CN1475499A - New type human cell signal related protein, its code sequence and use - Google Patents

Abstract

A pleckstrin homology domain-containing protein (PHDP), its coding polyneucleotide, the process for recombinating said protein, and the application of said PHDP and its polynucleotide coding sequence in diagnosing and treating cancer are disclosed.

Description

New type human cell signal related protein, its encoding sequence and purposes

Technical field

The invention belongs to biotechnology and medical field, specifically, the present invention relates to new human cell signal associated molecule PHDP polypeptide and polynucleotide encoding sequence thereof.The invention still further relates to the purposes and the preparation of these polynucleotide and polypeptide.PHDP is a soluble proteins in a kind of new cell relevant with cell signaling, has the cytolemma transposition activity of PH structural domain mediation.

Background technology

For multicellular organism, the correct conduction of iuntercellular and cell interior signal is crucial to keeping each intercellular mutual coordination.Cell interior signal conduction has number of ways, turns to a series of signal conductive process of feature especially with protein phosphatase, and is because of expression and the regulation and control that relate to cytogene, relevant with the victory physiological process with many pathology and cause people's attention.Discern mutually between the different signaling molecules, transmit signal like clockwork, not only depend on the peculiar kinases of signaling molecule district (catalysis target molecule particular amino acid residue phosphorylation), more depend on each signaling molecule specific mutual identification and combining site.These identifications can mainly be divided into 3 classes: Src Homology 2 (SH2) structural domain, Src Homology 3 (SH3) structural domain and Pleckstrin Homology (PH) structural domain with combining site.

PH structural domain (pleckstrin homeodomain) is a kind of functional region of approximately being made up of 120 amino acid that is present in multiple signal conductive protein and the cytoskeleton related protein.Because one section tumor-necrosis factor glycoproteins in they and the pleckstrin (pleckstrin) has homology, so be called Pleckstrin Homology (PH) structural domain.Frequently occurring of this homologous region is that Mayer etc. finds when carrying out the data analysis of computer gene pool with Haslam etc. respectively at 1993.The PH structural domain is the important component part of intracellular signal conduction associated protein.The protein that contains the PH structural domain that has been found that at present has kind more than 100, be mainly the molecule that some participate in signal transduction, belong to GAP/GRF/GEF (GTP exchange factor), albumen serine/threonine kinases, protein tyrosine kinase, Phospholipase C (PLC), growth factor receptor binding protein precursor (Grb) and yeast secreted protein families such as (Sec), wherein most of this proteinoid is relevant with the signal transduction downstream events of surface of cell membrane acceptor.The extensive distribution prompting of PH structural domain in signal transducers, it may with SH2 and SH3 structure and function class seemingly, lead interaction between the signaling molecule at the cell signalling intermediary of network.The present PH structural domain that studies show that has multiple functionally active, comprises in conjunction with G albumen β γ subunit, protein kinase C (PKC) and phosphoinositide etc., thus the interaction of participation protein-protein and protein-lipid.

On secondary structure, the PH structural domain by two almost orthogonal, contain the β lamella of two antiparallel 3 strands and 4 strands and the α spiral of a C end respectively and constitute.Have 6 conservative regions in the PH structural domain, lay respectively between 1-13,14-23,24-31,32-55,56-66 and the 67-88, wherein the conservative property of the 3rd conserved regions is the poorest.Contain several conservative hydrophobic residues in each conserved regions, show that each subdomain has one or more secondary structure elements.Inserted by the amino-acid residue of different numbers between the conserved regions and be interrupted, these insert positions may be the peptide ring that comes out in the protein structure.Length, especially β 1/ β 2 of ring, the ring between β 3/ β 4, β 6/ β 7 alter a great deal in different PH structural domains, may be relevant with the combination of part.The homology of PH structural domain on primary structure in the different proteins and not really high, but to its space structure discover that its peptide chain backbone fold mode is basic identical, so just structurally confirmed that the PH structural domain is the real functional structure territory of a class.

Along with to the going deep into of the structure that comprises the PH domain protein and biological function research, it is found that the PH structural domain may all bring into play critical function in the various kinds of cell signal event.The PH structural domain can cause unusually with signal transduction pathway in other molecules must interact unusually, thereby can cause multiple heredopathia.Relevant as the sudden change of the R28C in tyrosine protein kinase Btk (bruton tyrosine kinase) the PH structural domain with the sex chromosome linksystem immunodeficiency symptoms (XID) of XID mouse.In gamma Globulin mass formed by blood stasis (XLA) at the bottom of the human sex chromosome linksystem, also find several site mutations in the PH structural domain of Btk.

In view of the vital role of signal related protein, this area presses for the new cell signal related protein of exploitation.

Summary of the invention

The purpose of this invention is to provide a kind of new human cell signal related protein PHDP albumen with and fragment, analogue and derivative.

Another object of the present invention provides the polynucleotide of these polypeptide of coding.

Another object of the present invention provides the method for these polypeptide of production and the purposes of this polypeptide and encoding sequence.

In a first aspect of the present invention, novel isolated PHDP polypeptide is provided, this polypeptide is the people source, it comprises: polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative with SEQ ID NO:2 aminoacid sequence.Preferably, this polypeptide is selected from down group: the polypeptide that (a) has SEQ ID NO:2 aminoacid sequence; (b) SEQ ID NO:2 aminoacid sequence is formed through replacement, disappearance or the interpolation of one or more amino-acid residues, and under the serum stimulation situation, take place the cytolemma transposition by (a) polypeptides derived.

In a second aspect of the present invention, the polynucleotide of isolating these polypeptide of coding are provided, these polynucleotide comprise a nucleotide sequence, and this nucleotide sequence is shown at least 40% homogeny with a kind of nucleotides sequence that is selected from down group: (a) polynucleotide of the above-mentioned human PHD P of coding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 84-1553 position among the SEQ ID NO:1; (b) has the sequence of 1-3675 position among the SEQ ID NO:1.

In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.

In a fourth aspect of the present invention, provide preparation to have the method for the polypeptide of human PHD P protein-active, this method comprises: (a) under the proteic condition of suitable expressing human PHDP, cultivate the above-mentioned host cell that is transformed or transduce; (b) from culture, isolate polypeptide with human PHD P protein-active.

In a fifth aspect of the present invention, provide and above-mentioned human PHD P polypeptid specificity bonded antibody.The nucleic acid molecule that can be used for detecting also is provided, and it contains a successive 10-3675 Nucleotide in the above-mentioned polynucleotide.

In a sixth aspect of the present invention, the compound of simulation, promotion, antagonism human PHD P polypeptide active is provided, and the compound that suppresses human PHD P polypeptide expression.The method of screening and/or prepare these compounds also is provided.Preferably, this compound is encoding sequence or its segmental antisense sequences of human PHD P polypeptide.

In a seventh aspect of the present invention, provide and whether had the proteic method of PHDP in the test sample, it comprises: sample is contacted with the proteic specific antibody of PHDP, observe whether form antibody complex, formed antibody complex and just represented to exist in the sample PHDP albumen.

In a eighth aspect of the present invention, a kind of disease relevant with human PHD P polypeptide unconventionality expression or method of disease susceptibility of detecting is provided, this method comprises: whether have sudden change in the nucleotide sequence of detection coding said polypeptide.

In a ninth aspect of the present invention, provide the purposes of polypeptide of the present invention and encoding sequence.Polypeptide for example of the present invention can be used to screen the agonist that promotes human PHD P polypeptide active, and perhaps screening suppresses the antagonist of human PHD P polypeptide active or is used to the peptide finger print identification.The proteic encoding sequence of human PHD P of the present invention or its fragment can be used as primer and be used for pcr amplification reaction, perhaps are used for hybridization as probe, perhaps are used to make gene chip or microarray.

In a tenth aspect of the present invention, a kind of pharmaceutical composition is provided, it contains human PHD P polypeptide of the present invention or its agonist, antagonist and the pharmaceutically acceptable carrier of safe and effective amount.These pharmaceutical compositions can be treated illnesss such as tumour, inflammation, neural system and cardiovascular diseases.

Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.

