CN1475502A - New withered induced protein, its coded sequence and use - Google Patents
New withered induced protein, its coded sequence and use Download PDFInfo
- Publication number
- CN1475502A CN1475502A CNA021365261A CN02136526A CN1475502A CN 1475502 A CN1475502 A CN 1475502A CN A021365261 A CNA021365261 A CN A021365261A CN 02136526 A CN02136526 A CN 02136526A CN 1475502 A CN1475502 A CN 1475502A
- Authority
- CN
- China
- Prior art keywords
- appd
- polypeptide
- sequence
- polynucleotide
- people
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
Abstract
An apoptosis-inducing protein containing pH domain (APPD), its coding polynucleotide, the process for recombining said protein, and the application of said APPD and its coding sequence in diagnosing and treating cancer are disclosed.
Description
Technical field
The invention belongs to biotechnology and medical field, specifically, the present invention relates to accent that new coding contains the pH structural domain die inducible protein (Apoptosis-inducing Protein containing PH Domain, APPD) and the polynucleotide encoding sequence.The invention still further relates to the purposes and the preparation of these polynucleotide and polypeptide.APPD is a kind of and apoptosis-related interior soluble proteins of cell, and its high expression level has the function of cell death inducing.
Background technology
Apoptosis (apoptosis) is a kind of spontaneous death process that body cell occurs after being subjected to physiology and pathological stimuli, has crucial meaning in the processes such as generation of the adjusting of the keeping of fetal development, ripe organ, body's immunity and tumour.
It has been found that some are in natural death of cerebral cells proteins associated and gene.But, up to now, still have many undiscovered with natural death of cerebral cells proteins associated or gene.Therefore, this area press for exploitation new with natural death of cerebral cells proteins associated or gene.
Summary of the invention
The purpose of this invention is to provide a kind of new withered induced protein-APPD with and fragment, analogue and derivative.
Another object of the present invention provides the polynucleotide of these polypeptide of coding.
Another object of the present invention provides the method for these polypeptide of production and the purposes of this polypeptide and encoding sequence.
In a first aspect of the present invention, novel isolated APPD polypeptide is provided, this polypeptide is the people source, it comprises: polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative with SEQ ID NO:2 aminoacid sequence.Preferably, this polypeptide is selected from down group: the polypeptide that (a) has SEQ ID NO:2 aminoacid sequence; (b) SEQ ID NO:2 aminoacid sequence is formed through replacement, disappearance or the interpolation of one or more amino-acid residues, and have inducing cell transfer the function of dying by (a) polypeptides derived.
In a second aspect of the present invention, the polynucleotide of isolating these polypeptide of coding are provided, these polynucleotide comprise a nucleotide sequence, and this nucleotide sequence is shown at least 70% homogeny with a kind of nucleotides sequence that is selected from down group: (a) polynucleotide of the above-mentioned people APPD of coding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 71-907 position among the SEQ ID NO:1; (b) has the sequence of 1-1698 position among the SEQ ID NO:1.
In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.
In a fourth aspect of the present invention, provide preparation to have the method for the polypeptide of people APPD protein-active, this method comprises: (a) under the proteic condition of suitable expressing human APPD, cultivate the above-mentioned host cell that is transformed or transduce; (b) from culture, isolate polypeptide with people APPD protein-active.
In a fifth aspect of the present invention, provide and above-mentioned people APPD polypeptid specificity bonded antibody.The nucleic acid molecule that can be used for detecting also is provided, and it contains a successive 15-1698 Nucleotide in the above-mentioned polynucleotide.
In a sixth aspect of the present invention, the compound of simulation, promotion, antagonism people APPD polypeptide active is provided, and the compound that suppresses people APPD polypeptide expression.The method of screening and/or prepare these compounds also is provided.Preferably, this compound is encoding sequence or its segmental antisense sequences of people APPD polypeptide.
In a seventh aspect of the present invention, provide and whether had the proteic method of APPD in the test sample, it comprises: sample is contacted with the proteic specific antibody of APPD, observe whether form antibody complex, formed antibody complex and just represented to exist in the sample APPD albumen.
In a eighth aspect of the present invention, a kind of disease relevant with people APPD polypeptide unconventionality expression or method of disease susceptibility of detecting is provided, this method comprises: whether have sudden change in the nucleotide sequence of detection coding said polypeptide.
In a ninth aspect of the present invention, provide the purposes of polypeptide of the present invention and encoding sequence.Polypeptide for example of the present invention can be used to screen the agonist that promotes people APPD polypeptide active, and perhaps screening suppresses the antagonist of people APPD polypeptide active or is used to the peptide finger print identification.The proteic encoding sequence of people APPD of the present invention or its fragment can be used as primer and be used for pcr amplification reaction, perhaps are used for hybridization as probe, perhaps are used to make gene chip or microarray.
In a tenth aspect of the present invention, a kind of pharmaceutical composition is provided, it contains people APPD polypeptide of the present invention or its agonist, antagonist and the pharmaceutically acceptable carrier of safe and effective amount.These pharmaceutical compositions can be treated illnesss such as primary cardiac myopathy, liver failure.
Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
Description of drawings
Fig. 1 is a people APPD Northern blot hybridization photo of the present invention.
Fig. 2 has shown the RT-PCR analytical results of people APPD of the present invention.
Fig. 3 has shown the flow cytometry analysis result of people APPD albumen transfection RAW 264.7 cells of the present invention, wherein uses the two dyeing of annexin V/PI.Results suggest APPD has the activity of cell death inducing.
After Fig. 4 has shown inventor APPD albumen transfectional cell, to the active influence of ERK, MEK1/2.Results suggest APPD has the activity of activation ERK, MEK1/2.
Embodiment
The inventor is separated to a recruit first from normal people's marrow stromal cell, find that it has the RAW of inducing and the apoptotic function of L-929, therefore the accent that it called after is contained the pH structural domain inducible protein (Apoptosis-inducing Protein containing PH Domain) of dying abbreviates APPD as.Finished the present invention on this basis.
APPD and known Rho/Rac guanylic acid exchange factor (GEF) molecule have higher homology, the major function of Rho/Rac GEF is the guanylic acid exchange that promotes small G-protein Rho/Rac family member, convert the GTP bonding state to by the GDP bonding state, promptly make it to be in again active state, substantial connection is arranged with the cell growth.But, APPD does not contain the major function territory DH of Rho/Rac GEF, only contain pleckstrin homology functional domain (pleckstrin homology domain, PH) and the FYVE Zinc finger domain, these two structural domains do not possess phosphorylation site, but with proteic location with mutually combine closely related.
APPD is carried out hydrophobicity analysis, find that it does not have tangible signal peptide and strides the film district, hints that it may be a plasmosin.The Northern trace shows, APPD is predominant expression in the heart of normal adult and skeletal muscle, and liver, placenta, lung and peripheral blood lymphocyte also have low-level expression (Fig. 1).RT-PCR analysis revealed APPD is to be wide expression (Fig. 2) in tumour, mammary cancer, the epithelial cancer at the dendritic cell high expression level in peripheral blood lymphocytes source at various tumour cells such as hematopoiesis.
