CN100480263C - Immunosuppressive receptor derived from dendritic cell, coding sequence and uses thereof - Google Patents
Immunosuppressive receptor derived from dendritic cell, coding sequence and uses thereof Download PDFInfo
- Publication number
- CN100480263C CN100480263C CNB031295673A CN03129567A CN100480263C CN 100480263 C CN100480263 C CN 100480263C CN B031295673 A CNB031295673 A CN B031295673A CN 03129567 A CN03129567 A CN 03129567A CN 100480263 C CN100480263 C CN 100480263C
- Authority
- CN
- China
- Prior art keywords
- digr2
- polypeptide
- mouse
- sequence
- present
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a novel immunological suppression acceptor DIgR2 (DC-derived Ig-like receptor 2, DigR2). The invention provides the polynucleotide for encoding the protein molecule and the method for producing the protein molecule through recombination technology, the invention also discloses the use of the polynucleotide for encoding the novel immunological suppression receptor DigR2 molecule. The invention confirms the negative regulation action of DigR2 for immune response.
Description
Technical field
The invention belongs to biotechnology and medical field, specifically, the present invention relates to the polynucleotide of new coding inhibitive ability of immunity acceptor molecule DIgR2 polypeptide, and the polypeptide of this polynucleotide encoding.The invention still further relates to the purposes and the preparation of these polynucleotide and polypeptide.Specifically, polypeptide of the present invention be a kind of new with suppress dendritic cell (DC) ripening process in the relevant inhibitive ability of immunity acceptor of expression of mhc class ii molecule and costimulatory molecules CD80 (B7-1).
Background technology
The inhibitive ability of immunity acceptor of finding in hematopoiesis and immunocyte (inhibitory immunoreceptor) is a hot subject of field of immunology in recent years.The constructional feature of inhibitive ability of immunity acceptor be contain the relevant inhibitory motifs of one or more immunity receptor tyrosine (immunoreceptor tyrosine-basedinhibitory motifs, ITIM).The conserved sequence that ITIM is made up of 6 amino acid (S/I/L/VxYxxL/V, X represent arbitrary amino acid).When immunosuppression acceptor and costimulatory receptor coupling, tyrosine phosphorylation takes place in ITIM, then with Protein-tyrosine-phosphatase SHP or/and the SH2 of inositol monophosphate enzyme SHIP combines, produce the negative adjusting effect of cell activation.Its encoding gene belongs to immunoglobulin gene family and C type lectin family more.
Immunoglobulin superfamily (immunoglobulin superfamily, IgSF) be a class and Ig structural similitude, encoding gene homologous protein molecular, mainly be present in the surface of various hematopoietic cells, epithelial cell, immunocyte, vascular endothelial cell and neurocyte, in immunne response, have functions such as the stimulation of acceptance, transmission information, activating cells with the membranin form.The defective of IgSF gene can cause immunologic function disorder with sudden change, causes immune related diseases.In this family, found multiple inhibition acceptor in recent years, as IgG low-affinity receptor, natural killer cell inhibition acceptor (killer inhibitory receptor, KIR), Ig sample transcription product (ITL-1,2,3) etc., proved to have important immunologic function.As KIR with can start the inhibition signal after part combines, can suppress NK cytotoxicity, ADCC and secrete cytokines, make NK forfeiture killing activity; The Ca2+ that low-affinity IgG Fc acceptor FcR γ IIB can suppress to be caused by BCR flows and B cell proliferation, and the mouse that lacks FcR γ IIB is easy to generate autoimmune disorder, has shown that this acceptor plays an important role in guaranteeing immunologic balance; PD-1 is relevant with the periphery immunological tolerance as the inhibition acceptor, and the C57BL/6 mouse of PD-1 disappearance is brought out lupoid acne glomerulonephritis and sacroiliitis easily.This shows that an immunosuppression acceptor newcomer's discovery and function conclusive evidence not only have important theory and explore meaning, also have broad clinical application prospect, this aspect research has become the heat subject of current field of immunology.
In view of the critical function of immunoglobulin-like receptor, this area presses for the new immunoglobulin-like receptor of exploitation.
Summary of the invention
The immunoglobulin-like receptor DIgR2 albumen that the purpose of this invention is to provide a kind of novel dendritic cell source with and fragment, analogue and derivative.
Another object of the present invention provides the polynucleotide of these polypeptide of coding.
Another object of the present invention provides the method for these polypeptide of production and the purposes of this polypeptide and encoding sequence.
In a first aspect of the present invention, novel isolated DIgR2 polypeptide is provided, it comprises: polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative with SEQID NO:2 aminoacid sequence.Preferably, this polypeptide is selected from down group: (a) have 1-330 position or 22-330 amino acids polypeptide of sequence among the SEQ ID NO:2; (b) SEQ ID NO:2 aminoacid sequence is formed through replacement, disappearance or the interpolation of one or more amino-acid residues, and have the negative regulation immunne response function by (a) polypeptides derived.
In a second aspect of the present invention, the polynucleotide of isolating these polypeptide of coding are provided, these polynucleotide comprise a nucleotide sequence, and this nucleotide sequence is shown at least 70% homogeny with a kind of nucleotides sequence that is selected from down group: (a) polynucleotide of the above-mentioned mouse DIgR2 of coding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in 1-330 position among the SEQ ID NO:2 or the 22-330 position.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 64-1056 position among the SEQID NO:1; (b) has the sequence of 1-1076 position among the SEQ ID NO:1; (c) has the sequence of 127-1056 position among the SEQ ID NO:1.
In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.
In a fourth aspect of the present invention, the method for preparing the DIgR2 polypeptide is provided, this method comprises: (a) under expression condition, cultivate the above-mentioned host cell that is transformed or transduce; (b) from culture, isolate and have the DIgR2 polypeptide.
