

＜213〉artificial sequence

<400> 3

tggtttgggt ctccagcatc ttt 23

<210> 4

<211> 24

<212> DNA

＜213〉artificial sequence

<400> 4

tgtggatttg gagatcaggt aacg 24

<210> 5

<211> 22

<212> DNA

＜213〉artificial sequence

<400> 5

tcagaccttc caaagctgcc at 22

<210> 6

<211> 25

<212> DNA

＜213〉artificial sequence

<400> 6

cacactgaga gcagtgatgt tcaga 25

<210> 7

<211> 32

<212> DNA

＜213〉artificial sequence

<400> 7

acagcagtat tccttttaca tagtagtagc ag 32

<210> 8

<211> 30

<212> DNA

＜213〉artificial sequence

<400> 8

cacaatactg ttactttaat agctgcctag 30

<210> 9

<211> 30

<212> DNA

＜213〉artificial sequence

<400> 9

aaacaaccct cgtactctgt ttttagagca 30

<210> 10

<211> 25

<212> DNA

＜213〉artificial sequence

<400> 10

agctagcacg acccgaatcg ttgtc 25

<210> 11

<211> 28

<212> DNA

＜213〉artificial sequence

<400> 11

ggcaatagag accatagatc ctatgcgg 28

<210> 12

<211> 26

<212> DNA

＜213〉artificial sequence

<400> 12

caaacatgtc aggagactgg agacac 26

Claims

1. the method for a jian carp combo breeding is characterized in that, comprises the steps:

(3) select to contain 4 ~ 6 very fast genotypic individualities of weightening finish as the candidate parent;

2. the method for jian carp combo according to claim 1 breeding, it is characterized in that: in described step (2) the PCR-RFLP method, the pcr amplification condition is: cumulative volume 12.5 μ L, include genomic dna 50 ~ 100 ng, all the other components according to TaqThe enzyme specification sheets adds, and reaction finishes to get 3 ~ 5 μ L PCR liquid and detects its concentration and band unicity at 1.0% agarose gel electrophoresis.

3. the method for jian carp combo according to claim 1 breeding, it is characterized in that: in described step (2) the PCR-RFLP method, the pcr amplification program is: 94 ℃ of pre-sex change 2min; 94 ℃ of sex change 30s, annealing 40s, 72 ℃ are extended 1min, 30 circulations; 72 ℃ were extended 4 ℃ of preservations 8 minutes.

4. the method for jian carp combo according to claim 1 breeding, it is characterized in that, in described step (2) the PCR-RFLP method, the RFLP testing conditions is: 5 μ L PCR liquid carry out enzyme and cut in cumulative volume 10 μ L, include restriction enzyme 2 U, cut 3 ~ 5 h according to the temperature enzyme that operation instruction is recommended, stop endonuclease reaction then, detect enzyme slitting band with 1.2～2.0% agarose gel electrophoresis, carry out genotype and judge.

5. the method for jian carp combo according to claim 1 breeding is characterized in that: in described step (2) the PCR-RFLP method, 6 are respectively with jian carp weightening finish related SNP site title, primer sequence:

Site (1) JlGHSR1a E1-A450C, upstream primer: CAATTCGCATCCTGCTATATATTCG

Downstream primer: TTAGTATCCCACGAGTTTGTCCCA,

Site (2) JlGHSR1a I-C386T, upstream primer: TGGTTTGGGTCTCCAGCATCTTT

Downstream primer: TGTGGATTTGGAGATCAGGTAACG,

Site (3) JlGHSR1b E1-G159T, upstream primer: TCAGACCTTCCAAAGCTGCCAT

Downstream primer: CACACTGAGAGCAGTGATGTTCAGA,

Site (4) JlGHR1aI3-A43G , upstream primer: ACAGCAGTATTCCTTTTACATAGTAGTAGCAG

Downstream primer: CACAATACTGTTACTTTAATAGCTGCCTAG,

Site (5) JlGHR1Be8-C12T , upstream primer: AAACAACCCTCGTACTCTGTTTTTAGAGCA

Downstream primer: AGCTAGCACGACCCGAATCGTTGTC,

Site (6) JlIGFBP3bI2-G30T , upstream primer: GGCAATAGAGACCATAGATCCTATGCGG

Downstream primer: TGTGGATTTGGAGATCAGGTAACG.

6. the method for jian carp combo according to claim 1 breeding, it is characterized in that: the genetic analysis software that uses in the step (4) is populations software and MEGA software.