Discover that APPD can induce the apoptosis of RAW 264.7 (mouse monokaryon/scavenger cell) and L-929 (l cell), do not need the synergy (Fig. 3) of LPS or TNF-α.APPD can not activate MAPK family member JUN and p38, but can activate MAPK family member ERK with and upstream kinases MEK1/2 (Fig. 4).Yet MTT cell proliferation test and clone form test-results shows that the APPD on cell proliferation does not have promoter action.
APPD has the activity of clear and definite inducing cell generation apoptosis, according to the effect characteristics of contained structural domain, infers that it plays the proteic effect of joint in apoptotic signal transduction pathway.It may transmit and the magnocell apoptotic signal by mutually combining between the promotion apoptotic signal transduction molecule and forming complex body.APPD plays an important role in multiple physiology and pathologic process, has important development and application and be worth in a plurality of fields such as the adjusting of body's immunity, antitumor, anti-virus infection, treatment autoimmune disorder and nerve retrograde affection.Research shows that novel apoptosis induction molecule APPD is relevant with multiple vital movement.Therefore, to research and develop novel apoptosis induction molecule APPD significant for diagnosis and therapeutic purpose
In the present invention, term " APPD albumen ", " APPD polypeptide " or " withered induced protein APPD " are used interchangeably, and all refer to have accent that the people contains the pH structural domain die albumen or the polypeptide of inducible protein APPD aminoacid sequence (SEQ IDNO:2).
As used herein, " isolating " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.
As used herein, " isolating APPD albumen or polypeptide " is meant that the APPD polypeptide is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying APPD albumen of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.
Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.
The present invention also comprises the proteic fragment of people APPD, derivative and analogue.As used herein, term " fragment ", " derivative " are meant with " analogue " and keep identical biological function of natural human APPD albumen of the present invention or active polypeptide basically.Polypeptide fragment of the present invention, derivative or analogue can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferred conservative amino acid residue), and the amino-acid residue of such replacement can be also can not encoded by genetic code, or (ii) in one or more amino-acid residues, has a polypeptide of substituted radical, or (iii) mature polypeptide and another compound (such as the compound that prolongs the polypeptide transformation period, polyoxyethylene glycol for example) merges formed polypeptide, or (iv) additional aminoacid sequence is fused to this peptide sequence and the polypeptide that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying, or with the fusion rotein of the segmental formation of antigen I gG).According to the instruction of this paper, these fragments, derivative and analogue belong to the known scope of those skilled in the art.
In the present invention, term " people APPD polypeptide " refers to have the SEQ ID NO.2 polypeptide of sequence of people APPD protein-active.This term also comprises having and variant form people APPD albumen identical function, SEQ ID NO.2 sequence.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises proteic active fragments of people APPD and reactive derivative.
The variant form of this polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, under high or low tight degree condition can with the coded albumen of the DNA of people APPD DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-people APPD polypeptide to obtain.The present invention also provides other polypeptide, as comprises people APPD polypeptide or its segmental fusion rotein.Except the polypeptide of total length almost, the present invention has also comprised the soluble fragments of people APPD polypeptide.Usually, this fragment have people APPD peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.
Invention also provides the analogue of people APPD albumen or polypeptide.The difference of these analogues and natural human APPD polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
In the present invention, " people APPD albumen conservative property variation polypeptide " refers to compare with the aminoacid sequence of SEQ ID NO:2, has 10 at the most, preferably at the most 8, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best.These conservative property variation polypeptide preferably carry out the amino acid replacement according to table 1 and produce.
Table 1
| Initial residue | Representational replacement | The preferred replacement |
| ?Ala??(A) | Val；Leu；Ile | ?Val |
| ?Arg??(R) | Lys；Gln；Asn | ?Lys |
| ?Asn??(N) | Gln；His；Lys；Arg | ?Gln |
| ?Asp??(D) | Glu | ?Glu |
| ?Cys??(C) | Ser | ?Ser |
| ?Gln??(Q) | Asn | ?Asn |
| ?Glu??(E) | Asp | ?Asp |
| ?Gly??(G) | Pro；Ala | ?Ala |
| ?His??(H) | Asn；Gln；Lys；Arg | ?Arg |
| ?Ile??(I) | Leu；Val；Met；Ala；Phe | ?Leu |
| ?Leu??(L) | Ile；Val；Met；Ala；Phe | ?Ile |
| ?Lys??(K) | Arg；Gln；Asn | ?Arg |
| ?Met??(M) | Leu；Phe；Ile | ?Leu |
| ?Phe??(F) | Leu；Val；Ile；Ala；Tyr | ?Leu |
| ?Pro??(P) | Ala | ?Ala |
| ?Ser??(S) | Thr | ?Thr |
| ?Thr??(T) | Ser | ?Ser |
| ?Trp??(W) | Tyr；Phe | ?Tyr |
| ?Tyr??(Y) | Trp；Phe；Thr；Ser | ?Phe |
| ?Val??(V) | Ile；Leu；Met；Phe；Ala | ?Leu |
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.As used herein, " varient of degeneracy " is meant that in the present invention coding has the protein of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.
The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence of an encoding mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.
Term " polynucleotide of coded polypeptide " can be the polynucleotide that comprise this polypeptide of encoding, and also can be the polynucleotide that also comprise additional code and/or non-coding sequence.
The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.
The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 50%, preferably at least 70%, the polynucleotide of at least 80% homogeny more preferably.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 90%, be more preferably 95% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.
The invention still further relates to nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " contains 15 Nucleotide at least, better is at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid to determine and/or the proteic polynucleotide of separation coding APPD.
Polypeptide among the present invention and polynucleotide preferably provide with isolating form, more preferably are purified to homogeneous.
People APPD Nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.
In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.
In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.
At present, can be fully obtain the dna sequence dna of code book invention albumen (or its fragment, or derivatives thereof) by chemosynthesis.This dna sequence dna can be introduced in various existing dna moleculars as known in the art (or as carrier) and the cell then.In addition, also can will suddenly change and introduce in the protein sequence of the present invention by chemosynthesis.
Use method (Saiki, the et al.Science1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to obtain the cDNA of total length from the library, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with carrier of the present invention or APPD albumen coded sequence, and the method that produces polypeptide of the present invention through recombinant technology.
Recombinant DNA technology (Science, 1984 by routine; 224:1431), can utilize polymerized nucleoside acid sequence of the present invention to can be used to express or produce the APPD polypeptide of reorganization.In general following steps are arranged:
(1). with the polynucleotide (or varient) of coding of the present invention people APPD polypeptide, or with the recombinant expression vector that contains these polynucleotide proper host cell that transforms or transduce;
(2). the host cell of in suitable medium, cultivating;
(3). separation, protein purification from substratum or cell.