In a fifth aspect of the present invention, provide and above-mentioned mouse DIgR2 polypeptid specificity bonded antibody.The nucleic acid molecule that can be used for detecting also is provided, and it contains a successive 10-1076 Nucleotide in the above-mentioned polynucleotide.
In a sixth aspect of the present invention, the compound of simulation, promotion, antagonism mouse DIgR2 polypeptide active is provided, and the compound that suppresses mouse DIgR2 polypeptide expression.The method of screening and/or prepare these compounds also is provided.Preferably, this compound is encoding sequence or its segmental antisense sequences of mouse DIgR2 polypeptide.
In a seventh aspect of the present invention, provide and whether had the proteic method of DIgR2 in the test sample, it comprises: sample is contacted with the proteic specific antibody of DIgR2, observe whether form antibody complex, formed antibody complex and just represented to exist in the sample DIgR2 albumen.
In a eighth aspect of the present invention, a kind of disease relevant with mouse DIgR2 polypeptide unconventionality expression or method of disease susceptibility of detecting is provided, this method comprises: whether have sudden change in the nucleotide sequence of detection coding said polypeptide.
In a ninth aspect of the present invention, provide the purposes of polypeptide of the present invention and encoding sequence.Polypeptide for example of the present invention can be used to screen the agonist that promotes mouse DIgR2 polypeptide active, and perhaps screening suppresses the antagonist of mouse DIgR2 polypeptide active or is used to the peptide finger print identification.The proteic encoding sequence of mouse DIgR2 of the present invention or its fragment can be used as primer and be used for pcr amplification reaction, perhaps are used for hybridization as probe, perhaps are used to make gene chip or microarray.
In a tenth aspect of the present invention, a kind of pharmaceutical composition is provided, it contains mouse DIgR2 polypeptide of the present invention or its agonist, antagonist and the pharmaceutically acceptable carrier of safe and effective amount.These pharmaceutical compositions can be treated illnesss such as tumour, inflammation, neural system and cardiovascular diseases.
Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
Description of drawings
Fig. 1 has shown the hydrophobicity graphic representation of the proteic Kyte-doolitte hydrophobicity analysis of mouse DIgR2 of the present invention.
Fig. 2 has shown mouse DIgR2 RT-PCR expression analysis result of the present invention, and prompting DIgR2 has wide expression.The RT-PCR:(1 of the mouse cell of A. fresh separated wherein) neutrophil leucocyte, (2) monocyte, (3) T lymphocyte, (4) bone-marrow-derived lymphocyte.B. the EL4 RT-PCR:(1 of part tumor cell line), (2) .CTLL-2, (3) E.G7, (4) A20, (5) J774, (6) Raw, (7) FBL-3, (8) Yac-1, (9) B16, (10) P815, (11) CT20, (12) WEHI164.
Fig. 3 has shown the Northern blot hybridization result of mouse DIgR2 of the present invention, and prompting DIgR2 is a kind of molecule of extensive distribution.
Fig. 4 has shown anti-DIgR2 resists the facs analysis result of blocking-up back mouse DC phenotype more.
Fig. 5 has shown the mixed lymphocyte reacion result after anti-DIgR2 resists processing DC more.
Embodiment
Dendritic cell (Dendritic cells, DC) functional characteristics is to excite primary tape T cell (naive Tcells) immune response, be most important antigen presenting cell (the antigen presenting cells that is found at present, APC), can induce the antigen-specific immune response reaction to feed back in the DC body of antigen sensibilization.
The inventor is extensive studies through going deep into, and the clone obtains the DIgR2 full length sequence from the DC in mouse bone marrow cells source; Analyze and show that DIgR2 is the I type transmembrane glycoprotein in the immunoglobulin superfamily.Western detects and shows that DIgR2 is a glycosylated protein in vivo, and the about 60kDa of molecular weight exists with monomeric form; By the gene transfection eukaryotic cell, indirect immunofluorescence detects determines that DIgR2 is an epicyte protein simultaneously.In addition, utilize co-immunoprecipitation to confirm that the ITIM of DIgR2 born of the same parents' inner segment has the potential ability in conjunction with SHP-1, prompting DIgR2 is a novel inhibition acceptor.Prove tentatively that with antibody blocking and the competitive blocking experiment of Fc fusion rotein DIgR2 plays restraining effect for the expression of mhc class ii molecule I-Ab in the ripening process of DC and costimulatory molecules CD80 (B7-1) respectively, thereby suppress the ability that DC stimulates T cell proliferation, have for immunne response and play the negativity regulating and controlling effect.Finished the present invention on this basis.
In the present invention, term " DIgR2 albumen ", " DIgR2 polypeptide ", " immunoglobulin-like receptor in dendritic cell source ", " immunoglobulin-like receptor DIgR2 " or " inhibitive ability of immunity acceptor DigR2 " are used interchangeably, and all refer to have the albumen or the polypeptide of the immunoglobulin-like receptor DIgR2 aminoacid sequence (SEQ ID NO:2) in dendritic cell source.
As used herein, " isolating " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.
As used herein, " isolating DIgR2 albumen or polypeptide " is meant that the DIgR2 polypeptide is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying DIgR2 albumen of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.
Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.
The present invention also comprises the proteic fragment of mouse DIgR2, derivative and analogue.As used herein, term " fragment ", " derivative " are meant with " analogue " and keep identical biological function or the active polypeptide of natural mouse DIgR2 albumen of the present invention basically.Polypeptide fragment of the present invention, derivative or analogue can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferred conservative amino acid residue), and the amino-acid residue of such replacement can be also can not encoded by genetic code, or (ii) in one or more amino-acid residues, has a polypeptide of substituted radical, or (iii) mature polypeptide and another compound (such as the compound that prolongs the polypeptide transformation period, polyoxyethylene glycol for example) merges formed polypeptide, or (iv) additional aminoacid sequence is fused to this peptide sequence and the polypeptide that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying, or with the fusion rotein of the segmental formation of antigen I gG).According to the instruction of this paper, these fragments, derivative and analogue belong to the known scope of those skilled in the art.