Description of drawings

Fig. 1 is the proteic PH structural domain of human PHD P of the present invention and other family members' a PH structural domain homology comparison diagram.The amino acid identical with PH structural domain unanimity (consensus) sequence marks with grey body between a plurality of sequences, and similar amino acid marks with square frame.The sequence top is α spiral and β lamella position

Fig. 2 is the hydrophobicity graphic representation of the proteic Kyte-doolitte hydrophobicity analysis of human PHD P of the present invention.

Fig. 3 is a human PHD P RT-PCR expression analysis of the present invention.

Fig. 4 is the shown distribution of human PHD P Northern blot hybridization of the present invention.Results suggest PHDP is the molecule that a kind of tool particular organization distributes.

Fig. 5 is the Western engram analysis of human PHD P protein expression of the present invention, and prompting PHDP protein expression is in some tumour cell.

Fig. 6 A-6D is the proteic immunofluorescence analysis of human PHD P of the present invention, and prompting PHDP has the cytolemma transposition activity of PH structural domain mediation.Fig. 6 A has shown the proteins encoded of three kinds of different PHDP-GFP fusion expression vectors: total length (FL), 361 amino acid (C361) of N end PH structural domain (N105) and the no PH structural domain of C end; With VNG-FL (Fig. 6 B), VNG-N105 (Fig. 6 C) and VNG-C361 (Fig. 6 D) transfectional cell, after serum hunger again with 20% serum stimulation.Take the photograph photo in per 60 second beats of Confocal microscopically.

Embodiment

Compare through extensive random sequencing and homology, the inventor is separated to a full-length cdna from human bone marrow substrate cell cDNA library, one of the ORF codified that it comprised contains the albumen of Pleckstrin Homology (PH) structural domain, should new unnamed gene be PHDP (Pleckstrin HomologyDomain-containing Protein) therefore.Infer albumen TNF cell intracellular domain interaction protein (TNFintracellular domain-interacting protein) height homology for one of this molecule and people CK2 interaction protein (CK2 interactingprotein) and mouse source, especially higher in PH structural domain near zone homology.PHDP all has expression in multiple health adult tissue and tumour cell.Show that through fluorescent microscope and Confocal microscopical analysis the green fluorescent protein of PHDP (GFP) fusion rotein can be transferred to rapidly on the cytolemma under 20% serum stimulation; And the film transposition that the PHDP albumen of disappearance PH structural domain does not show signal.This prompting PHDP albumen can by with the interaction that mediates signaling molecule that combine of membrane phospholipid.

The albumen of human cell signal related protein PHDP and the known PH of comprising structural domain has higher homology, and induces down at serum at least, and the PH structural domain can mediate the cytolemma transposition of PHDP.Therefore, this prompting PHDP with other comprise albumen of PH structural domain the same can by with the interaction that mediates signaling molecule that combines of membrane phospholipid, thereby participate in the signal conduction function of cell, regulate and control multiple physiology and pathology activity, play a significant role, and may grow at tissue growth, have important development and application aspect the immunodiagnosis in a plurality of fields such as antitumor and immunologic function adjusting and the immunotherapy and be worth.

In the present invention, term " PHDP albumen ", " PHDP polypeptide " or " the cell signal related protein PHDP that comprises the pleckstrin homeodomain " are used interchangeably, and all refer to have albumen or the polypeptide that the people comprises the aminoacid sequence (SEQ ID NO:2) of the cell signal related protein PHDP of pleckstrin homeodomain.

As used herein, " isolating " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.

As used herein, " isolating PHDP albumen or polypeptide " is meant that the PHDP polypeptide is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying PHDP albumen of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.

Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.

The present invention also comprises the proteic fragment of human PHD P, derivative and analogue.As used herein, term " fragment ", " derivative " are meant with " analogue " and keep identical biological function of natural human PHDP albumen of the present invention or active polypeptide basically.Polypeptide fragment of the present invention, derivative or analogue can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferred conservative amino acid residue), and the amino-acid residue of such replacement can be also can not encoded by genetic code, or (ii) in one or more amino-acid residues, has a polypeptide of substituted radical, or (iii) mature polypeptide and another compound (such as the compound that prolongs the polypeptide transformation period, polyoxyethylene glycol for example) merges formed polypeptide, or (iv) additional aminoacid sequence is fused to this peptide sequence and the polypeptide that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying, or with the fusion rotein of the segmental formation of antigen I gG).According to the instruction of this paper, these fragments, derivative and analogue belong to the known scope of those skilled in the art.

In the present invention, term " human PHD P polypeptide " refers to have the SEQ ID NO.2 polypeptide of sequence of human PHD P protein-active.This term also comprises having and variant form human PHD P albumen identical function, SEQ ID NO.2 sequence.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises proteic active fragments of human PHD P and reactive derivative.

The variant form of this polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, under high or low tight degree condition can with the coded albumen of the DNA of human PHD P DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-human PHD P polypeptide to obtain.The present invention also provides other polypeptide, as comprises human PHD P polypeptide or its segmental fusion rotein.Except the polypeptide of total length almost, the present invention has also comprised the soluble fragments of human PHD P polypeptide.Usually, this fragment have human PHD P peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.

Invention also provides the analogue of human PHD P albumen or polypeptide.The difference of these analogues and natural human PHDP polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.

(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.

In the present invention, " human PHD P albumen conservative property variation polypeptide " refers to compare with the aminoacid sequence of SEQ ID NO:2, has 10 at the most, preferably at the most 8, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best.These conservative property variation polypeptide preferably carry out the amino acid replacement according to table 1 and produce.

Table 1

Initial residue	Representational replacement	The preferred replacement
			Ala(A)	Val；Leu；Ile	?Val
Arg(R)	Lys；Gln；Asn	?Lys
			Asn(N)	Gln；His；Lys；Arg	?Gln
Asp(D)	Glu	?Glu
			Cys(C)	Ser	?Ser
Gln(Q)	Asn	?Asn
			Glu(E)	Asp	?Asp
Gly(G)	Pro；Ala	?Ala
			His(H)	Asn；Gln；Lys；Arg	?Arg

Ile(I)	Leu；Val；Met；Ala；Phe	?Leu
			Leu(L)	Ile；Val；Met；Ala；Phe	?Ile
Lys(K)	Arg；Gln；Asn	?Arg
			Met(M)	Leu；Phe；Ile	?Leu
Phe(F)	Leu；Val；Ile；Ala；Tyr	?Leu
			Pro(P)	Ala	?Ala
Ser(S)	Thr	?Thr
			Thr(T)	Ser	?Ser
Trp(W)	Tyr；Phe	?Tyr
			Tyr(Y)	Trp；Phe；Thr；Ser	?Phe
Val(V)	Ile；Leu；Met；Phe；Ala	?Leu

Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.As used herein, " varient of degeneracy " is meant that in the present invention coding has the protein of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.

The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence of an encoding mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.

Term " polynucleotide of coded polypeptide " can be the polynucleotide that comprise this polypeptide of encoding, and also can be the polynucleotide that also comprise additional code and/or non-coding sequence.

The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.

The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 50%, preferably at least 70%, the polynucleotide of at least 80% homogeny more preferably.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 90%, be more preferably 95% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.

The invention still further relates to nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " contains 15 Nucleotide at least, better is at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid to determine and/or the proteic polynucleotide of separation coding PHDP.

Polypeptide among the present invention and polynucleotide preferably provide with isolating form, more preferably are purified to homogeneous.

Human PHD P Nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.

In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.

In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.

At present, can be fully obtain the dna sequence dna of code book invention albumen (or its fragment, or derivatives thereof) by chemosynthesis.This dna sequence dna can be introduced in various existing dna moleculars as known in the art (or as carrier) and the cell then.In addition, also can will suddenly change and introduce in the protein sequence of the present invention by chemosynthesis.

Use method (Saiki, the et al. Science1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to obtain the cDNA of total length from the library, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.

The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with carrier of the present invention or PHDP albumen coded sequence, and the method that produces polypeptide of the present invention through recombinant technology.

Recombinant DNA technology (Science, 1984 by routine; 224:1431), can utilize polymerized nucleoside acid sequence of the present invention to can be used to express or produce the PHDP polypeptide of reorganization.In general following steps are arranged:

(1). with the polynucleotide (or varient) of coding human PHD P polypeptide of the present invention, or transform or the transduction proper host cell with the recombinant expression vector that contains these polynucleotide;

(2). the host cell of in suitable medium, cultivating;

(3). separation, protein purification from substratum or cell.