Among the present invention, people APPD polynucleotide sequence can be inserted in the recombinant expression vector.Term " recombinant expression vector " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carriers.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on T7 of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J BioChem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier can be used.A key character of expression vector is to contain replication orgin, promotor, marker gene and translation controlling elements usually.
Method well-known to those having ordinary skill in the art can be used to make up and contains people APPD DNA sequences encoding and suitable transcribing/the translate expression vector of control signal.These methods comprise (Sambroook, et al.Molecular Cloning, a LaboratoryManual, cold Spring Harbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; Lambda particles phage P
LPromotor; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in protokaryon or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance.
Comprise the carrier of above-mentioned suitable dna sequence dna and suitable promotor or control sequence, can be used to transform appropriate host cell, so that it can marking protein.
Host cell can be a prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; The bacterial cell of Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; The insect cell of fruit bat S2 or Sf9; The zooblast of CHO, COS, 293 cells or Bowes melanoma cells etc.
When polynucleotide of the present invention are expressed in higher eucaryotic cells, be enhanced if will make to transcribe when in carrier, inserting enhancer sequence.Enhanser is the cis acting factor of DNA, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.
Persons skilled in the art all know how to select appropriate carriers, promotor, enhanser and host cell.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results
2Method is handled, and used step is well-known in this area.Another kind method is to use MgCl
2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.
The transformant that obtains can be cultivated with ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
The extracellular can be expressed or be secreted into to recombinant polypeptide in the above methods in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation handles, with protein precipitant handle (salt analysis method), centrifugal, the broken bacterium of infiltration, superly handle, the combination of super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
The people APPD albumen or the polypeptide of reorganization are of use in many ways.These purposes include, but is not limited to: the direct disease due to the low or forfeiture and be used to screen and promote or antibody, polypeptide or other part of antagonism APPD protein function as pharmacological agent APPD protein function.The peptide molecule that can suppress or stimulate people APPD protein function that can be used for seeking therapeutic value with the recombinant human APPD protein screening peptide library of expressing.
On the other hand, the present invention also comprises people APPD DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into people APPD gene product or fragment.Preferably, refer to that those can combine with people APPD gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress the proteic molecule of people APPD, comprise that also those do not influence the antibody of people APPD protein function.The present invention also comprise those can with modify or without the people APPD gene product bonded antibody of modified forms.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab)
2Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule (people such as Ladner, U.S. Patent No. 4,946,778); Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.
Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the people APPD gene product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing human APPD albumen or its have antigenic segmental cell and can be used to immune animal and produce antibody.Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology prepare (see people such as Kohler,
Nature256; 495,1975; People such as Kohler,
Eur.J.Immunol.6:511,1976; People such as Kohler,
Eur.J.Immunol.6:292,1976; People such as Hammerling,
In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, N.Y., 1981).Antibody of the present invention comprises the antibody that can block people APPD protein function and the antibody that does not influence people APPD protein function.Each antibody-like of the present invention can utilize the fragment or the functional zone of people APPD gene product, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of people APPD gene product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).
The proteic antibody of anti-people APPD can be used in the immunohistochemistry technology, detects the people APPD albumen in the biopsy specimen.In addition, with the also available labelled with radioisotope of the protein bound monoclonal antibody of people APPD, inject in the body and can follow the tracks of its position and distribution.This radiolabeled antibody can be used as a kind of atraumatic diagnostic method and is used for the location of tumour cell and has judged whether transfer.
Antibody among the present invention can be used for treating or prevention and the relevant disease of people APPD albumen.The antibody that gives suitable dosage can stimulate or block proteic generation of people APPD or activity.
Antibody also can be used for being designed to the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of people APPD albumen high-affinity can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing the cell (for example lymph-node cell etc.) of people APPD protein positive.
The production of polyclonal antibody can choose APPD albumen or polypeptide immune animal, as rabbit, mouse, rat etc.Multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.
Utilize albumen of the present invention,, can filter out with APPD albumen interactional material takes place, as acceptor, inhibitor, agonist or antagonist etc. by various conventional screening methods.
Albumen of the present invention and antibody thereof, inhibitor, agonist, antagonist or acceptor etc. when using (administration) in treatment, can provide different effects.Usually, can these materials are formulated in nontoxic, inert and the pharmaceutically acceptable aqueous carrier medium, wherein pH is about 5-8 usually, and preferably pH is about 6-8, although the pH value can be with being changed to some extent by preparation Substance Properties and illness to be treated.The pharmaceutical composition for preparing can carry out administration by conventional route, comprising (but being not limited to): intramuscular, intraperitoneal, intravenously, subcutaneous, intracutaneous or topical.
Polypeptide of the present invention can be directly used in disease treatment, for example, uses the treatment with aspects such as primary cardiac myopathy, liver failures.When using APPD albumen of the present invention, also can use the other treatment agent simultaneously, as IFN-α, IFN-β, TNF-α, TNF-β etc.
The present invention also provides a kind of pharmaceutical composition, and it contains APPD polypeptide of the present invention or its agonist, antagonist and the pharmaceutically acceptable carrier or the vehicle of safe and effective amount.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.Pharmaceutical composition of the present invention can be made into the injection form, for example is prepared by ordinary method with the physiological saline or the aqueous solution that contains glucose and other assistant agents.Pharmaceutical composition such as tablet and capsule can be prepared by ordinary method.Pharmaceutical composition such as injection, solution, tablet and capsule should be made under aseptic condition.The dosage of activeconstituents is the treatment significant quantity, for example every day about 1 microgram/kg body weight-Yue 5 mg/kg body weight.In addition, polypeptide of the present invention also can use with the other treatment agent.
When making pharmaceutical composition, be that the APPD albumen of safe and effective amount or its antagonist, agonist are applied to Mammals, wherein this safe and effective amount is usually at least about 10 micrograms/kg body weight, and in most of the cases be no more than about 8 mg/kg body weight, preferably this dosage is about 10 micrograms/kg body weight-Yue 1 mg/kg body weight.Certainly, concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.
The proteic polynucleotide of people APPD also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treating because cell proliferation, growth or the metabolic disturbance due to the proteic expression of APPD of the proteic nothing expression of APPD or unusual/non-activity.The APPD albumen that the gene therapy vector (as virus vector) of reorganization can be designed to express variation is to suppress endogenic APPD protein-active.Deriving from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. can be used for the APPD transgenosis to cell.The method that structure carries the recombinant viral vector of APPD gene is found in existing document (Sambrook, et al.).Recombinant human APPD gene can be packaged in the liposome in addition, and then is transferred in the cell.