In the present invention, term " mouse DIgR2 polypeptide " refers to have the SEQ IDNO.2 polypeptide of sequence of mouse DIgR2 protein-active.This term also comprises having and variant form mouse DIgR2 albumen identical function, SEQ ID NO.2 sequence.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises proteic active fragments of mouse DIgR2 and reactive derivative.
The variant form of this polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, under high or low tight degree condition can with the coded albumen of the DNA of mouse DIgR2 DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-mouse DIgR2 polypeptide to obtain.The present invention also provides other polypeptide, as comprises mouse DIgR2 polypeptide or its segmental fusion rotein.Except the polypeptide of total length almost, the present invention has also comprised the soluble fragments of mouse DIgR2 polypeptide.Usually, this fragment have mouse DIgR2 peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.
Invention also provides the analogue of mouse DIgR2 albumen or polypeptide.The difference of these analogues and natural mouse DIgR2 polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
In the present invention, " mouse DIgR2 albumen conservative property variation polypeptide " refers to compare with the aminoacid sequence of SEQ ID NO:2, has 10 at the most, preferably at the most 8, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best.These conservative property variation polypeptide preferably carry out the amino acid replacement according to table 1 and produce.
Table 1
Initial residue | Representational replacement | The preferred replacement |
Ala(A) | Val;Leu;Ile | Val |
Arg(R) | Lys;Gln;Asn | Lys |
Asn(N) | Gln;His;Lys;Arg | Gln |
Asp(D) | Glu | Glu |
Cys(C) | Ser | Ser |
Gln(Q) | Asn | Asn |
Glu(E) | Asp | Asp |
Gly(G) | Pro;Ala | Ala |
His(H) | Asn;Gln;Lys;Arg | Arg |
Ile(I) | Leu;Val;Met;Ala;Phe | Leu |
Leu(L) | Ile;Val;Met;Ala;Phe | Ile |
Lys(K) | Arg;Gln;Asn | Arg |
Met(M) | Leu;Phe;Ile | Leu |
Phe(F) | Leu;Val;Ile;Ala;Tyr | Leu |
Pro(P) | Ala | Ala |
Ser(S) | Thr | Thr |
Thr(T) | Ser | Ser |
Trp(W) | Tyr;Phe | Tyr |
Tyr(Y) | Trp;Phe;Thr;Ser | Phe |
Val(V) | Ile;Leu;Met;Phe;Ala | Leu |
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.As used herein, " varient of degeneracy " is meant that in the present invention coding has the protein of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.
The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence of an encoding mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.
Term " polynucleotide of coded polypeptide " can be the polynucleotide that comprise this polypeptide of encoding, and also can be the polynucleotide that also comprise additional code and/or non-coding sequence.
The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.
The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 50%, preferably at least 70%, the polynucleotide of at least 80% homogeny more preferably.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1% Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 90%, be more preferably 95% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.
The invention still further relates to nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " contains 15 Nucleotide at least, better is at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid to determine and/or the proteic polynucleotide of separation encoding D IgR2.
Mouse DIgR2 Nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.
In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.
In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.
At present, can be fully obtain the dna sequence dna of code book invention albumen (or its fragment, or derivatives thereof) by chemosynthesis.This dna sequence dna can be introduced in various existing dna moleculars as known in the art (or as carrier) and the cell then.In addition, also can will suddenly change and introduce in the protein sequence of the present invention by chemosynthesis.
Use method (Saiki, the et al.Science1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to obtain the cDNA of total length from the library, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with carrier of the present invention or DIgR2 albumen coded sequence, and the method that produces polypeptide of the present invention through recombinant technology.
Recombinant DNA technology (Science, 1984 by routine; 224:1431), can utilize polymerized nucleoside acid sequence of the present invention to can be used to express or produce the DIgR2 polypeptide of reorganization.In general following steps are arranged:
(1). with the polynucleotide (or varient) of encoding murine DIgR2 polypeptide of the present invention, or transform or the transduction proper host cell with the recombinant expression vector that contains these polynucleotide;
(2). the host cell of in suitable medium, cultivating;
(3). separation, protein purification from substratum or cell.
Among the present invention, mouse DIgR2 polynucleotide sequence can be inserted in the recombinant expression vector.Term " recombinant expression vector " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carriers.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on T7 of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J Bio Chem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier can be used.A key character of expression vector is to contain replication orgin, promotor, marker gene and translation controlling elements usually.
Method well-known to those having ordinary skill in the art can be used to make up and contains mouse DIgR2 DNA sequences encoding and suitable transcribing/the translate expression vector of control signal.These methods comprise (Sambroook, et al.Molecular Cloning, a LaboratoryManual, cold Spring Harbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; Lambda particles phage PL promotor; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in protokaryon or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance.
Comprise the carrier of above-mentioned suitable dna sequence dna and suitable promotor or control sequence, can be used to transform appropriate host cell, so that it can marking protein.
Host cell can be a prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; The bacterial cell of Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; The insect cell of fruit bat S2 or Sf9; The zooblast of CHO, COS, 293 cells or Bowes melanoma cells etc.
When polynucleotide of the present invention are expressed in higher eucaryotic cells, be enhanced if will make to transcribe when in carrier, inserting enhancer sequence.Enhanser is the cis acting factor of DNA, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.
Persons skilled in the art all know how to select appropriate carriers, promotor, enhanser and host cell.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results
2Method is handled, and used step is well-known in this area.Another kind method is to use MgCl
2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.