Among the present invention, human PHD P polynucleotide sequence can be inserted in the recombinant expression vector.Term " recombinant expression vector " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carriers.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on T7 of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J BioChem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier can be used.A key character of expression vector is to contain replication orgin, promotor, marker gene and translation controlling elements usually.

Method well-known to those having ordinary skill in the art can be used to make up and contains human PHD P DNA sequences encoding and suitable transcribing/the translate expression vector of control signal.These methods comprise (Sambroook, et al.Molecular Cloning, a LaboratoryManual, cold Spring Harbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; Lambda particles phage P _LPromotor; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in protokaryon or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.

In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance.

Comprise the carrier of above-mentioned suitable dna sequence dna and suitable promotor or control sequence, can be used to transform appropriate host cell, so that it can marking protein.

Host cell can be a prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; The bacterial cell of Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; The insect cell of fruit bat S2 or Sf9; The zooblast of CHO, COS, 293 cells or Bowes melanoma cells etc.

When polynucleotide of the present invention are expressed in higher eucaryotic cells, be enhanced if will make to transcribe when in carrier, inserting enhancer sequence.Enhanser is the cis acting factor of DNA, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.

Persons skilled in the art all know how to select appropriate carriers, promotor, enhanser and host cell.

Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results ₂Method is handled, and used step is well-known in this area.Another kind method is to use MgCl ₂If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.

The transformant that obtains can be cultivated with ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.

The extracellular can be expressed or be secreted into to recombinant polypeptide in the above methods in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation handles, with protein precipitant handle (salt analysis method), centrifugal, the broken bacterium of infiltration, superly handle, the combination of super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.

The human PHD P albumen or the polypeptide of reorganization are of use in many ways.These purposes include, but is not limited to: the direct disease due to the low or forfeiture and be used to screen and promote or antibody, polypeptide or other part of antagonism PHDP protein function as pharmacological agent PHDP protein function.The peptide molecule that can suppress or stimulate human PHD P protein function that can be used for seeking therapeutic value with the recombinant human PHDP protein screening peptide library of expressing.

On the other hand, the present invention also comprises human PHD P DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into human PHD P gene product or fragment.Preferably, refer to that those can combine with human PHD P gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress the proteic molecule of human PHD P, comprise that also those do not influence the antibody of human PHD P protein function.The present invention also comprise those can with modify or without the human PHD P gene product bonded antibody of modified forms.

The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab) ₂Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule (people such as Ladner, U.S. Patent No. 4,946,778); Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.

Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the human PHD P gene product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing human PHDP albumen or its have antigenic segmental cell and can be used to immune animal and produce antibody.Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology prepare (see people such as Kohler, Nature256; 495,1975; People such as Kohler, Eur.J.Immunol.6:511,1976; People such as Kohler, Eur.J.Immunol.6:292,1976; People such as Hammerling, In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, N.Y., 1981).Antibody of the present invention comprises the antibody that can block human PHD P protein function and the antibody that does not influence human PHD P protein function.Each antibody-like of the present invention can utilize the fragment or the functional zone of human PHD P gene product, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of human PHD P gene product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).

The proteic antibody of anti-human PHD P can be used in the immunohistochemistry technology, detects the human PHD P albumen in the biopsy specimen.In addition, with the also available labelled with radioisotope of the protein bound monoclonal antibody of human PHD P, inject in the body and can follow the tracks of its position and distribution.This radiolabeled antibody can be used as a kind of atraumatic diagnostic method and is used for the location of tumour cell and has judged whether transfer.

Antibody among the present invention can be used for treating or prevention and the relevant disease of human PHD P albumen.The antibody that gives suitable dosage can stimulate or block proteic generation of human PHD P or activity.

Antibody also can be used for being designed to the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of human PHD P albumen high-affinity can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing the cell (for example lymph-node cell etc.) of human PHD P protein positive.

The production of polyclonal antibody available human PHD P albumen or polypeptide immune animal, as rabbit, mouse, rat etc.Multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.

Utilize albumen of the present invention,, can filter out with PHDP albumen interactional material takes place, as part, inhibitor, agonist or antagonist etc. by various conventional screening methods.

Albumen of the present invention and antibody thereof, inhibitor, agonist, antagonist or acceptor etc. when using (administration) in treatment, can provide different effects.Usually, can these materials are formulated in nontoxic, inert and the pharmaceutically acceptable aqueous carrier medium, wherein pH is about 5-8 usually, and preferably pH is about 6-8, although the pH value can be with being changed to some extent by preparation Substance Properties and illness to be treated.The pharmaceutical composition for preparing can carry out administration by conventional route, comprising (but being not limited to): intramuscular, intraperitoneal, intravenously, subcutaneous, intracutaneous or topical.

Polypeptide of the present invention or its agonist or antagonist can be directly used in or assist disease treatment, for example, are used for tumour, inflammation, the treatment of neural system and cardiovascular diseases aspect.In use, also can use the other treatment agent simultaneously, as IFN-α, IFN-β, TNF-α, TNF-β etc.

The present invention also provides a kind of pharmaceutical composition, and it contains PHDP polypeptide of the present invention or its agonist, antagonist and the pharmaceutically acceptable carrier or the vehicle of safe and effective amount.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.Pharmaceutical composition of the present invention can be made into the injection form, for example is prepared by ordinary method with the physiological saline or the aqueous solution that contains glucose and other assistant agents.Pharmaceutical composition such as tablet and capsule can be prepared by ordinary method.Pharmaceutical composition such as injection, solution, tablet and capsule should be made under aseptic condition.The dosage of activeconstituents is the treatment significant quantity, for example every day about 1 microgram/kg body weight-Yue 5 mg/kg body weight.In addition, polypeptide of the present invention also can use with the other treatment agent.

When making pharmaceutical composition, be that the PHDP albumen of safe and effective amount or its antagonist, agonist are applied to Mammals, wherein this safe and effective amount is usually at least about 10 micrograms/kg body weight, and in most of the cases be no more than about 8 mg/kg body weight, preferably this dosage is about 10 micrograms/kg body weight-Yue 1 mg/kg body weight.Certainly, concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.

The proteic polynucleotide of human PHD P also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treating because cell proliferation, growth or the metabolic disturbance due to the proteic expression of PHDP of the proteic nothing expression of PHDP or unusual/non-activity.The PHDP albumen that the gene therapy vector (as virus vector) of reorganization can be designed to express variation is to suppress endogenic PHDP protein-active.Deriving from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. can be used for the PHDP transgenosis to cell.The method that structure carries the recombinant viral vector of PHDP gene is found in existing document (Sambrook, et al.).Recombinant human PHDP gene can be packaged in the liposome in addition, and then is transferred in the cell.

Suppress the oligonucleotide (comprising sense-rna and DNA) of human PHD P mRNA and ribozyme also within the scope of the invention.Ribozyme is the enzyme sample RNA molecule that a kind of energy specificity is decomposed specific RNA, and its mechanism of action is to carry out the endonuclease effect after ribozyme molecule and the hybridization of complementary target RNA-specific.The RNA of antisense and DNA and ribozyme can obtain with existing any RNA or DNA synthetic technology, as the technology widespread use of solid phase phosphoamide chemical synthesis synthetic oligonucleotide.Antisense rna molecule can be transcribed acquisition by the dna sequence dna of this RNA that encodes in external or body.This dna sequence dna has been incorporated into the downstream of rna polymerase promoter of carrier.In order to increase the stability of nucleic acid molecule, available several different methods is modified it, and as increasing the sequence length of both sides, the connection between the ribonucleoside is used phosphoric acid thioester bond or peptide bond but not phosphodiester bond.

Polynucleotide imports tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.

Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with the protein bound peptide molecule of human PHD P obtains.During screening, must carry out mark to human PHD P protein molecular.

The invention still further relates to the diagnostic testing process of quantitative and detection and localization human PHD P protein level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.The human PHD P protein level that is detected in the test can be with laying down a definition the importance of human PHD P albumen in various diseases and be used to the disease of diagnosing PHDP albumen to work.

Whether having the proteic method of PHDP in a kind of detection test sample is to utilize the proteic specific antibody of PHDP to detect, and it comprises: sample is contacted with the PHDP protein specific antibody; Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample PHDP albumen.