Suppress the oligonucleotide (comprising sense-rna and DNA) of people APPD mRNA and ribozyme also within the scope of the invention.Ribozyme is the enzyme sample RNA molecule that a kind of energy specificity is decomposed specific RNA, and its mechanism of action is to carry out the endonuclease effect after ribozyme molecule and the hybridization of complementary target RNA-specific.The RNA of antisense and DNA and ribozyme can obtain with existing any RNA or DNA synthetic technology, as the technology widespread use of solid phase phosphoamide chemical synthesis synthetic oligonucleotide.Antisense rna molecule can be transcribed acquisition by the dna sequence dna of this RNA that encodes in external or body.This dna sequence dna has been incorporated into the downstream of rna polymerase promoter of carrier.In order to increase the stability of nucleic acid molecule, available several different methods is modified it, and as increasing the sequence length of both sides, the connection between the ribonucleoside is used phosphoric acid thioester bond or peptide bond but not phosphodiester bond.
Polynucleotide imports tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.
Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with the protein bound peptide molecule of people APPD obtains.During screening, must carry out mark to people APPD protein molecular.
The invention still further relates to the diagnostic testing process of quantitative and detection and localization people APPD protein level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.The people APPD protein level that is detected in the test can be with laying down a definition the importance of people APPD albumen in various diseases and be used to the disease of diagnosing APPD albumen to work.
Whether having the proteic method of APPD in a kind of detection test sample is to utilize the proteic specific antibody of APPD to detect, and it comprises: sample is contacted with the APPD protein specific antibody; Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample APPD albumen.
The proteic polynucleotide of APPD can be used for the diagnosis and the treatment of APPD protein related diseases.Aspect diagnosis, the proteic polynucleotide of APPD can be used for detecting the proteic expression of APPD APPD abnormal exprssion whether or under morbid state.Can be used for the hybridization of biopsy specimen to judge the proteic abnormal expression of APPD as the APPD dna sequence dna.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.Carry out RNA-polymerase chain reaction (RT-PCR) amplification in vitro with the special primer of APPD albumen and also can detect the proteic transcription product of APPD.
The sudden change that detects the APPD gene also can be used for the disease of diagnosing APPD albumen relevant.The form of APPD protein mutation comprises that the point mutation compared with normal wild type APPD dna sequence dna, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.
Sequence of the present invention identifies it also is valuable to karyomit(e).In brief, the proteic cDNA of APPD prepares PCR primer (preferred 15-35bp) according to the present invention, sequence can be positioned on the karyomit(e).Then, these primers are used for the somatocyte hybrid cell that the PCR screening contains each bar human chromosome.Have only those hybrid cells that contain corresponding to the people's gene of primer can produce the fragment of amplification.
In case sequence is positioned to chromosome position accurately, the physical location of this sequence on karyomit(e) just can be associated with the gene map data.These data for example are found in, V.Mckusick, MendelianInheritance in Man (can by with the online acquisition of Johns Hopkins University Welch MedicalLibrary).Can pass through linkage analysis then, determine gene and navigated to relation between the disease on the chromosomal region already.
In an example of the present invention, a kind of isolating polynucleotide are provided, its coding has the polypeptide of aminoacid sequence shown in the SEQ IDNO:2.Polynucleotide of the present invention are isolated from human bone marrow substrate cell cDNA library.Its sequence is shown in SEQ ID NO:1, and the polynucleotide sequence total length that it comprises is 1698 bases, and its open reading frame is positioned at the 71-907 position, and the coding total length is 279 amino acid whose people APPD albumen (SEQ ID NO:2).This APPD albumen belongs to molecule in the born of the same parents, and with Rho/Rac guanylic acid exchange factor aminoacid sequence portion homologous, consistence can be up to 46%, and similarity then can reach 61%.In addition, APPD albumen also comprises Rho/Rac guanylic acid exchange factor conservative PH structural domain and FYVE zinc fingers.The Northern engram analysis shows wide expression in tissue.The research prompting of having carried out, APPD may be the new joint albumen relevant with the apoptosis signal transduction.Therefore, APPD albumen or its relevant antagonist, agonist etc. can be diseases such as treating malignant tumour provides new treatment approach, thereby has great application prospect.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1: the clone of people APPD cDNA
Extract the total RNA of human bone marrow substrate cell with Trizol (Gibco company).Then, from total RNA, separate poly (A) mRNA.Poly (A) mRNA after reverse transcription forms cDNA, is cloned test kit (available from Gibco) with SuperScriptII cDNA fragment orientation is inserted on the multiple clone site of carrier, transform DH5 α bacterium and form the cDNA plasmid library.Measure the sequence of random choose clone's 5 ' end with dideoxy method.CDNA sequence and the existing public dna sequence data storehouse measured are compared, found that a cDNA clone's dna sequence dna is new full-length cDNA.By synthetic a series of primers the contained dna sequence dna of new clone is carried out two-way mensuration.Computer Analysis shows that cloning contained full-length cDNA is a new cDNA sequence (shown in SEQ ID NO:1), the new protein (shown in SEQ ID NO:2) of encoding.This protein is named as people APPD, and its encoding gene name is people APPD gene.
Sequence SEQ ID NO:1 total length is 1698bp, comprises 5 ' the end non-coding region of 70bp and 3 ' the end non-coding region of 788bp, and coding contains 279 amino acid whose polypeptide.Calculating not in theory, the molecular weight of glycosylated ripe molecule is about 30kD.
They are different with known for the BLAST analysis revealed, and with people Rho/Rac guanylic acid exchange factor aminoacid sequence height homology, consistence reaches 46%, and similarity reaches 61%.In addition, also comprise Rho/Rac guanylic acid exchange factor conservative PH structural domain and FYVE zinc fingers in APPD albumen, this also further points out it may be new and the cell relevant signal transducer of growing.
Embodiment 2: the Construction of eukaryotic of people APPD
Be in logarithmic phase B lymphoma cell strain Raji cell total rna with Trizol (Gibco company) extraction, get the 6mg cell total rna and mix, carry out reverse transcription with 0.5 μ g Oligo-dT12-18.The reverse transcription system is 20 μ l, adds 80 μ l deionized waters after reaction finishes and dilutes.The used primer of pcr amplification is as follows: adopted primer 5 '-GCGAATTCATGGTGGACCACTTGGCCAACA-3 ' (SEQ ID NO:3) is arranged, this primer contains the restriction enzyme site of EcoR I restriction enzyme, is the part encoding sequence of people APPD after this restriction enzyme site; Antisense primer 5 '-GCAAGCTTTCAGCTGTGGAAAGCAGACCA-3 ' (SEQ ID NO:4), this primer contains the restriction enzyme site of HindIII restriction enzyme and the part encoding sequence of people APPD.The PCR reaction volume is 50 μ l, wherein contain reverse transcription template 10 μ l, 0.4mM primer, 0.2mM dNTP and 1U ExTaq archaeal dna polymerase (Takara Inc.), the amplification parameter be 94 ℃ 30 seconds, 60 ℃ 30 seconds, 72 ℃ 45 seconds, capable 2% agarose gel electrophoresis of PCR product is tentatively confirmed after 25 circulations.With the PCR product purification that obtains after EcoR I/HindIII enzyme cut and recombinate according to a conventional method with plasmid pcDNA3.1/Myc-His (-) B again and be converted into the competence intestinal bacteria, the picking positive colony is identified after order-checking confirms that the dna sequence analysis result shows that the coding region is identical among this insertion fragments sequence and the SEQ ID NO:1.