The transformant that obtains can be cultivated with ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
The extracellular can be expressed or be secreted into to recombinant polypeptide in the above methods in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation handles, with protein precipitant handle (salt analysis method), centrifugal, the broken bacterium of infiltration, superly handle, the combination of super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
The mouse DIgR2 albumen or the polypeptide of reorganization are of use in many ways.These purposes include, but is not limited to: the direct disease (as the negative regulation immunne response) due to the low or forfeiture and be used to screen and promote or antibody, polypeptide or other part of antagonism DIgR2 protein function as pharmacological agent DIgR2 protein function.The peptide molecule that can suppress or stimulate mouse DIgR2 protein function that can be used for seeking therapeutic value with the recombined small-mouse DIgR2 protein screening peptide library of expressing.
On the other hand, the present invention also comprises mouse DIgR2 DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into mouse DIgR2 gene product or fragment.Preferably, refer to that those can combine with mouse DIgR2 gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress the proteic molecule of mouse DIgR2, comprise that also those do not influence the antibody of mouse DIgR2 protein function.The present invention also comprise those can with modify or without the mouse DIgR2 gene product bonded antibody of modified forms.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab)
2Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule (people such as Ladner, U.S. Patent No. 4,946,778); Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.
Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the mouse DIgR2 gene product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing mouse DIgR2 albumen or its has antigenic segmental cell and can be used to immune animal and produce antibody.Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology prepare (see people such as Kohler,
Nature256; 495,1975; People such as Kohler,
Eur.J.Immunol.6:511,1976; People such as Kohler,
Eur.J.Immunol.6:292,1976; People such as Hammerling,
In Monoclonal Antibodies And T Cell Hybridomas, Elsevier, N.Y., 1981).Antibody of the present invention comprises the antibody that can block mouse DIgR2 protein function and the antibody that does not influence mouse DIgR2 protein function.Each antibody-like of the present invention can utilize the fragment or the functional zone of mouse DIgR2 gene product, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of mouse DIgR2 gene product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).
The proteic antibody of anti-mouse DIgR2 can be used in the immunohistochemistry technology, detects the mouse DIgR2 albumen in the biopsy specimen.In addition, with the also available labelled with radioisotope of the protein bound monoclonal antibody of mouse DIgR2, inject in the body and can follow the tracks of its position and distribution.
Antibody among the present invention can be used for treating or prevention and the relevant disease of mouse DIgR2 albumen.The antibody that gives suitable dosage can stimulate or block proteic generation of mouse DIgR2 or activity.
Antibody also can be used for being designed to the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of mouse DIgR2 albumen high-affinity can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing the cell of mouse DIgR2 protein positive.
The production of polyclonal antibody available mouse DIgR2 albumen or polypeptide immune animal, as rabbit, mouse, rat etc.Multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.
Utilize albumen of the present invention,, can filter out with DIgR2 albumen interactional material takes place, as part, inhibitor, agonist or antagonist etc. by various conventional screening methods.
Albumen of the present invention and antibody thereof, inhibitor, agonist, antagonist or acceptor etc. when using (administration) in treatment, can provide different effects.Usually, can these materials are formulated in nontoxic, inert and the pharmaceutically acceptable aqueous carrier medium, wherein pH is about 5-8 usually, and preferably pH is about 6-8, although the pH value can be with being changed to some extent by preparation Substance Properties and illness to be treated.The pharmaceutical composition for preparing can carry out administration by conventional route, comprising (but being not limited to): intramuscular, intraperitoneal, intravenously, subcutaneous, intracutaneous or topical.
Polypeptide of the present invention can be directly used in disease treatment, for example, is used for tumour, inflammation, the treatment of neural system and cardiovascular diseases aspect.
The present invention also provides a kind of pharmaceutical composition, and it contains DIgR2 polypeptide of the present invention or its agonist, antagonist and the pharmaceutically acceptable carrier or the vehicle of safe and effective amount.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.Pharmaceutical composition of the present invention can be made into the injection form, for example is prepared by ordinary method with the physiological saline or the aqueous solution that contains glucose and other assistant agents.Pharmaceutical composition such as tablet and capsule can be prepared by ordinary method.Pharmaceutical composition such as injection, solution, tablet and capsule should be made under aseptic condition.The dosage of activeconstituents is the treatment significant quantity, for example every day about 1 microgram/kg body weight-Yue 5 mg/kg body weight.In addition, polypeptide of the present invention also can use with the other treatment agent.
When making pharmaceutical composition, be that the DIgR2 albumen of safe and effective amount or its antagonist, agonist are applied to Mammals, wherein this safe and effective amount is usually at least about 10 micrograms/kg body weight, and in most of the cases be no more than about 8 mg/kg body weight, preferably this dosage is about 10 micrograms/kg body weight-Yue 1 mg/kg body weight.Certainly, concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.
Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with the protein bound peptide molecule of mouse DIgR2 obtains.During screening, must carry out mark to mouse DIgR2 protein molecular.
The invention still further relates to the diagnostic testing process of quantitative and detection and localization mouse DIgR2 protein level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.The mouse DIgR2 protein level that is detected in the test can be with laying down a definition the importance of mouse DIgR2 albumen in various diseases and be used to the disease of diagnosing DIgR2 albumen to work.
Whether having the proteic method of DIgR2 in a kind of detection test sample is to utilize the proteic specific antibody of DIgR2 to detect, and it comprises: sample is contacted with the DIgR2 protein specific antibody; Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample DIgR2 albumen.
The proteic polynucleotide of DIgR2 can be used for the diagnosis and the treatment of DIgR2 protein related diseases.Aspect diagnosis, the proteic polynucleotide of DIgR2 can be used for detecting the proteic expression of DIgR2 DIgR2 abnormal exprssion whether or under morbid state.Can be used for the hybridization of biopsy specimen to judge the proteic abnormal expression of DIgR2 as the DIgR2DNA sequence.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.Carry out RNA-polymerase chain reaction (RT-PCR) amplification in vitro with the special primer of DIgR2 albumen and also can detect the proteic transcription product of DIgR2.