The proteic polynucleotide of PHDP can be used for the diagnosis and the treatment of PHDP protein related diseases.Aspect diagnosis, the proteic polynucleotide of PHDP can be used for detecting the proteic expression of PHDP PHDP abnormal exprssion whether or under morbid state.Can be used for the hybridization of biopsy specimen to judge the proteic abnormal expression of PHDP as the PHDPDNA sequence.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.Carry out RNA-polymerase chain reaction (RT-PCR) amplification in vitro with the special primer of PHDP albumen and also can detect the proteic transcription product of PHDP.

The sudden change that detects the PHDP gene also can be used for the disease of diagnosing PHDP albumen relevant.The form of PHDP protein mutation comprises that the point mutation compared with normal wild type PHDP dna sequence dna, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.

Sequence of the present invention identifies it also is valuable to karyomit(e).In brief, the proteic cDNA of PHDP prepares PCR primer (preferred 15-35bp) according to the present invention, sequence can be positioned on the karyomit(e).Then, these primers are used for the somatocyte hybrid cell that the PCR screening contains each bar human chromosome.Have only those hybrid cells that contain corresponding to the people's gene of primer can produce the fragment of amplification.

In case sequence is positioned to chromosome position accurately, the physical location of this sequence on karyomit(e) just can be associated with the gene map data.These data for example are found in, V.Mckusick, MendelianInheritance in Man (can by with the online acquisition of Johns Hopkins University Welch MedicalLibrary).Can pass through linkage analysis then, determine gene and navigated to relation between the disease on the chromosomal region already.

In an example of the present invention, a kind of isolating polynucleotide are provided, its coding has the polypeptide of aminoacid sequence shown in the SEQ IDNO:2.Polynucleotide of the present invention are isolated from human bone marrow substrate cell cDNA library.Its sequence is shown in SEQ ID NO:1, and the polynucleotide sequence total length that it comprises is 3675 bases, and its open reading frame is positioned at the 84-1553 position, and the coding total length is 490 amino acid whose human PHD P albumen (SEQ ID NO:2).PHDP albumen structurally contains a Pleckstrin Homology (PH) structural domain.PHDP and people CK2 interaction protein have certain homology, and the similarity of complete sequence (Similarity) is 43%, and consistence (Identity) is 32%.Infer albumen TNF cell intracellular domain interaction protein for one of PHDP and mouse source and also show homology, especially higher in PH structural domain near zone homology.RT-PCR and Western analysis revealed, hematopoiesis is cell such as U-937, K-562, KG-1, MOLT-4, NAMALWA and Reh cell etc., and clones such as tumor cell line such as lung cancer, adenocarcinoma of colon, mammary cancer, cervical cancer, prostate cancer, epithelial cancer are all expressed PHDP in various degree.PHDP mRNA expression ratio is more extensive in normal adult tissue, as tissues such as heart, skeletal muscle, thymus gland, spleen, liver, Tiroidina, lymphoglandula, marrow.Cytolemma transposition test shows, induces down at serum at least, and the cytolemma transposition of PHDP is mediated by the PH structural domain.The research prompting of having carried out, PHDP may be similar to other homologous proteins that comprise the PH structural domain, by with the interaction that mediates signaling molecule that combines of albumen or film fat, participate in cell signaling, regulate and control multiple physiology and pathology activity, the regulation and control of tool potential cytodifferentiation differentiation and development, antitumor action.Therefore, PHDP albumen or its relevant antagonist, agonist etc. can be diseases such as treatment tumour, neural system and heredity new immunodiagnosis and targeted therapy approach are provided, thereby have great application prospect.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

Embodiment 1: the clone of human PHD P cDNA

Extract the total RNA of human bone marrow substrate cell with Trizol reagent (Life Technologies company).Then, from total RNA, separate poly (A) mRNA.Poly (A) mRNA after reverse transcription forms cDNA, is cloned test kit (Life Technologies) with SuperScriptII.CDNA fragment orientation is inserted on the multiple clone site of carrier, transforms DH5 α bacterium and form the cDNA plasmid library.Measure the sequence of random choose clone's 5 ' end with dideoxy method.CDNA sequence and the existing public dna sequence data storehouse measured are compared, found that a cDNA clone's dna sequence dna is new full-length cDNA.By synthetic a series of primers the contained dna sequence dna of new clone is carried out two-way mensuration.Computer Analysis shows that cloning contained full-length cDNA is a new cDNA sequence (shown in SEQ ID NO:1), the new protein (shown in SEQ ID NO:2) of encoding.This protein is named as human cell signal related protein PHDP, its encoding gene called after human PHD P gene.

Sequence SEQ ID NO:1 total length is 3675bp, comprises 5 ' the end non-coding region of 83bp and 3 ' the end non-coding region of 2119bp, and coding contains 490 amino acid whose polypeptide.Calculate in theory not that the molecular weight of glycosylated ripe molecule is about 53.35 kD, calculating iso-electric point is 5.19.It is soluble proteins that the proteic Kyte-doolitte hydrophobicity analysis of PHDP (Fig. 2) is pointed out this albumen.

BLAST analyzes (Fig. 1) and shows that they are different with known, and with people CK2 interaction protein sequence homology, similarity is 43%, and consistence is 32%.In addition, PHDP and other comprise the albumen of PH structural domain such as TNF cell intracellular domain interaction protein that mouse is inferred show higher level in the PH structural domain homology.

Embodiment 2: carry out the cell expressing analysis of human PHD P with the RT-PCR method

Extract the cell total rna that is in the corresponding clone of logarithmic phase with Trizol reagent, get 5 μ g cell total rnas and 1 μ g Oligo-dT ₁₂- ₁₈Mix, carry out reverse transcription.The reverse transcription system is 20 μ l, and reaction adds 80 μ l ddH after finishing ₂O dilutes.The pcr amplification primer is as follows: adopted primer 5 ' GCA GAG AGT GCAGAA CCG T (SEQ ID NO:3) is arranged, antisense primer 5 ' T TCT CCT GTA GAG GGT CAC (SEQ IDNO:4), simultaneously with beta-actin as positive control.The PCR reaction volume is 50 μ l, wherein contain reverse transcription template 10 μ l, 0.5mM primer, 0.2mM dNTP and 1U rTaq archaeal dna polymerase (Takara Inc.), the amplification parameter be 95 ℃ 15 seconds, 57 ℃ 30 seconds, 72 ℃ 30 seconds, capable 1.5% agarose gel electrophoresis of PCR product is tentatively confirmed after 28 circulations.The dna sequence analysis result shows that the DNA sequences encoding of this PCR product and the 936-1545 shown in the SEQ ID NO:1 are identical.

Experimental result (Fig. 3) prompting, PHDP mRNA all has expression in various degree in U-937, K-562, HL-60, KG-1, MOLT-4, Jurkat, NAMALWA, Reh, MCF7, HT-29, HeLa, PC-3 and A431 cell, do not see Table to reach in NB4, A549, LoVo and Caov-3.

Embodiment 3: the Northern engram analysis of human PHD P

Carry out the Northern trace by following ordinary method: filter membrane to be checked places the hybridization solution of 10ml through 68 ℃ of preheatings, in hybrid heater (Bellco) in 68 ℃ of prehybridizations 30 minutes; The cDNA probe that mark is good was in 95～100 ℃ of sex change 2～5 minutes, and (cDNA probe final concentration is 2～10ng/ml or 1～2 * 10 to put rapid cooling back adding hybridization solution on ice ⁶Cpm/ml), fully mixing was hybridized 2 hours in 68 ℃.After hybridization finishes, filter membrane with 2 * SSC, the drip washing of 0.05%SDS room temperature for several times, the washing lotion several is changed in continuing vibration flushing 30～40 minutes therebetween.Use 0.1 * SSC, 0.1%SDS in 50 ℃ of vibration flushings 20～40 minutes subsequently.Last filter membrane wrapped up with plastic fresh-keeping membrane, in-70 ℃ of exposure X line films 24～48 hours.

Northern blot hybridization result (Fig. 4) shows: PHDP mRNA expression ratio is more extensive in normal adult tissue, as tissues such as heart, skeletal muscle, thymus gland, spleen, liver, placenta, lung, peripheral blood leucocyte, Tiroidina, lymphoglandula, tracheae, suprarenal gland, marrow, wherein expression level is higher in heart, skeletal muscle, thymus gland, Tiroidina.In brain, colon, kidney, small intestine, stomach, spinal cord, do not see Table and reach.This shows that PHDP albumen is a kind of albumen of particular expression.