The Northern engram analysis of embodiment 3:APPD
Carry out the Northern trace by following ordinary method: filter membrane to be checked places the hybridization solution of 10ml through 68 ℃ of preheatings, in hybrid heater (Bellco) in 68 ℃ of prehybridizations 30 minutes; The cDNA probe that mark is good is in boiling sex change 5 minutes, and (cDNA probe final concentration is 2～10ng/ml or 1～2 * 10 to put rapid cooling back adding hybridization solution on ice
6Cpm/ml), fully mixing was hybridized 2 hours in 68 ℃.After hybridization finishes, filter membrane with 2 * SSC, the drip washing of 0.05%SDS room temperature for several times, the washing lotion several is changed in continuing vibration flushing 30～40 minutes therebetween.Use 0.1 * SSC, 0.1%SDS in 50 ℃ of vibration flushings 20～40 minutes subsequently.Last filter membrane wrapped up with plastic fresh-keeping membrane, in-70 ℃ of exposure X line films 24～48 hours.
Northern blot hybridization result (Fig. 1) shows: APPD all has expression (1.9kb) in many healthy tissuess such as heart, skeletal muscle, liver, placenta, peripheral blood leucocyte, this shows that APPD is a kind of molecule of wide expression.
Embodiment 4: carry out the cell expressing analysis of people APPD with the RT-PCR method
Extract total RNA of the various clones such as MCF-7 be in logarithmic phase with Trizol reagent, get 5 μ g cell total rnas and 1 μ g Oligo-dT
12-18Mix, carry out reverse transcription.The reverse transcription system is 20 μ l, and reaction adds 80 μ l ddH after finishing
2O dilutes.The pcr amplification primer is as follows: adopted primer 5 ' CGACGAGGACAAGGAGGGCAGCAGG (SEQ ID NO:5) is arranged, antisense primer 5 ' GTGGGTGTTCTGGGGCTTCCTGAAG (SEQ ID NO:6), simultaneously with beta-actin as positive control.The PCR reaction volume is 50 μ l, wherein contain reverse transcription template 10 μ l, 0.5mM primer, 0.2mM dNTP and 1UrTaq archaeal dna polymerase (Takara Inc.), the amplification parameter be 95 ℃ 15 seconds, 57 ℃ 30 seconds, 72 ℃ 30 seconds, capable 1.5% agarose gel electrophoresis of PCR product is tentatively confirmed after 28 circulations.
RT-PCR result (Fig. 2) shows that there is expression comparatively widely in APPD mRNA tool in clones such as MCF-7, A549, PC-3, HeLa, SMMC7721, U937, K562, THP-1, NB4, HL60, Raji, Jurkat and Molt-4
Embodiment 5: people APPD protokaryon is recombinant expressed
In this embodiment, be template with the plasmid DNA among the embodiment 2,5 ' and 3 ' the PCR Oligonucleolide primers held following with sequence increases, and obtains people APPD DNA as inserting fragment.
5 ' the end Oligonucleolide primers sequence of using in the PCR reaction is:
5’-ACGAATTCCGATGGTGGACCACTTGGCCA-3’(SEQ?ID?NO：7)
This primer contains the restriction enzyme site of EcoR I restriction enzyme, is the part encoding sequence of people APPD after this restriction enzyme site;
3 ' end primer sequence is:
5’-ACGAATTCGCTCAGGAGGCCATCTGGAGC-3’(SEQ?ID?NO：8)
This primer contains the part encoding sequence of restriction enzyme site, translation termination and the people APPD of EcoR I restriction enzyme.
After EcoR I enzyme is cut and recombinated according to a conventional method with plasmid pGEM-3ZF and be converted into the competence e. coli bl21, the picking positive colony is identified back purifying and order-checking with the PCR product purification that obtains.The people APPD cDNA EcoR I endonuclease bamhi of correct sequence is cloned into expression vector pGEX-2T (Pharmacia company), forms carrier pGEX-2T-APPD, then transformed into escherichia coli BL21.Positive colony is cut evaluation with EcoR I enzyme, and the forward clone cuts evaluation with BamH I enzyme, the capable 0.8% agarose gel electrophoresis analysis of product.Confirm through order-checking, inserted designed APPD encoding sequence.
Choosing the positive BL21 clone who expresses APPD is inoculated in 100ml 2 * YTA substratum, 37 ℃ of 300rpm shaking culture 12-15hr, 2 * YTA the substratum that is diluted in preheating at 1: 10 continues shaking culture 1.5hr, add behind the 100mM IPTG to 0.1mM 30 ℃ and induce 2-6hr, 5,4 ℃ of centrifugal 10min of 000g remove supernatant, put and use 50ml 1 * PBS (0.14M NaCl on ice, 2.7mM KCl, 10.1mM Na
2HPO
4, 1.8mM KH
2PO
4PH7.3) resuspended, add 20%Triton X-100 to 1% jog 30min again after ultrasonic (B.Braun Labsonic U) fragmentation, then 12,4 ℃ of centrifugal 10min of 000g, supernatant with 0.8 μ m membrane filtration after, cross 1ml 50% glutathione S epharose 4B chromatography column, behind 1 * PBS thorough washing, add 500ul gsh elution buffer (10mM gsh, 50mM Tris-HCl, pH8.0) room temperature leaves standstill after 30 minutes and collects elutriant, repeats wash-out 2-3 time, obtains people GST-APPD fusion rotein, its molecular weight is about 56KDa, conforms to prediction.
Embodiment 6: anti-people APPD production of antibodies
The recombinant protein GST-APPD fusion rotein that obtains among the embodiment 5 is used for immune animal to produce antibody, and concrete grammar is as follows.Recombinant molecule is standby after separating with chromatography.Also available SDS-PAGE gel electrophoresis separates, electrophoretic band downcut from gel, and with isopyknic complete Freund ' s adjuvant emulsion.Albumen with 50-100 μ g/0.2ml emulsification carries out peritoneal injection to mouse.After 14 days,, mouse is carried out peritoneal injection with booster immunization with the dosage of 50-100 μ g/0.2ml with the same antigen of non-complete Freund ' s adjuvant emulsion.Carried out booster immunization one time every 14 days, carry out at least three times.The sero-fast specific reaction that obtains is active to be assessed in the ability of external precipitation people APPD gene translation product with it.Found that antibody can combine with albumen of the present invention specifically.