The sudden change that detects the DIgR2 gene also can be used for the disease of diagnosing DIgR2 albumen relevant.The form of DIgR2 protein mutation comprises that the point mutation compared with normal wild type DIgR2 dna sequence dna, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.
Sequence of the present invention identifies it also is valuable to karyomit(e).In brief, the proteic cDNA of DIgR2 prepares PCR primer (preferred 15-35bp) according to the present invention, sequence can be positioned on the karyomit(e).Then, these primers are used for the somatocyte hybrid cell that the PCR screening contains each bar human chromosome.Have only those hybrid cells that contain corresponding to the people's gene of primer can produce the fragment of amplification.
In case sequence is positioned to chromosome position accurately, the physical location of this sequence on karyomit(e) just can be associated with the gene map data.These data for example are found in, V.Mckusick, MendelianInheritance in Man (can by with the online acquisition of Johns Hopkins University Welch Medical Library).Can pass through linkage analysis then, determine gene and navigated to relation between the disease on the chromosomal region already.
In an example of the present invention, a kind of isolating polynucleotide are provided, its coding has the polypeptide of aminoacid sequence shown in the SEQ IDNO:2.Polynucleotide of the present invention are isolated from the dendritic cell cDNA in mouse bone marrow cells source.Its sequence is shown in SEQ ID NO:1, and the polynucleotide sequence total length that it comprises is 1076 bases, and its open reading frame is positioned at the 64-1056 position, and the coding total length is 330 amino acid whose mouse DIgR2 albumen (SEQ ID NO:2).
This sequence utilizes ANTHEPROT and ExPASy analysis software to analyze demonstration, is complete TMDs from the 188th amino acids to 207 amino acids, and the N end has 19 amino acid signal peptides, and pointing out this albumen is an I type transmembrane molecule; At the extracellular section, contain an immunoglobulin (Ig) V district; In the intracellular region section, LCYADL and VSYAAL structure are arranged, it meet V/L/IxYxxL/V this-immunity receptor in the relevant inhibition type motif ITIM of tyrosine; According to the constitutional features of this a part, think that it is an inhibition acceptor new in the immunoglobulin superfamily.Because the inventor once named one to be DIgR1 (Luo K with CMRF-35A homologous molecule in the past, et.al.DIgR1, a novel membrane receptorof the immunoglobulin gene superfamily, is preferentially expressed by antigen-presenting cells.Biochem Biophys Res Commun.2001; 287 (1): 35-41), be DIgR2 so name this and CMRF-35H homologous recruit.
Northern, RT-PCR analyze prompting DIgR2 wide expression in healthy tissues, but it is lower to express abundance, except that not detecting the expression signal in mononuclear macrophage system, at various hematopoietic cells systems and part tumor cell line in various degree expression are arranged all.
Behind the prokaryotic expression DIgR2 albumen preparation, purifying the polyclonal antibody of anti-DIgR2.Western detects and shows that DIgR2 is a glycosylated protein in vivo, and the about 60kDa of molecular weight exists with monomeric form; By the gene transfection eukaryotic cell, indirect immunofluorescence detects determines that DIgR2 is an epicyte protein simultaneously.
In addition, utilize co-immunoprecipitation to confirm that the ITIM of DIgR2 born of the same parents' inner segment has the potential ability in conjunction with SHP-1, prompting DIgR2 is a novel inhibition acceptor.Prove tentatively that with antibody blocking and the competitive blocking experiment of Fc fusion rotein DIgR2 plays restraining effect for the expression of mhc class ii molecule I-Ab in the ripening process of DC and costimulatory molecules CD80 (B7-1) respectively, thereby suppress the ability that DC stimulates T cell proliferation, finally might play the negativity regulating and controlling effect for immunne response.
Research prompting of the present invention, DIgR2 may be the same with other inhibitive ability of immunity acceptors, by the ITIM motif conduction conditioning signal of its intracellular region, regulates and control multiple physiology and pathology activity, the anti-autoimmune disorder of tool potential, antitumor, anti-inflammatory effect.Therefore, DIgR2 albumen or its relevant antagonist, agonist etc. can be diseases such as treatment autoimmune disorder, tumour, inflammation, neural system and cardiovascular diseases new immunodiagnosis and targeted therapy approach are provided, thereby have great application prospect.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (NewYork:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1: the clone of mouse DIgR2 cDNA
Extract the total RNA of mouse dcs with Trizol reagent (Invitrogen company), after reverse transcription forms cDNA, usefulness upstream primer 5 '-G
GAATTCTGTTCTCGCTGGCAGGCTC-3 ' (SEQ IDNO:3) and downstream primer 5 '-GC
TCTAGAAGCCGCCTTCAGAGA CCAAGATT-3 ' (SEQID NO:4) carries out pcr amplification.The amplification parameter be 94 ℃ 30 seconds, 57 ℃ 30 seconds, 72 ℃ 45 seconds, capable 2% agarose gel electrophoresis of PCR product is tentatively confirmed after 30 circulations.After cutting with the EcoRI/XbaI enzyme, insert the pGEM-3Z carrier, measure random choose clone's 5 ' terminal sequence with dideoxy method.CDNA sequence and the existing public dna sequence data storehouse measured are compared, found that this dna sequence dna is new full-length cDNA.Computer Analysis shows that full-length cDNA is a new cDNA sequence (shown in SEQID NO:1), the new protein (shown in SEQ ID NO:2) of encoding.This protein be named as mouse immune inhibition acceptor DIgR2 (DC-derived Ig-like receptor 2, DIgR2), its encoding gene called after mouse inhibitive ability of immunity acceptor DIgR2 gene.