Embodiment 4: human PHD P is recombinant expressed

In this embodiment, PCR Oligonucleolide primers with 5 ' and 3 ' following end of sequence, with extractive medullary cell mRNA is that template is carried out RT-PCR, is that template increases with the total length plasmid DNA among the embodiment 1 perhaps, obtains human PHD P DNA as inserting fragment.

5 ' the end Oligonucleolide primers sequence of using in the PCR reaction is:

5’-AC?GGA?TCC?ATG?GAG?GAG?GAG?GGT?GTGA?A-3’(SEQ?ID?NO：5)

This primer contains the restriction enzyme site of BamH I restriction enzyme, is the encoding sequence of translation initiation sign indicating number and human PHD P after this restriction enzyme site;

3 ' end primer sequence is:

5’-GC?GAA?TTC?CTA?GGG?TGC?ACT?TCT?CCT?GTA?G-3’(SEQ?ID?NO：6)

This primer contains the part encoding sequence of restriction enzyme site, translation termination and the human PHD P of EcoR I restriction enzyme.

With the PCR product purification that obtains after BamH I/EcoR I enzyme cut and recombinate according to a conventional method with plasmid pGEM-3ZF again and be converted into the competence e. coli bl21, the picking positive colony is identified back purifying and order-checking (377 type sequenators of ABI company, BigDye Terminator test kit, PE company).The human PHD P cDNA EcoR I endonuclease bamhi of correct sequence is cloned into expression vector pGEX-2T (Pharmacia company), forms carrier pGEX-2T-PHDP, then transformed into escherichia coli BL21.Positive colony is cut evaluation with BamH I/EcoRII enzyme, the capable 0.8% agarose gel electrophoresis analysis of product.Confirm through order-checking, inserted designed PHDP encoding sequence.

Choosing the positive BL21 clone who expresses PHDP is inoculated in 100ml 2 * YTA substratum, 37 ℃ of 300rpm shaking culture 12-15hr, 2 * YTA the substratum that is diluted in preheating at 1: 10 continues shaking culture 1.5hr, add behind the 100mM IPTG to 0.1mM 30 ℃ and induce 2-6hr, 5,4 ℃ of centrifugal 10min of 000g remove supernatant, put and use 50ml 1 * PBS (0.14M NaCl on ice, 2.7mM KCl, 10.1mM Na ₂HPO ₄, 1.8mM KH ₂PO ₄PH7.3) resuspended, add 20%Triton X-100 to 1% jog 30min again after ultrasonic (B.Braun Labsonic U) fragmentation, then 12,4 ℃ of centrifugal 10min of 000g, supernatant with 0.8 μ m membrane filtration after, cross 1ml 50% glutathione S epharose 4B chromatography column, behind 1 * PBS thorough washing, adding 500ul gsh elution buffer (pH 8.0 for 10mM gsh, 50mM Tris-HCl) room temperature left standstill after 30 minutes collects elutriant, repeat wash-out 2-3 time, obtain human PHD P-GST fusion rotein.The molecular weight size of fusion rotein conforms to predictor.

Embodiment 5: anti-human PHD P production of antibodies

The recombinant protein human PHD P that obtains among the embodiment 4 is used for immune animal to produce antibody, and concrete grammar is as follows.Recombinant molecule is standby after separating with chromatography.Also available SDS-PAGE gel electrophoresis separates, electrophoretic band downcut from gel, and with isopyknic complete Freund ' s adjuvant emulsion.Albumen with 50-100 μ g/0.2ml emulsification carries out peritoneal injection to mouse.After 14 days,, mouse is carried out peritoneal injection with booster immunization with the dosage of 50-100 μ g/0.2ml with the same antigen of non-complete Freund ' s adjuvant emulsion.Carried out booster immunization one time every 14 days, carry out at least three times.The sero-fast specific reaction that obtains is active to be assessed in the ability of external precipitation human PHD P gene translation product with it.Found that antibody can combine with albumen of the present invention specifically.

The Western of embodiment 6:PHDP protein expression detects

Collecting cell (5 * 10 ⁶Cell/sample), wash one time with PBS after, extract whole protein with T-PERTM Tissue ProteinExtraction Reagent, concrete operations are undertaken by the test kit explanation.Measure protein concentration with the BCA method afterwards, be adjusted to unanimity after, per 20 μ l of sample and 4 μ l 6X sample-loading buffer (100mmol/LTris-HCL, 200mmol/L DTT, 4%SDS, 0.2% tetrabromophenol sulfonphthalein, 20% glycerine, PH6.8) mixing, after 100 ℃ of water-baths were boiled 5 minutes, row 12%SDS-PAGE electrophoresis moved on to the protein transduction in the polyacrylamide on the nitrocellulose filter in 4 ℃ with the 100V constant voltage subsequently, ponceau dyeing and label orientation mark molecular weight of albumen standard position.4 hours (the TBST solution of 10% skim-milk) of room temperature blocking-up, be diluted in the skim-milk solution by 1: 1000 rabbit source PHDP is how anti-, the negative contrast of normal rabbit serum, with cellulose nitrate film in room temperature reaction after 2 hours, with TBST (the TBS solution of 0.05%Tween20) washing 3 times, each 10 minutes.The goat anti-rabbit igg of horseradish peroxidase-labeled (dilution in 1: 2000) in addition then, incubated at room 60 minutes, TBST gives a baby a bath on the third day after its birth time, each 10 minutes, A liquid in the Western trace luciferase assay reagent and B liquid is mixed with equal-volume, and incubated at room dried after 1 minute, press mold, exposure is developed.

Western trace result (Fig. 5) shows: the proteic expression of PHDP is all arranged in HeLa, MOLT-4, Jurkat, HL-60, K-562, the U-937 cell.The molecular weight of protein band is about 54kD, with the predicted molecular weight basically identical.

The structure of embodiment 7:PHDP-GFP (green fluorescent protein) eucaryon fusion expression vector

In this embodiment, be template with the total length plasmid DNA among the embodiment 1,5 ' and 3 ' the PCR Oligonucleolide primers held following with sequence increases, and obtains human PHD P DNA as inserting fragment.The PCR reaction parameter be 95 ℃ 15 seconds, 58 ℃ 30 seconds, 72 ℃ 45 seconds, 20 circulations were extended 10 minutes for back 72 ℃,

Total length PHDP (FL) upstream primer is 5 '-G GAT CCC TGG AAG CGA GTG GCG GA-3 ' (5 ' end contains BamH I site) (SEQ ID NO:7), downstream primer is 5 '-GG TAC C GGTGCA CTT CTC CTG TAG AG-3 ' (5 ' end contains the KpnI site) (SEQ ID NO:8), product coding total length PHDP albumen.

PH structural domain (N105) upstream primer of PHDP is 5 '-G GAT CCG ATG GTG GAC AAG GCTGGC T-3 ' (5 ' end contains BamH I site) (SEQ ID NO:9), downstream primer is 5 '-GG TACCTT GCC TCG GTT AAT CCC TTC-3 ' (5 ' end contains Kpn I site) (SEQ ID NO:10), the product coding proteic PH structural domain of PHDP (105 amino acid).

Do not comprise PH structural domain (C361) upstream primer and be 5 '-CAG GAT CCC GAT GAG GTA AAGGTG GAC-3 ' (5 ' end contains BamH I site) (SEQ ID NO:11), downstream primer is 5 '-GGTAC CCT CCT GTA GAG GGT CAC CA-3 ' (5 ' end contains Kpn I site) (SEQ ID NO:12), 361 amino acid of C end of the proteic disappearance of product coding PHDP PH structural domain.

Behind the PCR product purification directly and the pGEM-T carrier recombinate according to a conventional method and be converted into competence bacterium DH5 α.Picking white clone identifies, also order-checking (sequencing primer is T7 and SP6 and gene-specific primer GAG TGC AGA ACC GTC CCA) of purifying.With the purified rear clone of the endonuclease bamhi of correct sequence to expression vector pNGFP through enzyme cut identify positive colony after, recon is designated as VNG-FL (total length), VNG-N105 (PH structural domain) and VNG-C361 (no PH structural domain) (Fig. 6 A) respectively.Confirm through order-checking, inserted designed PHDP encoding sequence.