The detection of embodiment 7:APPD activity inducing apoptosis
Total length APPD plasmid DNA among the embodiment 2 with LipofectAMINE reagent (LifeTechnologies company) transfection RAW 264.7 cells, is contrasted as irrelevant with the pcDNA3.1 plasmid vector.Collected cell in 60 hours after the transfection, carry out the two dyeing of AnnexinV/PI, detect with flow cytometer.
The result illustrates that APPD can obviously induce RAW 264.7 cells that die (LR district numerical value rises to 7.30 by 0.56) takes place to transfer as shown in Figure 3.
Replace RAW 264.7 cells with the L-929 cell, repeat above-mentioned experiment.The result shows that APPD can obviously induce L-929 cell generation accent to die
The Western of activation ERK, the MEK1/2 of embodiment 8:APPD detects
The cell (5 * 10 of APPD plasmid of having collected transfection
6Cell/sample), wash one time with PBS after, extract whole protein with T-PERTM Tissue Protein Extraction Reagent and be used for other detection, concrete operations are undertaken by the test kit explanation.Measure protein concentration with the BCA method afterwards, be adjusted to unanimity after, the per 20 μ l of sample and 6 times of sample-loading buffer (100mmol/L Tris-HCL of 4 μ l, 200mmol/L DTT, 4%SDS, 0.2% tetrabromophenol sulfonphthalein, 20% glycerine, PH6.8) mixing, after 100 ℃ of water-baths were boiled 5 minutes, row 12%SDS-PAGE electrophoresis moved on to the protein transduction in the polyacrylamide on the nitrocellulose filter in 4 ℃ with the 100V constant voltage subsequently, ponceau dyeing and label orientation mark the Marker position.4 hours (the TBST solution of 10% skim-milk) of room temperature blocking-up, be diluted in the skim-milk solution by 1: 1000 rabbit source ERK, MEK1/2 be how anti-, after 2 hours, wash 3 times each 10 minutes in room temperature reaction with TBST (the TBS solution of 0.05%Tween20) with cellulose nitrate film.In addition corresponding two of horseradish peroxidase-labeled anti-(dilutions in 1: 2000) then, incubated at room 60 minutes, TBST gives a baby a bath on the third day after its birth time, each 10 minutes, A liquid in the Western trace luciferase assay reagent and B liquid is mixed with equal-volume, and incubated at room dried after 1 minute, press mold, exposure is developed.
The result behind the APPD transfectional cell, can activate ERK, MEK1/2 as shown in Figure 4.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table＜110〉Inst. of Immunology, Zhejiang Univ.＜120〉new withered induced protein, its coded sequence and purposes＜130〉024957＜160〉8＜170〉PatentIn version 3.1＜210〉1＜211〉1698＜212〉DNA＜213〉homo sapiens (Homo sapiens)＜220〉＜221〉CDS＜222〉(71) .. (907)＜223〉＜400〉1acccgggcta ctgcggtgtg gactcgaggg ctgggcgcgg ggccggcgca gaagccgcca 60gctggagacg atg gtg gac cac ttg gcc aac acg gag atc aac agc cag 109
Met?Val?Asp?His?Leu?Ala?Asn?Thr?Glu?Ile?Asn?Ser?Gln
1???????????????5???????????????????10cgc?atc?gcg?gca?gtg?gag?agc?tgc?ttc?ggg?gcc?tcg?ggg?cag?ccg?ctg??????157Arg?Ile?Ala?Ala?Val?Glu?Ser?Cys?Phe?Gly?Ala?Ser?Gly?Gln?Pro?Leu
15??????????????????20??????????????????25gcg?ctg?cca?ggc?cga?gtg?ctg?ctg?ggc?gag?ggc?gtg?ctg?acc?aaa?gag??????205Ala?Leu?Pro?Gly?Arg?Val?Leu?Leu?Gly?Glu?Gly?Val?Leu?Thr?Lys?Glu30??????????????????35??????????????????40??????????????????45tgc?cgc?aag?aag?gcc?aag?ccg?cgc?atc?ttc?ttc?ctc?ttt?aac?gac?atc??????253Cys?Arg?Lys?Lys?Ala?Lys?Pro?Arg?Ile?Phe?Phe?Leu?Phe?Asn?Asp?Ile
50??????????????????55??????????????????60ctg?gtg?tat?ggc?agc?atc?gtg?ctc?aac?aag?cgc?aag?tac?cgc?agc?cag??????301Leu?Val?Tyr?Gly?Ser?Ile?Val?Leu?Asn?Lys?Arg?Lys?Tyr?Arg?Ser?Gln
65??????????????????70??????????????????75cac?atc?atc?ccc?ctg?gag?gag?gtc?aca?ctg?gag?ctg?ttg?ccg?gag?acg??????349His?Ile?Ile?Pro?Leu?Glu?Glu?Val?Thr?Leu?Glu?Leu?Leu?Pro?Glu?Thr
80??????????????????85??????????????????90ctg?cag?gcc?aag?aac?cgc?tgg?atg?atc?aag?acg?gcc?aag?aag?tcc?ttt????397Leu?Gln?Ala?Lys?Asn?Arg?Trp?Met?Ile?Lys?Thr?Ala?Lys?Lys?Ser?Phe
95??????????????????100?????????????????105gtg?gtg?tcg?gcc?gcc?tcc?gct?acg?gag?cgc?cag?gaa?tgg?att?agc?cac????445Val?Val?Ser?Ala?Ala?Ser?Ala?Thr?Glu?Arg?Gln?Glu?Trp?Ile?Ser?His110?????????????????115?????????????????120?????????????????125atc?gag?gag?tgc?gtg?cgg?cgg?caa?ctg?aag?gcc?acg?ggc?cgc?ccg?ccc????493Ile?Glu?Glu?Cys?Val?Arg?Arg?Gln?Leu?Lys?Ala?Thr?Gly?Arg?Pro?Pro
130?????????????????135?????????????????140agc?acg?gag?cac?gcg?gca?ccc?tgg?atc?ccc?gac?aag?gcc?acg?gac?atc????541Ser?Thr?Glu?His?Ala?Ala?Pro?Trp?Ile?Pro?Asp?Lys?Ala?Thr?Asp?Ile
145?????????????????150?????????????????155tgc?atg?cgc?tgc?acg?cag?acg?cgc?ttc?tct?gcc?ctc?acg?agg?cgc?cac????589Cys?Met?Arg?Cys?Thr?Gln?Thr?Arg?Phe?Ser?Ala?Leu?Thr?Arg?Arg?His