Mouse immune inhibition acceptor DIgR2 full-length cDNA is 1076bp, comprises 3 ' end non-coding region of 5 of 63bp ' end non-coding region and 20bp, and coding contains 330 amino acid whose polypeptide, and calculating not in theory, the molecular weight of glycosylated ripe molecule is about 36.3kD.The proteic N end of mouse immune inhibition acceptor DIgR2 comprises 21 amino acid whose secreting signal peptides, has 2 N-glycosylation sites at 79 and 86, strides the film district and is positioned at the 188-206 position.
MHLSLLVPFL FWITGCCTAE D PVTGPEEVS GQEQGSLTVQ CRYTSGWKDY 50
MSDAGIYWCG ITKGGLDPMF KVTVNIGPVP TMPPITSTTT IFTVTTTVKE 150
TSMFPTLTSY YSDDGHGGGD SGGGEDGVGD GFLDLNV
LLP IISAVLLLLL 200
LVASLFAWRM VRRQKKAAGP PSEQAQSLEG DLCYADLSLK QPRTSPGSSW 250
KKGSSMSSSG KDHQEEVEYV TMALFPREEV SYAALTLAGL GQEPTYGNTG 300
CPITHVPRTG LEEETTEYSS IRRPLPAAMP 330
(SEQ ID NO:2, wherein residue is the N-glycosylation site in the square frame; The single line district is a signal peptide; The two-wire district is for striding the film district)
This sequence utilizes ANTHEPROT and ExPASy analysis software to analyze demonstration, is complete TMDs from the 188th amino acids to 207 amino acids, and the N end has 19 amino acid signal peptides, and pointing out this albumen is an I type transmembrane molecule (Fig. 1); At the extracellular section, contain an immunoglobulin (Ig) V district; In the intracellular region section, LCYADL and VSYAAL structure are arranged, it meets the relevant inhibition type motif ITIM of tyrosine in this immunity receptor of V/L/IxYxxL/V.
They are different with known for the BLAST analysis revealed, and homology comparison shows that DIgR2 and people CMRF-35H have 28% similarity; Its extracellular fragment and people CMRF-35A have 38% similarity, with the DIgR1 of mouse 34% similarity are arranged, and with mouse pIgR V1 district 34% similarity are arranged, and there is 36% similarity in the V4 district.DIgR2 and mouse DIgR1 have 34% similarity at extracellular fragment, but differ greatly at born of the same parents' inner segment.
Embodiment 2: carry out the cell expressing analysis of mouse DIgR2 with the RT-PCR method
Extract the total RNA of dendritic cell that is in the corresponding clone of logarithmic phase, mouse peripheral blood lymphocytes and stimulates the mouse peripheral blood lymphocytes source of different time with Trizol reagent, get 5 μ g cell total rnas and 1 μ g Oligo-dT through LPS
12-
18Mix, carry out reverse transcription.The reverse transcription system is 20 μ l, and reaction adds 80 μ l ddH after finishing
2O dilutes.The used primer of pcr amplification DIgR2 is as follows: have adopted primer 5 '-G
GAATTCTGTTCTCGCTGGCAGGCTC-3 ' (SEQ ID NO:3), antisense primer 5 '-GC
TCTAGAAGCCGCC TTCAGAGACCAAGATT-3 ' (SEQ ID NO:4), simultaneously with β-actin as positive control.The PCR reaction volume is 50 μ l, wherein contain reverse transcription template 10 μ l, 0.5mM primer, 0.2mM dNTP and 1U rTaq archaeal dna polymerase (Takara company), the amplification parameter be 95 ℃ 15 seconds, 57 ℃ 30 seconds, 72 ℃ 45 seconds, capable 2% agarose gel electrophoresis of PCR product is tentatively confirmed after 28 circulations.The dna sequence analysis result shows that the DNA sequences encoding of this PCR product and the 19-1076 shown in the SEQ ID NO:1 are identical.
The result as shown in Figure 2.RT-PCR analyzes prompting DIgR2 and has wide expression, but it is lower to express abundance, except that not detecting the expression signal in mononuclear macrophage system, at various hematopoietic cells systems and part tumor cell line in various degree expression (Fig. 2) is arranged all.
The Northern engram analysis of embodiment 3 mouse DIgR2
Carry out the Northern trace by following ordinary method: filter membrane to be checked places the hybridization solution of 10ml through 68 ℃ of preheatings, in hybrid heater (Bellco) in 68 ℃ of prehybridizations 30 minutes; The cDNA probe that mark is good was in 95~100 ℃ of sex change 2~5 minutes, and (cDNA probe final concentration is 2~10ng/ml or 1~2 * 10 to put rapid cooling back adding hybridization solution on ice
6Cpm/ml), fully mixing was hybridized 2 hours in 68 ℃.After hybridization finishes, filter membrane with 2 * SSC, the drip washing of 0.05%SDS room temperature for several times, the washing lotion several is changed in continuing vibration flushing 30~40 minutes therebetween.Use 0.1 * SSC, 0.1%SDS in 50 ℃ of vibration flushings 20~40 minutes subsequently.Last filter membrane wrapped up with plastic fresh-keeping membrane, in-70 ℃ of exposure X line films 24~48 hours.
Northern blot hybridization result shows: there is the transcript of 1.4kb and 3.0kb in DIgR2 mRNA, have in many healthy tissuess such as the heart, brain, spleen, liver, lungs, skeletal muscle, kidney, testis in various degree and express, this shows that DIgR2 albumen is a kind of albumen (Fig. 3) of particular expression.
In this embodiment, be template with the total length plasmid DNA among the embodiment 1, increase with the PCR Oligonucleolide primers of 5 ' and 3 following ' end of sequence, obtain mouse DIgR2 DNA as inserting fragment.