The proteic immunofluorescence analysis of embodiment 8:PHDP

Utilize LipofectAMINE reagent (Invitrogen) to carry out the gene transfection of eukaryotic cell COS-7 with three kinds of PHDP total lengths or segmental GFP fusion expression vector plasmid DNA constructed among the embodiment 7, contrast as irrelevant with the pNGFP plasmid vector.The transient transfection cell after transfection 36 hours with trysinization, be laid on the sterility cover slide, carried out serum starvation 18 hours with the DMEM substratum that contains 0.5% foetal calf serum, subsequently under Laser Scanning Confocal Microscope with the substratum irritation cell that contains 20% serum 10 minutes, and carry out Real Time Observation.

Result (Fig. 6 B, 6C and 6D) shows: the fluorescent signal of VNG-FL, VNG-N105 and VNG-C361 transfectional cell all is dispersed in and is distributed in the endochylema under the serum starvation condition; After adding 20% serum, VNG-FL and VNG-N105 cell fluorescence signal promptly began to transfer on the cytolemma rapidly at 2 minutes, and after can lasting till 10 minutes always; And VNG-C361 transfectional cell or GFP transfectional cell add serum after 10 minutes fluorescent signal still be distributed in the endochylema.The experimental result prompting is induced down at serum at least, and the cytolemma transposition of PHDP is by the mediation of PH structural domain, and independent PH structural domain has been enough to mediate this cytolemma transposition and membrane-binding function.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence table＜110〉Immunology Inst., No.2 Military Medical Univ.＜120〉new type human cell signal related protein, its coded sequence and purposes＜130〉024975＜160〉12＜170〉PatentIn version 3.1＜210〉1＜211〉3675＜212〉DNA＜213〉homo sapiens (Homo sapiens)＜220〉＜221〉CDS＜222〉(84) .. (1553)＜223〉＜400〉1cttggccggg cgtagacgcg gtggcagagc ccgcgcggcg ctggaagcga gtggcggagc 60ggcgggacct cggcggactc gcc atg gag gag gag ggt gtg aag gaa gcc ggt 113

Met?Glu?Glu?Glu?Gly?Val?Lys?Glu?Ala?Gly

1???????????????5???????????????????10gag?aag?cct?cgg?gga?gca?cag?atg?gtg?gac?aag?gct?ggc?tgg?atc?aag??????161Glu?Lys?Pro?Arg?Gly?Ala?Gln?Met?Val?Asp?Lys?Ala?Gly?Trp?Ile?Lys

15??????????????????20??????????????????25aag?agc?agt?ggg?ggc?ctc?ctg?ggt?ttc?tgg?aaa?gac?cga?tat?ctg?ctc??????209Lys?Ser?Ser?Gly?Gly?Leu?Leu?Gly?Phe?Trp?Lys?Asp?Arg?Tyr?Leu?Leu

30??????????????????35??????????????????40ctc?tgc?cag?gcc?cag?ctg?ctg?gtc?tat?gag?aat?gag?gat?gat?cag?aag??????257Leu?Cys?Gln?Ala?Gln?Leu?Leu?Val?Tyr?Glu?Asn?Glu?Asp?Asp?Gln?Lys

45??????????????????50??????????????????55tgt?gtg?gag?act?gtg?gag?ctg?ggc?agc?tat?gag?aag?tgc?cag?gac?ctt??????305Cys?Val?Glu?Thr?Val?Glu?Leu?Gly?Ser?Tyr?Glu?Lys?Cys?Gln?Asp?Leu

60??????????????????65??????????????????70cgt?gcc?ctc?ctc?aag?cga?aaa?cac?cgc?ttt?atc?ctg?ctg?cga?tcc?cca??????353Arg?Ala?Leu?Leu?Lys?Arg?Lys?His?Arg?Phe?Ile?Leu?Leu?Arg?Ser?Pro75??????????????????80??????????????????85??????????????????90ggg?aac?aag?gtc?agc?gac?atc?aaa?ttc?cag?gca?ccc?acc?ggg?gag?gag??????401Gly?Asn?Lys?Val?Ser?Asp?Ile?Lys?Phe?Gln?Ala?Pro?Thr?Gly?Glu?Glu

95??????????????????100?????????????????105aag?gaa?tcc?tgg?atc?aaa?gcc?ctc?aat?gaa?ggg?att?aac?cga?ggc?aaa??????449Lys?Glu?Ser?Trp?Ile?Lys?Ala?Leu?Asn?Glu?Gly?Ile?Asn?Arg?Gly?Lys

110?????????????????115?????????????????120aac?aag?gct?ttc?gat?gag?gta?aag?gtg?gac?aag?agc?tgc?gcc?ctg?gag??????497Asn?Lys?Ala?Phe?Asp?Glu?Val?Lys?Val?Asp?Lys?Ser?Cys?Ala?Leu?Glu

125?????????????????130?????????????????135cat?gtg?aca?cgg?gac?cgg?gtg?cga?ggg?ggc?cag?cga?cgc?cgg?cca?cca??????545His?Val?Thr?Arg?Asp?Arg?Val?Arg?Gly?Gly?Gln?Arg?Arg?Arg?Pro?Pro

140?????????????????145?????????????????150acg?aga?gtc?cac?ctg?aag?gag?gtg?gcc?agt?gca?gct?tct?gac?ggt?ctt??????593Thr?Arg?Val?His?Leu?Lys?Glu?Val?Ala?Ser?Ala?Ala?Ser?Asp?Gly?Leu155?????????????????160?????????????????165?????????????????170ctg?cgc?ctg?gat?ctt?gat?gtt?ccg?gac?agt?ggg?cca?cca?gtg?ttt?gcc??????641Leu?Arg?Leu?Asp?Leu?Asp?Val?Pro?Asp?Ser?Gly?Pro?Pro?Val?Phe?Ala

175?????????????????180?????????????????185ccc?agc?aat?cat?gtc?agt?gaa?gcc?caa?cct?cgg?gag?aca?ccc?cgg?ccc??????689Pro?Ser?Asn?His?Val?Ser?Glu?Ala?Gln?Pro?Arg?Glu?Thr?Pro?Arg?Pro

190?????????????????195?????????????????200ctc?atg?cct?cct?acc?aag?cct?ttc?cta?gca?cct?gag?acc?acc?agc?cct??????737Leu?Met?Pro?Pro?Thr?Lys?Pro?Phe?Leu?Ala?Pro?Glu?Thr?Thr?Ser?Pro

205?????????????????210?????????????????215ggt?gac?agg?gtg?gag?acc?cct?gtg?ggg?gag?aga?gcc?cca?acc?cct?gtc??????785Gly?Asp?Arg?Val?Glu?Thr?Pro?Val?Gly?Glu?Arg?Ala?Pro?Thr?Pro?Val

220?????????????????225?????????????????230tca?gca?agc?tct?gag?gtc?tcc?cct?gag?agc?caa?gag?gac?tca?gag?acc??????833Ser?Ala?Ser?Ser?Glu?Val?Ser?Pro?Glu?Ser?Gln?Glu?Asp?Ser?Glu?Thr235?????????????????240?????????????????245?????????????????250cca?gca?gag?gag?gac?agt?ggc?tct?gag?cag?cct?ccc?aac?agc?gtc?ctg??????881Pro?Ala?Glu?Glu?Asp?Ser?Gly?Ser?Glu?Gln?Pro?Pro?Asn?Ser?Val?Leu

255?????????????????260?????????????????265cct?gac?aaa?ctg?aag?gtg?agc?tgg?gag?aac?ccc?agc?ccc?cag?gag?gcc??????929Pro?Asp?Lys?Leu?Lys?Val?Ser?Trp?Glu?Asn?Pro?Ser?Pro?Gln?Glu?Ala

270?????????????????275?????????????????280cct?gct?gca?gag?agt?gca?gaa?ccg?tcc?cag?gca?ccc?tgt?tct?gag?act??????977Pro?Ala?Ala?Glu?Ser?Ala?Glu?Pro?Ser?Gln?Ala?Pro?Cys?Ser?Glu?Thr

285?????????????????290?????????????????295tct?gag?gct?gcc?ccc?agg?gag?ggt?ggg?aag?ccc?cct?aca?ccc?cca?ccc?????1025Ser?Glu?Ala?Ala?Pro?Arg?Glu?Gly?Gly?Lys?Pro?Pro?Thr?Pro?Pro?Pro

300?????????????????305?????????????????310aag?atc?tta?tca?gag?aaa?ctg?aaa?gcc?tcc?atg?ggt?gag?atg?cag?gct?????1073Lys?Ile?Leu?Ser?Glu?Lys?Leu?Lys?Ala?Ser?Met?Gly?Glu?Met?Gln?Ala315?????????????????320?????????????????325?????????????????330tct?ggg?cca?cct?gct?cca?ggc?aca?gtg?cag?gtc?tca?gtg?aat?ggc?atg?????1121Ser?Gly?Pro?Pro?Ala?Pro?Gly?Thr?Val?Gln?Val?Ser?Val?Asn?Gly?Met

335?????????????????340?????????????????345gat?gac?agt?cct?gag?cct?gcc?aag?ccc?tct?cag?gct?gag?ggc?acc?cca?????1169Asp?Asp?Ser?Pro?Glu?Pro?Ala?Lys?Pro?Ser?Gln?Ala?Glu?Gly?Thr?Pro

350?????????????????355?????????????????360gga?act?cct?cca?aag?gat?gca?aca?aca?tcc?aca?gca?ctg?ccc?ccc?tgg?????1217Gly?Thr?Pro?Pro?Lys?Asp?Ala?Thr?Thr?Ser?Thr?Ala?Leu?Pro?Pro?Trp

365?????????????????370?????????????????375gac?ctg?cca?cct?cag?ttc?cat?ccc?cgc?tgc?tcc?tcc?ctt?ggg?gac?ttg?????1265Asp?Leu?Pro?Pro?Gln?Phe?His?Pro?Arg?Cys?Ser?Ser?Leu?Gly?Asp?Leu

380?????????????????385?????????????????390ctt?ggg?gaa?ggc?ccg?cgg?cat?ccc?ttg?cag?ccc?agg?gaa?cgg?cta?tat?????1313Leu?Gly?Glu?Gly?Pro?Arg?His?Pro?Leu?Gln?Pro?Arg?Glu?Arg?Leu?Tyr395?????????????????400?????????????????405?????????????????410cgg?gcc?cag?ctg?gag?gtg?aag?gtg?gcc?tcg?gaa?cag?acg?gag?aaa?ctg?????1361Arg?Ala?Gln?Leu?Glu?Val?Lys?Val?Ala?Ser?Glu?Gln?Thr?Glu?Lys?Leu

415?????????????????420?????????????????425ttg?aac?aag?gtg?ctg?ggc?agt?gag?ccg?gcc?cct?gtt?agt?gcc?gaa?aca?????1409Leu?Asn?Lys?Val?Leu?Gly?Ser?Glu?Pro?Ala?Pro?Val?Ser?Ala?Glu?Thr

430?????????????????435?????????????????440ttg?ctc?agc?cag?gct?gtg?gag?cag?ctg?agg?cag?gcc?acc?cag?gtc?ctg?????1457Leu?Leu?Ser?Gln?Ala?Val?Glu?Gln?Leu?Arg?Gln?Ala?Thr?Gln?Val?Leu

445?????????????????450?????????????????455cag?gaa?atg?aga?gat?ttg?gga?gag?ctg?agc?cag?gaa?gca?cct?ggg?cta?????1505Gln?Glu?Met?Arg?Asp?Leu?Gly?Glu?Leu?Ser?Gln?Glu?Ala?Pro?Gly?Leu

460 465 470agg gag aag cgg aag gag ctg gtg acc ctc tac agg aga agt gca ccc 1553Arg Glu Lys Arg Lys Glu Leu Val Thr Leu Tyr Arg Arg Ser Ala Pro475 480 485 490tagggccttc tgggccagag gcaccatccc ttctggccat ccatcaagtc catcaaggcc 1613cagccctgct gagaaatgtg cttctgcttc tacagcaatg gctgcaggag ggccattggg 1673catgtcaggg tttggccatg acccgaagag actcctggcg tccttcctac tctgctctgg 1733ccagtggtgc caggtgccac ccagggctac tgcctggcta tctggcctgg cctctgggct 1793ggggctgggg ctgggagcac acacgctggg acctatgtgt ttgtgtggtc gttccaaact 1853gccccagggc tttgggggcg gcacttgggg tttctgggaa tgacatcatc tctgttcccc 1913atccccagta gtttacattc ctgacttctg aatacagcac agctgagccc cctgcagctc 1973ccatctccag ctattcctag gcaaagagcc tcatggctaa ggcagcctca aagccagccc 2033ctcctcccac ctattctgag tagctgcaga ggccttgggtccaggctcta ggttcatccc 2093tcagttgggg ggaacgtagg acccagctgg agcctcttga gggagatgag aggcctcttt 2153gtgaggagga cattagctgt gtggcctctc tctctttggc cctgtttcct tttttgcaaa 2213acaaggacat tttctgcagc cccttcctct cagtgagcta tgattggagg gcttaggtct 2273ggaggattca agagtggaag aggaatttaa ggggtcccct agtctagtct ctgcccctgg 2333atagtgtcca gccttgtata tttctgaaga ggtggatccc agagtggctc tgatgtccac 2393attagaaaag cttacttgta atgatcatgt cagccttcag aagagaatcc ccaccaactt 2453ctgtgcctcc tcagatgggg atttatctgg atctctgtgg ttccttctca gccgaaacag 2513gtccagtatc ccagtcattt cttcaaatgc tgataggggt atgttggaat ccgaagccac 2573ttccccgcct tcaagcccca gatgggctgc tctcctgtaa ctttctagga gaagagacat 2633tttcttcttt ccctttcctg gtccatccct gcaccctggt cctctcccag cctctccccc 2693acattgtccc tgactctagg ggcacatcca gtctccatcg tgctgcagca gctggactga 2753gggcagagcc tgtaggtgca gaggccctgg ctcccgaggt ccagccactc tccctggggc 2813ctctggggtg agagcagctt ccgataggac ctgcccagat ttctgcatgt gcacttttgt 2873ttactgaaag agagaaaggg gggggtcaca gcaacatgcc ctggcctttc tgccctgttc 2933cccaacccca ctgaggcctg ctgcacaggt caatgccttc gttatcgtta ttgtactgtc 2993actttgttct tgaggtagta gtcaaggatc aggaggggca gatgtcttct ctgggctgcg 3053tggggccgga gcagaggtga gcagcaatgc actggttcgg gagcccccat cagcctcctt 3113gtgcaaactg ggcccccatg ccacagtctg gctttccctc catctgcccc aggacaagag 3173caagaaggac atcagttgcc cagtcatgtg atcccctgcc atcttgcctt aggaacagcc 3233ttcccccacc agcagccatg gctggctggg gcgttagcca agccacctac tgccaggaat 3293tggagcctca gttccctcct gtgtcaagta gctaactgca gcagctggac tgagggcaga 3353gtctgtgggt gcagagaccc tgcatgtagg tcacaggttg aggcccagcc actctccctg 3413gggcctggtg ggtaggcaag tagctctggg gccacctcaa gtgaccaaat gctattaatt 3473tccatccttt agcaggctgg gccctaggca ggaagctggc ttctgggaga ggagtgagaa 3533cgtgcagggc ctgcctagct tgcgtgcttg aggaaggtgg cattccgtgc ttgcctcctt 3593gaggagggtg gcattctgtg tcttctgctt atgaagcgcc tttcttaaag tttggcaata 3653aaatccattt ttatggaaaa aa 3675＜210〉2＜211〉490＜212〉PRT＜213〉 ( Homo sapiens )＜400〉2Met Glu Glu Glu Gly Val Lys Glu Ala Gly Glu Lys Pro Arg Gly Ala1 5 10 15Gln Met Val Asp Lys Ala Gly Trp Ile Lys Lys Ser Ser Gly Gly Leu

20??????????????????25??????????????????30Leu?Gly?Phe?Trp?Lys?Asp?Arg?Tyr?Leu?Leu?Leu?Cys?Gln?Ala?Gln?Leu

35??????????????????40??????????????????45Leu?Val?Tyr?Glu?Asn?Glu?Asp?Asp?Gln?Lys?Cys?Val?Glu?Thr?Val?Glu

50??????????????????55??????????????????60Leu?Gly?Ser?Tyr?Glu?Lys?Cys?Gln?Asp?Leu?Arg?Ala?Leu?Leu?Lys?Arg65??????????????????70??????????????????75??????????????????80Lys?His?Arg?Phe?Ile?Leu?Leu?Arg?Ser?Pro?Gly?Asn?Lys?Val?Ser?Asp

85??????????????????90??????????????????95Ile?Lys?Phe?Gln?Ala?Pro?Thr?Gly?Glu?Glu?Lys?Glu?Ser?Trp?Ile?Lys

100?????????????????105?????????????????110Ala?Leu?Asn?Glu?Gly?Ile?Asn?Arg?Gly?Lys?Asn?Lys?Ala?Phe?Asp?Glu

115?????????????????120?????????????????125Val?Lys?Val?Asp?Lys?Ser?Cys?Ala?Leu?Glu?His?Val?Thr?Arg?Asp?Arg

130?????????????????135?????????????????140Val?Arg?Gly?Gly?Gln?Arg?Arg?Arg?Pro?Pro?Thr?Arg?Val?His?Leu?Lys145?????????????????150?????????????????155?????????????????160Glu?Val?Ala?Ser?Ala?Ala?Ser?Asp?Gly?Leu?Leu?Arg?Leu?Asp?Leu?Asp

165?????????????????170?????????????????175Val?Pro?Asp?Ser?Gly?Pro?Pro?Val?Phe?Ala?Pro?Ser?Asn?His?Val?Ser

180?????????????????185?????????????????190Glu?Ala?Gln?Pro?Arg?Glu?Thr?Pro?Arg?Pro?Leu?Met?Pro?Pro?Thr?Lys

195?????????????????200?????????????????205Pro?Phe?Leu?Ala?Pro?Glu?Thr?Thr?Ser?Pro?Gly?Asp?Arg?Val?Glu?Thr

210?????????????????215?????????????????220Pro?Val?Gly?Glu?Arg?Ala?Pro?Thr?Pro?Val?Ser?Ala?Ser?Ser?Glu?Val225?????????????????230?????????????????235?????????????????240Ser?Pro?Glu?Ser?Gln?Glu?Asp?Ser?Glu?Thr?Pro?Ala?Glu?Glu?Asp?Ser

245?????????????????250?????????????????255Gly?Ser?Glu?Gln?Pro?Pro?Asn?Ser?Val?Leu?Pro?Asp?Lys?Leu?Lys?Val

260?????????????????265?????????????????270Ser?Trp?Glu?Asn?Pro?Ser?Pro?Gln?Glu?Ala?Pro?Ala?Ala?Glu?Ser?Ala

275?????????????????280?????????????????285Glu?Pro?Ser?Gln?Ala?Pro?Cys?Ser?Glu?Thr?Ser?Glu?Ala?Ala?Pro?Arg

290?????????????????295?????????????????300Glu?Gly?Gly?Lys?Pro?Pro?Thr?Pro?Pro?Pro?Lys?Ile?Leu?Ser?Glu?Lys305?????????????????310?????????????????315?????????????????320Leu?Lys?Ala?Ser?Met?Gly?Glu?Met?Gln?Ala?Ser?Gly?Pro?Pro?Ala?Pro

325?????????????????330?????????????????335Gly?Thr?Val?Gln?Val?Ser?Val?Asn?Gly?Met?Asp?Asp?Ser?Pro?Glu?Pro

340?????????????????345?????????????????350Ala?Lys?Pro?Ser?Gln?Ala?Glu?Gly?Thr?Pro?Gly?Thr?Pro?Pro?Lys?Asp

355?????????????????360?????????????????365Ala?Thr?Thr?Ser?Thr?Ala?Leu?Pro?Pro?Trp?Asp?Leu?Pro?Pro?Gln?Phe

370?????????????????375?????????????????380His?Pro?Arg?Cys?Ser?Ser?Leu?Gly?Asp?Leu?Leu?Gly?Glu?Gly?Pro?Arg385?????????????????390?????????????????395?????????????????400His?Pro?Leu?Gln?Pro?Arg?Glu?Arg?Leu?Tyr?Arg?Ala?Gln?Leu?Glu?Val

405?????????????????410?????????????????415Lys?Val?Ala?Ser?Glu?Gln?Thr?Glu?Lys?Leu?Leu?Asn?Lys?Val?Leu?Gly

420?????????????????425?????????????????430Ser?Glu?Pro?Ala?Pro?Val?Ser?Ala?Glu?Thr?Leu?Leu?Ser?Gln?Ala?Val

435?????????????????440?????????????????445Glu?Gln?Leu?Arg?Gln?Ala?Thr?Gln?Val?Leu?Gln?Glu?Met?Arg?Asp?Leu

450?????????????????455?????????????????460Gly?Glu?Leu?Ser?Gln?Glu?Ala?Pro?Gly?Leu?Arg?Glu?Lys?Arg?Lys?Glu465?????????????????470?????????????????475?????????????????480Leu?Val?Thr?Leu?Tyr?Arg?Arg?Ser?Ala?Pro

485 490＜210〉3＜211〉19＜212〉DNA＜213〉＜400〉3gcagagagtg cagaaccgt 19＜210〉4＜211〉19＜212〉DNA＜213〉＜400〉4ttctcctgta gagggtcac 19＜210〉5＜211〉28＜212〉DNA＜213〉＜400〉5acggatccat ggaggaggag ggtgtgaa 28＜210〉6＜211〉30＜212〉DNA＜213〉＜400〉6gcgaattcct agggtgcact tctcctgtag 30＜210〉7＜211〉24＜212〉DNA＜213〉＜400〉7ggatccctgg aagcgagtgg cgga 24＜210〉8＜211〉26＜212〉DNA＜213〉＜400〉8ggtaccggtg cacttctcct gtagag 26＜210〉9＜211〉26＜212〉DNA＜213〉＜400〉9ggatccgatg gtggacaagg ctggct 26＜210〉10＜211〉26＜212〉DNA＜213〉＜400〉10ggtaccttgc ctcggttaat cccttc 26＜210〉11＜211〉27＜212〉DNA＜213〉＜400〉11caggatcccg atgaggtaaa ggtggac 27＜210〉12＜211〉25＜212〉DNA＜213〉＜400〉12ggtaccctcc tgtagagggt cacca 25

Claims (10)

1. an isolating human PHD P polypeptide is characterized in that it comprises: polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative with SEQ ID NO:2 aminoacid sequence.

2. polypeptide as claimed in claim 1 is characterized in that, this polypeptide is selected from down group:

(a) has the polypeptide of SEQ ID NO:2 aminoacid sequence;

(b) SEQ ID NO:2 aminoacid sequence is formed through replacement, disappearance or the interpolation of one or more amino-acid residues, and under the serum stimulation situation, take place the cytolemma transposition by (a) polypeptides derived.

3. isolating polynucleotide is characterized in that, it comprises a nucleotide sequence, and this nucleotide sequence is shown at least 70% homogeny with a kind of nucleotides sequence that is selected from down group:

(a) coding is as the polynucleotide of polypeptide as described in claim 1 and 2;

(b) with polynucleotide (a) complementary polynucleotide.

4. polynucleotide as claimed in claim 3 is characterized in that this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQIDNO:2.

5. polynucleotide as claimed in claim 3 is characterized in that, the sequence of these polynucleotide is selected from down a kind of of group:

(a) has the sequence of 84-1553 position among the SEQ ID NO:1;

(b) has the sequence of 1-3675 position among the SEQ ID NO:1.

6. a carrier is characterized in that, it contains the described polynucleotide of claim 3.

7. a genetically engineered host cell is characterized in that, it contains the described carrier of claim 6.

8. preparation method with polypeptide of human PHD P polypeptide active is characterized in that this method comprises:

(a) under the condition that is fit to expressing human PHDP polypeptide, cultivate the described host cell of claim 7;

(b) from culture, isolate polypeptide with human PHD P polypeptide active.

9. energy and the described human PHD P of claim 1 polypeptid specificity bonded antibody.

10. a pharmaceutical composition is characterized in that, it contains the described polypeptide of claim 1 and the pharmaceutically acceptable carrier of safe and effective amount.

Images