160?????????????????165?????????????????170cac?tgc?cgc?aag?tgc?ggc?ttc?gtg?gtc?tgc?gct?gag?tgc?tcg?cgc?cag????637His?Cys?Arg?Lys?Cys?Gly?Phe?Val?Val?Cys?Ala?Glu?Cys?Ser?Arg?Gln
175?????????????????180?????????????????185cgc?ttc?ctg?ctc?ccg?cgc?ctg?tcc?ccc?aag?ccc?gtg?cgc?gtc?tgc?agc????685Arg?Phe?Leu?Leu?Pro?Arg?Leu?Ser?Pro?Lys?Pro?Val?Arg?Val?Cys?Ser190?????????????????195?????????????????200?????????????????205ctc?tgc?tac?cgc?gaa?ctg?gcc?gcc?cag?cag?cgg?cag?gag?gag?gcg?gag????733Leu?Cys?Tyr?Arg?Glu?Leu?Ala?Ala?Gln?Gln?Arg?Gln?Glu?Glu?Ala?Glu
210?????????????????215?????????????????220gag?cag?ggc?gcg?ggg?tcc?cca?agg?cag?cca?gcc?cac?ctg?gcc?cgg?ccc????781Glu?Gln?Gly?Ala?Gly?Ser?Pro?Arg?Gln?Pro?Ala?His?Leu?Ala?Arg?Pro
225?????????????????230?????????????????235atc?tgc?gga?gcg?tcc?agt?gga?gat?gac?gat?gac?tcc?gac?gag?gac?aag????829Ile?Cys?Gly?Ala?Ser?Ser?Gly?Asp?Asp?Asp?Asp?Ser?Asp?Glu?Asp?Lys
240?????????????????245?????????????????250gag?ggc?agc?agg?gac?ggg?gac?tgg?ccc?agc?agc?gtg?gag?ttc?tac?gcc????877Glu?Gly?Ser?Arg?Asp?Gly?Asp?Trp?Pro?Ser?Ser?Val?Glu?Phe?Tyr?Ala
255 260 265tcg ggg gtg gcc tgg tct gct ttc cac agc tgaccccggg cctgcagaac 927Ser Gly Val Ala Trp Ser Ala Phe His Ser270 275atctgtcccc aagccagctc cactgcccag gcccccaaga gggcagctcc agaagctgcc 987cagggctccg ggaccccatc ccatggtggc aggtgcagcg gtggggagtg gctctttctg 1047gactcccagt gcctttttgc tggacactgt gtccttatgg cttcactgca ggtaatgcct 1107ttcccttcag gaagccccag aacacccaca ggtcttggta acaaacgcca ccttacactc 1167tgcaggctgc agcggcagct ccagatggcc tcctgagctg gacgacccca ggtctccaga 1227catctaggga ccagagcagg tttgggaaca cagagggaag acaggatggg agtgtagcca 1287cagaacccac ctgcaccctg acaggcacac cccactgaag agcctgagtc ccaggaggcc 1347tcctggaagc ccaggactgc ccacccacca cgctggtgcc caccgccttg gccagccaag 1407ccctgccgat cagacatgtg ggctccccga agcccagcca gagactgccg tgctgtgggt 1467gccaccaggc ccagggactg cagcctgagc tccccgaggc ccagggcagc cgggtgagga 1527ctctgtcctg tgtcacctct ctccaggtgt ccagctgtct catgcctttt tgtcctgtcc 1587tcagctctcc gtgtggtcag cgaaaccatt gttttctgtt aggactcagt tgcaagaaca 1647gaaaccctgc ccccccttaa taataaaaaa gaaagtttat tggaaaaaaa a 1698＜210〉2＜211〉279＜212〉PRT＜213〉 ( Homo sapiens )＜400〉2Met Val Asp His Leu Ala Asn Thr Glu Ile Asn Ser Gln Arg Ile Ala1 5 10 15Ala Val Glu Ser Cys Phe Gly Ala Ser Gly Gln Pro Leu Ala Leu Pro
20??????????????????25??????????????????30Gly?Arg?Val?Leu?Leu?Gly?Glu?Gly?Val?Leu?Thr?Lys?Glu?Cys?Arg?Lys
35??????????????????40??????????????????45Lys?Ala?Lys?Pro?Arg?Ile?Phe?Phe?Leu?Phe?Asn?Asp?Ile?Leu?Val?Tyr
50??????????????????55??????????????????60Gly?Ser?Ile?Val?Leu?Asn?Lys?Arg?Lys?Tyr?Arg?Ser?Gln?His?Ile?Ile65??????????????????70??????????????????75??????????????????80Pro?Leu?Glu?Glu?Val?Thr?Leu?Glu?Leu?Leu?Pro?Glu?Thr?Leu?Gln?Ala
85??????????????????90??????????????????95Lys?Asn?Arg?Trp?Met?Ile?Lys?Thr?Ala?Lys?Lys?Ser?Phe?Val?Val?Ser
100?????????????????105?????????????????110Ala?Ala?Ser?Ala?Thr?Glu?Arg?Gln?Glu?Trp?Ile?Ser?His?Ile?Glu?Glu
115?????????????????120?????????????????125Cys?Val?Arg?Arg?Gln?Leu?Lys?Ala?Thr?Gly?Arg?Pro?Pro?Ser?Thr?Glu
130?????????????????135?????????????????140His?Ala?Ala?Pro?Trp?Ile?Pro?Asp?Lys?Ala?Thr?Asp?Ile?Cys?Met?Arg145?????????????????150?????????????????155?????????????????160Cys?Thr?Gln?Thr?Arg?Phe?Ser?Ala?Leu?Thr?Arg?Arg?His?His?Cys?Arg
165?????????????????170?????????????????175Lys?Cys?Gly?Phe?Val?Val?Cys?Ala?Glu?Cys?Ser?Arg?Gln?Arg?Phe?Leu
180?????????????????185?????????????????190Leu?Pro?Arg?Leu?Ser?Pro?Lys?Pro?Val?Arg?Val?Cys?Ser?Leu?Cys?Tyr
195?????????????????200?????????????????205Arg?Glu?Leu?Ala?Ala?Gln?Gln?Arg?Gln?Glu?Glu?Ala?Glu?Glu?Gln?Gly
210?????????????????215?????????????????220Ala?Gly?Ser?Pro?Arg?Gln?Pro?Ala?His?Leu?Ala?Arg?Pro?Ile?Cys?Gly225?????????????????230?????????????????235?????????????????240Ala?Ser?Ser?Gly?Asp?Asp?Asp?Asp?Ser?Asp?Glu?Asp?Lys?Glu?Gly?Ser
245?????????????????250?????????????????255Arg?Asp?Gly?Asp?Trp?Pro?Ser?Ser?Val?Glu?Phe?Tyr?Ala?Ser?Gly?Val
260?????????????????265?????????????????270Ala?Trp?Ser?Ala?Phe?His?Ser
275＜210〉3＜211〉30＜212〉DNA＜213〉primer＜400〉3gcgaattcat ggtggaccac ttggccaaca 30＜210〉4＜211〉29＜212〉DNA＜213〉primer＜400〉4gcaagctttc agctgtggaa agcagacca 29＜210〉5＜211〉25＜212〉DNA＜213〉primer＜400〉5cgacgaggac aaggagggca gcagg 25＜210〉6＜211〉25＜212〉DNA＜213〉primer＜400〉6gtgggtgttc tggggcttcc tgaag 25＜210〉7＜211〉29＜212〉DNA＜213〉primer＜400〉7acgaattccg atggtggacc acttggcca 29＜210〉8＜211〉29＜212〉DNA＜213〉primer＜400〉8acgaattcgc tcaggaggcc atctggagc 29
Claims (10)
1. isolating people's withered induced protein APPD polypeptide is characterized in that it comprises: polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative with SEQID NO:2 aminoacid sequence.