5 ' end Oligonucleolide primers sequence of using in the PCR reaction is:
5′-
GGATCCATAGTCACAGGTCC-3′(SEQ ID NO:5)
This primer contains the restriction enzyme site of BamH I restriction enzyme, is the part encoding sequence of mouse DIgR2 after this restriction enzyme site;
3 ' end primer sequence is:
5′-
GAATTCGGAGCACACTGAGATCCAG-3′(SEQ ID NO:6)
This primer contains the restriction enzyme site of EcoR I restriction enzyme and the part encoding sequence of mouse DIgR2.
With the PCR product purification that obtains after BamH I/EcoR I enzyme cut and recombinate according to a conventional method with plasmid pGEM-3ZF again and be converted into the competence e. coli bl21, the picking positive colony is identified back purifying and order-checking (377 type sequenators of ABI company, BigDye Terminator test kit, PE company).The mouse DIgR2 cDNA BamH I/EcoR I endonuclease bamhi of correct sequence is cloned into expression vector pGEX-2T (Pharmacia company), forms carrier pGEX-2T-mouse DIgR2, then transformed into escherichia coli BL21.Confirm through order-checking, inserted designed DIgR2 encoding sequence.
Choosing the positive BL21 clone who expresses DIgR2 is inoculated in 100ml 2 * YTA substratum, 37 ℃ of 300rpm shaking culture 12-15hr, 2 * YTA substratum that 1:10 is diluted in preheating continues shaking culture 1.5hr, add behind the 100mM IPTG to 0.1mM 30 ℃ and induce 2-6hr, 5,000g4 ℃ of centrifugal 10min removes supernatant, puts and uses 50ml 1 * PBS (0.14M NaCl on ice, 2.7mM KCl, 10.1mM Na
2HPO
4, 1.8mMKH
2PO
4PH7.3) resuspended, add 20% Triton X-100 to 1% jog 30min again after ultrasonic (B.Braun Labsonic U) fragmentation, then 12,4 ℃ of centrifugal 10min of 000g, supernatant with 0.8 μ m membrane filtration after, cross 1ml 50% glutathione S epharose 4B chromatography column, behind 1 * PBS thorough washing, adding 500ul gsh elution buffer (pH 8.0 for 10mM gsh, 50mM Tris-HCl) room temperature left standstill after 30 minutes collects elutriant, repeat wash-out 2-3 time, obtain mouse DIgR2 albumen.
Carry out the n terminal amino acid sequential analysis with the Edams hydrolysis method, 10 amino-acid residues of N-end shown in 10 amino acid of N-end and the SEQ IDNO:2 are identical as a result.
Embodiment 5: anti-mouse DIgR2 production of antibodies
The recombinant protein mouse DIgR2 that obtains among the embodiment 4 is used for immune new zealand rabbit to produce antibody, and concrete grammar is as follows.Recombinant molecule is standby after separating with chromatography.Also available SDS-PAGE gel electrophoresis separates, electrophoretic band downcut from gel, and with isopyknic complete Freund ' s adjuvant (Sigma company) emulsification.Albumen with 50-100 μ g/0.2ml emulsification carries out peritoneal injection to mouse.After 14 days,, mouse is carried out peritoneal injection with booster immunization with the dosage of 50-100 μ g/0.2ml with the same antigen of non-complete Freund ' s adjuvant (Sigma company) emulsive.Carried out booster immunization one time every 14 days, carry out at least three times.The sero-fast specific reaction that obtains is active to be assessed in the ability of external precipitation mouse DIgR2 gene translation product with it.Found that antibody can combine with albumen of the present invention specifically.
Embodiment 6: the facs analysis that behind the anti-DIgR2 polyclonal antibody processing DC DC phenotype is influenced
With the how anti-bone marrow cells in mice of handling fresh separated with 50 μ g/ml (in contrast) that obtains among the embodiment 5 with normal rabbit igg, the temperature of antibody incubation is 37 ℃, time is 2 hours, finishing the back washes 3 times with PBS, cultivate in the substratum that 2ng/ml IL-4 (Sigma company) and 10ng/mlGM-CSF (Sigma company) are arranged through many anti-bone marrow cells in mice of handling, collect DC after 8 days and detect the surperficial MHC quasi-molecule of DC and the expression of costimulatory molecules with FACS.
The result shows, compares MHC-II quasi-molecule I-A with control group
dObviously improve with the expression of costimulatory molecules CD80 (B7-1); CD86 (B7-2) has trend of rising, and CD11c and CD54 expression amount do not change (Fig. 4).
Embodiment 7: mixed lymphocyte reacion (MLR)
Handle DC with embodiment 6, the DC that obtains is through 3000 rads'
60After the Co irradiation, (1:10,1:100 1:1000) carry out mixed lymphocyte reacion with allotype T cell in 96 orifice plates, every hole T cell count is 2 * 10 in varing proportions
5/ 100 μ l, cumulative volume are 200 μ l, cultivate altogether 4 days, finish preceding 18 hours every holes in cultivation and add 1 μ Ci
3H-TdR (Amersham company).Finish the back and be collected on the glass fibre membrane, detect with the β calculating instrument with bull cell harvesting instrument
3The H value of mixing.
The result shows, with compare, the DC that the anti-DIgR2 polyclonal antibody of process was handled significantly strengthens the stimulation ability of T cell proliferation, shows the angtigen presentation increased functionality that resists the DC that blocked through DIgR2 more, thereby proves that DIgR2 plays negative regulation effect (Fig. 5) to the angtigen presentation function of DC.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
<110〉Inst. of Immunology, Zhejiang Univ.
<120〉the inhibitive ability of immunity acceptor in dendritic cell source, its encoding sequence and purposes
<130>031801
<160>6
<170>PatentIn version 3.1
<210>1
<211>1076
<212>DNA
<213〉homo sapiens (Homo sapiens)
<220>
<221>CDS
<222>(64)..(1053)
<223>
<400>1
<210>2
<211>330
<212>PRT
<213〉homo sapiens (Homo sapiens)
<400>2
<210>3
<211>26
<212>DNA
<213〉artificial sequence
<220>
<221>misc_feature
<222>(1)..(26)
<223〉primer
<400>3
<210>4
<211>31
<212>DNA
<213〉artificial sequence
<220>
<221>misc_feature
<222>(1)..(31)
<223〉primer
<400>4
<210>5
<211>20
<212>DNA
<213〉artificial sequence
<220>
<221>misc_feature
<222>(1)..(20)
<223〉primer
<400>5
<210>6
<211>25
<212>DNA
<213〉artificial sequence
<220>
<221>misc_feature
<222>(1)..(28)
<223〉primer
<400>6
Claims (2)
1. the purposes of a peptide species, described amino acid sequence of polypeptide is 1-330 position or 22-330 position among the SEQ ID NO:2, it is characterized in that, described polypeptide is used to prepare the composition that immunne response is played the negativity regulating and controlling effect.
2. a composition that is used for immunne response is risen the negativity regulating and controlling effect is characterized in that, the aminoacid sequence that it contains safe and effective amount is the polypeptide and the pharmaceutically acceptable carrier of 1-330 position or 22-330 position among the SEQ ID NO:2.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNB031295673A CN100480263C (en) | 2003-06-27 | 2003-06-27 | Immunosuppressive receptor derived from dendritic cell, coding sequence and uses thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNB031295673A CN100480263C (en) | 2003-06-27 | 2003-06-27 | Immunosuppressive receptor derived from dendritic cell, coding sequence and uses thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN1566149A CN1566149A (en) | 2005-01-19 |
CN100480263C true CN100480263C (en) | 2009-04-22 |
Family
ID=34469362
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CNB031295673A Expired - Fee Related CN100480263C (en) | 2003-06-27 | 2003-06-27 | Immunosuppressive receptor derived from dendritic cell, coding sequence and uses thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN100480263C (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104225627B (en) * | 2014-09-29 | 2016-09-14 | 武汉大学 | The leukocytic immunity globulin sample receptor subfamily B member 4 function and application in treatment atherosclerosis |
-
2003
- 2003-06-27 CN CNB031295673A patent/CN100480263C/en not_active Expired - Fee Related
Non-Patent Citations (6)
Title |
---|
. EMBL ID 号 AY214460. 2003 |
. EMBL ID 号 AY214460. 2003 * |
DIgR1, a novel membrane receptor of the immunoglobulin gene superfamily, is preferentially expressed by antigen-presenting cells. Luo Kun等.Biochemical and Biophysical Research Communications,Vol.287 . 2001 |
DIgR1, a novel membrane receptor of the immunoglobulin gene superfamily, is preferentially expressed by antigen-presenting cells. Luo Kun等.Biochemical and Biophysical Research Communications,Vol.287 . 2001 * |
新型免疫抑制性受体DIgR2的发现及其功能研究. 罗坤等.中国免疫学会第四届学术大会会议议程及论文摘要集. 2002 |
新型免疫抑制性受体DIgR2的发现及其功能研究. 罗坤等.中国免疫学会第四届学术大会会议议程及论文摘要集. 2002 * |
Also Published As
Publication number | Publication date |
---|---|
CN1566149A (en) | 2005-01-19 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN100480263C (en) | Immunosuppressive receptor derived from dendritic cell, coding sequence and uses thereof | |
CN1308346C (en) | Novel human phosphotidylethanolamine binding protein, its coding sequence and application | |
CN100425695C (en) | Novel human Rab GTP enzyme, its coding sequence and application | |
CN1371916A (en) | Human siali acid conjugated immunoglobulin-like agglutinant, its coding sequence and use | |
EP1566386B1 (en) | A baldness related gene and the polypeptide encoded thereby, and uses thereof | |
CN100400658C (en) | New type human death resist protein, its coded sequence and use | |
CN100523189C (en) | Function and use of human immune cell inhibition acceptor KLRL1 | |
CN100443501C (en) | Mitochondria traffic protein molecule for human marrow stromal cell and sequence encoding same and use thereof | |
CN1475502A (en) | New withered induced protein, its coded sequence and use | |
CN1477118A (en) | Novel DnaJ/Hsp40 molecule DC-DJIII, its coding sequence and application | |
CN100408597C (en) | Human calcium ion / calmodulin deopendent protein kinase II inhibitory protein alpha, its coded sequence and use | |
CN1223607C (en) | Human calcium ion/calmodulin dependent protein kinase II inhibitory protein and its application | |
CN1778816B (en) | Human cell surface membrane molecule and use thereof | |
CN1325874A (en) | Human C-type lectin-like receptor and its coding sequence and application | |
CN100358917C (en) | Tumor tag and the use thereof | |
CN1299827A (en) | New human CD20 homolgous molecule and its code sequence and use | |
CN1299828A (en) | New cell factor acceptor and its code sequence and use | |
CN1171901C (en) | New interferon-like protein and its code sequence and use | |
CN1477114A (en) | Immunoglobulin sample receptor originated from human dendritic cell, its coding sequence and application | |
CN1477119A (en) | Novel Human cysteine proteinase inhibitor sample molecule, its coding sequence and application | |
CN1477115A (en) | Novel human cyclin, its coding sequence and application | |
CN1477116A (en) | Novel human secretion-related membrane protion, its coding sequence and its application | |
CN1475500A (en) | New type human marrow differentiation tagged object its coded sequence and use | |
CN1377891A (en) | Zinc finger protein from dendritic cell, its coding sequence and use | |
CN1288057A (en) | Coded novel human angiotensin II-1 receptor related protein gene, and application and prepn. method therefor |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20090422 Termination date: 20160627 |
|
CF01 | Termination of patent right due to non-payment of annual fee |