2. polypeptide as claimed in claim 1 is characterized in that, this polypeptide is selected from down group:
(a) has the polypeptide of SEQ ID NO:2 aminoacid sequence;
(b) SEQ ID NO:2 aminoacid sequence is formed through replacement, disappearance or the interpolation of one or more amino-acid residues, and have inducing cell transfer the function of dying by (a) polypeptides derived.
3. isolating polynucleotide is characterized in that, it comprises a nucleotide sequence, and this nucleotide sequence is shown at least 70% homogeny with a kind of nucleotides sequence that is selected from down group:
(a) coding is as the polynucleotide of polypeptide as described in claim 1 and 2;
(b) with polynucleotide (a) complementary polynucleotide.
4. polynucleotide as claimed in claim 3 is characterized in that this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ IDNO:2.
5. polynucleotide as claimed in claim 3 is characterized in that, the sequence of these polynucleotide is selected from down a kind of of group:
(a) has the sequence of 71-907 position among the SEQ ID NO:1;
(b) has the sequence of 1-1698 position among the SEQ ID NO:1.
6. a carrier is characterized in that, it contains the described polynucleotide of claim 3.
7. a genetically engineered host cell is characterized in that, contains the described carrier of claim 6.
8. preparation method with polypeptide of people's withered induced protein APPD polypeptide active is characterized in that this method comprises:
(a) under the condition that is fit to expressing human withered induced protein APPD polypeptide, cultivate the described host cell of claim 7;
(b) from culture, isolate polypeptide with people's withered induced protein APPD polypeptide active.
9. energy and the described people's withered induced protein of claim 1 APPD polypeptid specificity bonded antibody.
10. a pharmaceutical composition is characterized in that, it contains the described polypeptide of claim 1 and the pharmaceutically acceptable carrier of safe and effective amount.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA021365261A CN1475502A (en) | 2002-08-16 | 2002-08-16 | New withered induced protein, its coded sequence and use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA021365261A CN1475502A (en) | 2002-08-16 | 2002-08-16 | New withered induced protein, its coded sequence and use |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1475502A true CN1475502A (en) | 2004-02-18 |
Family
ID=34146519
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA021365261A Pending CN1475502A (en) | 2002-08-16 | 2002-08-16 | New withered induced protein, its coded sequence and use |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1475502A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009030094A1 (en) * | 2007-09-06 | 2009-03-12 | Zhejiang University | Function and use of new lysosome-associated apoptosis-inducing protein containing ph and fyve domains (lapf) |
| CN102603865A (en) * | 2011-01-24 | 2012-07-25 | 罗楹 | Dipeptide derivative and application of the dipeptide derivative |
| CN112043819A (en) * | 2019-06-05 | 2020-12-08 | 中国人民解放军第二军医大学 | Use of LAPF and related substances for anti-infection |
-
2002
- 2002-08-16 CN CNA021365261A patent/CN1475502A/en active Pending
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009030094A1 (en) * | 2007-09-06 | 2009-03-12 | Zhejiang University | Function and use of new lysosome-associated apoptosis-inducing protein containing ph and fyve domains (lapf) |
| CN102603865A (en) * | 2011-01-24 | 2012-07-25 | 罗楹 | Dipeptide derivative and application of the dipeptide derivative |
| CN102603865B (en) * | 2011-01-24 | 2015-09-30 | 罗楹 | Dipeptidase derivant and application thereof |
| CN112043819A (en) * | 2019-06-05 | 2020-12-08 | 中国人民解放军第二军医大学 | Use of LAPF and related substances for anti-infection |
| CN112043819B (en) * | 2019-06-05 | 2022-01-14 | 中国人民解放军第二军医大学 | Use of LAPF and related substances for anti-infection |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1308346C (en) | Novel human phosphotidylethanolamine binding protein, its coding sequence and application | |
| CN1475502A (en) | New withered induced protein, its coded sequence and use | |
| CN1371916A (en) | Human siali acid conjugated immunoglobulin-like agglutinant, its coding sequence and use | |
| CN1477118A (en) | Novel DnaJ/Hsp40 molecule DC-DJIII, its coding sequence and application | |
| CN1475501A (en) | New type human bone marrow substrate cell source 1 type phosphoric acid enzyme inhibition factor, its coded sequence and use | |
| CN1223607C (en) | Human calcium ion/calmodulin dependent protein kinase II inhibitory protein and its application | |
| CN100425695C (en) | Novel human Rab GTP enzyme, its coding sequence and application | |
| CN1475499A (en) | New type human cell signal related protein, its code sequence and use | |
| CN100408597C (en) | Human calcium ion / calmodulin deopendent protein kinase II inhibitory protein alpha, its coded sequence and use | |
| CN100480263C (en) | Immunosuppressive receptor derived from dendritic cell, coding sequence and uses thereof | |
| CN100400658C (en) | New type human death resist protein, its coded sequence and use | |
| CN1475500A (en) | New type human marrow differentiation tagged object its coded sequence and use | |
| CN1477115A (en) | Novel human cyclin, its coding sequence and application | |
| CN1325874A (en) | Human C-type lectin-like receptor and its coding sequence and application | |
| CN1477114A (en) | Immunoglobulin sample receptor originated from human dendritic cell, its coding sequence and application | |
| CN100523189C (en) | Function and use of human immune cell inhibition acceptor KLRL1 | |
| CN1299823A (en) | New human cell factor and its code sequence and use | |
| CN100443501C (en) | Mitochondria traffic protein molecule for human marrow stromal cell and sequence encoding same and use thereof | |
| CN1385441A (en) | Novel human lymphokine, its coding sequence and use | |
| CN1475503A (en) | New type human bone marrow substrate cell source growth inhibiting factor, its coded sequence and use | |
| CN1477119A (en) | Novel Human cysteine proteinase inhibitor sample molecule, its coding sequence and application | |
| CN1477116A (en) | Novel human secretion-related membrane protion, its coding sequence and its application | |
| CN1299827A (en) | New human CD20 homolgous molecule and its code sequence and use | |
| CN1171901C (en) | New interferon-like protein and its code sequence and use | |
| CN1778816B (en) | Human cell surface membrane molecule and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |