CN1475501A - New type human bone marrow substrate cell source 1 type phosphoric acid enzyme inhibition factor, its coded sequence and use - Google Patents

New type human bone marrow substrate cell source 1 type phosphoric acid enzyme inhibition factor, its coded sequence and use Download PDF

Info

Publication number
CN1475501A
CN1475501A CNA021365245A CN02136524A CN1475501A CN 1475501 A CN1475501 A CN 1475501A CN A021365245 A CNA021365245 A CN A021365245A CN 02136524 A CN02136524 A CN 02136524A CN 1475501 A CN1475501 A CN 1475501A
Authority
CN
China
Prior art keywords
ipp2
polypeptide
sequence
polynucleotide
people
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CNA021365245A
Other languages
Chinese (zh)
Other versions
CN1290861C (en
Inventor
王晓健
李楠
曹雪涛
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
INST OF IMMUNOLOGY ZHEJIANG UNIV
Original Assignee
INST OF IMMUNOLOGY ZHEJIANG UNIV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by INST OF IMMUNOLOGY ZHEJIANG UNIV filed Critical INST OF IMMUNOLOGY ZHEJIANG UNIV
Priority to CN 02136524 priority Critical patent/CN1290861C/en
Publication of CN1475501A publication Critical patent/CN1475501A/en
Application granted granted Critical
Publication of CN1290861C publication Critical patent/CN1290861C/en
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Images

Landscapes

  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

A protein phosphatase 1 inhibitor-2 (IPP2), its coding polynucleotide, the process for recombining said protein, and the application of said IPP2 can its polynucleotide coding sequence in diagnosing and treating cancer are disclosed.

Description

1 type Phosphoric acid esterase supressor of new type human bone marrow substrate cell source, its encoding sequence and purposes
Technical field
The invention belongs to biotechnology and medical field, specifically, the present invention relates to 1 type Phosphoric acid esterase supressor IPP2 of new human bone marrow substrate cell source, and the polynucleotide encoding sequence.The invention still further relates to the purposes and the preparation of these polynucleotide and polypeptide.IPP2 is a soluble proteins in a kind of and anti-apoptosis cell relevant with memory, has opposing apoptosis and the function of keeping memory.
Background technology
Phosphorylation modification is topmost in organism metabolism and the signal path, also is regulative mode the most efficiently.And this mode is to realize by the perfect coordination of kinases and Phosphoric acid esterase, 1 type phosphoprotein phosphatase (PP-1) is the very important serine/threonine Phosphoric acid esterase of a class, by dephosphorylation albumen adjusting cell cycle, genetic expression, synthetic, the glycolipid metabolism of albumen, reach physiological functions such as memory formation.It is made up of catalytic subunit and adjusting subunit, and the latter determines the substrate specificity of Phosphoric acid esterase, activity and Subcellular Localization.1 type Phosphoric acid esterase supressor (IPP-1, inhibitor of protein phosphatase 1,) be that first finds to regulate the active endogenous molecule of 1 type phosphoprotein phosphatase, IPP-1 can suppress the dephosphorylation of PP1 to pCREB (cAMP response element binding protein), keep high-caliber pCREB, and the activation of CREB be phosphorylation is many cells, particularly the prerequisite that forms of neuronal survival and long-time memory.As everyone knows, senior physiological activity such as learning and memory all relates to the generation of cynapse LTP (the long-time enhancing), and PP1 promotes LTD (suppressing for a long time), and IPP-1 is by suppressing the generation that PP1 promotes LTP (the long-time enhancing).The generation of the LTP of the postsynaptic neuron that RpcAMP (inhibitor of PKA) inhibition HFS (high frequency stimulation) causes, and phosphorylation IPP-1 can reverse this situation, as seen, external stimulus is by PKA phosphorylation IPP-1, and then inhibition phosphatase activity, cause the change of some signaling pathway proteins and transcription factor phosphorylation degree, cause the change of a series of physiological function of cell.
In view of the factor relevant with phosphorylation has the important physical function, therefore, this area press for exploitation newly with the factor relevant with phosphorylation.
Summary of the invention
The purpose of this invention is to provide a kind of new 1 type Phosphoric acid esterase supressor IPP2 albumen of going into bone marrow substrate cell source with and fragment, analogue and derivative.
Another object of the present invention provides the polynucleotide of these polypeptide of coding.
Another object of the present invention provides the method for these polypeptide of production and the purposes of this polypeptide and encoding sequence.
In a first aspect of the present invention, novel isolated IPP2 polypeptide is provided, this polypeptide is the people source, it comprises: polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative with SEQ ID NO:2 aminoacid sequence.Preferably, this polypeptide is selected from down group: the polypeptide that (a) has SEQ ID NO:2 aminoacid sequence; (b) SEQ ID NO:2 aminoacid sequence is formed through replacement, disappearance or the interpolation of one or more amino-acid residues, and have suppress scavenger cell RAW 264.7 apoptosis functions by (a) polypeptides derived.
In a second aspect of the present invention, the polynucleotide of isolating these polypeptide of coding are provided, these polynucleotide comprise a nucleotide sequence, and this nucleotide sequence is shown at least 70% homogeny with a kind of nucleotides sequence that is selected from down group: (a) polynucleotide of the above-mentioned people IPP2 of coding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 235-582 position among the SEQ ID NO:1; (b) has the sequence of 1-1637 position among the SEQ ID NO:1.
In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.
In a fourth aspect of the present invention, provide preparation to have the method for the polypeptide of people IPP2 protein-active, this method comprises: (a) under the proteic condition of suitable expressing human IPP2, cultivate the above-mentioned host cell that is transformed or transduce; (b) from culture, isolate polypeptide with people IPP2 protein-active.
In a fifth aspect of the present invention, provide and above-mentioned people IPP2 polypeptid specificity bonded antibody.The nucleic acid molecule that can be used for detecting also is provided, and it contains a successive 15-1637 Nucleotide in the above-mentioned polynucleotide.
In a sixth aspect of the present invention, the compound of simulation, promotion, antagonism people IPP2 polypeptide active is provided, and the compound that suppresses people IPP2 polypeptide expression.The method of screening and/or prepare these compounds also is provided.Preferably, this compound is encoding sequence or its segmental antisense sequences of people IPP2 polypeptide.
In a seventh aspect of the present invention, provide and whether had the proteic method of IPP2 in the test sample, it comprises: sample is contacted with the proteic specific antibody of IPP2, observe whether form antibody complex, formed antibody complex and just represented to exist in the sample IPP2 albumen.
In a eighth aspect of the present invention, a kind of disease relevant with people IPP2 polypeptide unconventionality expression or method of disease susceptibility of detecting is provided, this method comprises: whether have sudden change in the nucleotide sequence of detection coding said polypeptide.
In a ninth aspect of the present invention, provide the purposes of polypeptide of the present invention and encoding sequence.Polypeptide for example of the present invention can be used to screen the agonist that promotes people IPP2 polypeptide active, and perhaps screening suppresses the antagonist of people IPP2 polypeptide active or is used to the peptide finger print identification.The proteic encoding sequence of people IPP2 of the present invention or its fragment can be used as primer and be used for pcr amplification reaction, perhaps are used for hybridization as probe, perhaps are used to make gene chip or microarray.
In a tenth aspect of the present invention, a kind of pharmaceutical composition is provided, it contains people IPP2 polypeptide of the present invention or its agonist, antagonist and the pharmaceutically acceptable carrier of safe and effective amount.These pharmaceutical compositions can be treated illnesss such as tumour, inflammation, neural system and cardiovascular diseases.
Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
Description of drawings
Fig. 1 has shown people IPP2 RT-PCR expression analysis result of the present invention, and prompting IPP2 is expressed in some tumour cell.
Fig. 2 is the shown distribution of people IPP2 Northern blot hybridization of the present invention.Results suggest IPP2 is the molecule that a kind of tool particular organization distributes.
Fig. 3 has shown that people IPP2 suppresses the ERK activation that LPS induces RAW 264.7.
Fig. 4 has shown the apoptosis of the RAW 264.7 that people IPP2 inhibition NO causes.
Fig. 5 has shown that people IPP2 keeps the phosphorylation of NIH 3T3 and PC-12 cell.
Embodiment
The inventor utilizes cDNA library large scale sequencing and EST homology method relatively, from normal people's marrow stromal cell, be separated to a kind of novel full-length gene, total length is 1637bp, contain the 348bp coding region, 116 amino acid of encoding are relatively pointed out the inhibition subunit IPP-1 that may belong to 1 type Phosphoric acid esterase family with the homology of other molecules.Especially in N end functional zone and people IPP-1 height homology, should new unnamed gene be IPP2 therefore.
RT-PCR shows that this molecule is the expression that exists in tumour such as Daudi, MOLT-4, Raji, THP-1, K562, HT-29, Hela, A549, NAM, TF-1,2162, Hut and Hela, A549, the HT29 solid tumor in various degree in some hematopoiesis.The Northern trace shows that IPP2mRNA expresses at normal human heart, liver, skeletal muscle, testes specificity, wherein has three transcripts in cardiac muscle and the skeletal muscle.Confirm that by the vitro kinase analysis this molecule can suppress the PP-1 enzymic activity, and IC50 and people IPP-1 protein similar.Find that simultaneously the IPP2 molecule can suppress the ERK activation that LPS causes, and can suppress NO and induce the RAW264.7 apoptosis.And IPP2 transient transfection NIH 3T3 and PC-12 cell can be kept the high-caliber CREB phosphorylation degree that 8-Br-cAMP/IBMX causes.And the phosphorylation of CREB can make inhibitor of apoptosis protein Bcl-2 express rising.We infer that IPP2 by suppressing PP1, keeps the activation of some signal proteins and transcription factor, and some survivin expressions are raised.And then the apoptosis that causes of opposing extraneous factor
In a word, IPP2 is as a kind of novel Phosphoric acid esterase supressor, by suppressing Phosphoric acid esterase, keep the phosphorylation of mesonic molecule in some important signal path or transcription factor, transmit and amplify some signal, at aspects such as anti-apoptotic, memory formations, signal transductions important effect is arranged, so this molecule has important development and application value in a plurality of fields such as the adjusting of body's immunity, antitumor, anti-virus infection, nerve retrograde affection treatment.
In the present invention, term " IPP2 albumen ", " IPP2 polypeptide " or " 1 type Phosphoric acid esterase supressor IPP2 of bone marrow substrate cell source " are used interchangeably, and all refer to have the albumen or the polypeptide of 1 type Phosphoric acid esterase supressor IPP2 aminoacid sequence (SEQ ID NO:2) of human bone marrow substrate cell source.
As used herein, " isolating " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.
As used herein, " isolating IPP2 albumen or polypeptide " is meant that the IPP2 polypeptide is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying IPP2 albumen of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.
Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.
The present invention also comprises the proteic fragment of people IPP2, derivative and analogue.As used herein, term " fragment ", " derivative " are meant with " analogue " and keep identical biological function of natural human IPP2 albumen of the present invention or active polypeptide basically.Polypeptide fragment of the present invention, derivative or analogue can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferred conservative amino acid residue), and the amino-acid residue of such replacement can be also can not encoded by genetic code, or (ii) in one or more amino-acid residues, has a polypeptide of substituted radical, or (iii) mature polypeptide and another compound (such as the compound that prolongs the polypeptide transformation period, polyoxyethylene glycol for example) merges formed polypeptide, or (iv) additional aminoacid sequence is fused to this peptide sequence and the polypeptide that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying, or with the fusion rotein of the segmental formation of antigen I gG).According to the instruction of this paper, these fragments, derivative and analogue belong to the known scope of those skilled in the art.
In the present invention, term " people IPP2 polypeptide " refers to have the SEQ ID NO.2 polypeptide of sequence of people IPP2 protein-active.This term also comprises having and variant form people IPP2 albumen identical function, SEQ ID NO.2 sequence.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises proteic active fragments of people IPP2 and reactive derivative.
The variant form of this polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, under high or low tight degree condition can with the coded albumen of the DNA of people IPP2 DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-people IPP2 polypeptide to obtain.The present invention also provides other polypeptide, as comprises people IPP2 polypeptide or its segmental fusion rotein.Except the polypeptide of total length almost, the present invention has also comprised the soluble fragments of people IPP2 polypeptide.Usually, this fragment have people IPP2 peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.
Invention also provides the analogue of people IPP2 albumen or polypeptide.The difference of these analogues and natural human IPP2 polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
In the present invention, " people IPP2 albumen conservative property variation polypeptide " refers to compare with the aminoacid sequence of SEQ ID NO:2, has 10 at the most, preferably at the most 8, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best.These conservative property variation polypeptide preferably carry out the amino acid replacement according to table 1 and produce.
Table 1
Initial residue Representational replacement The preferred replacement
Ala(A) Val;Leu;Ile ?Val
Arg(R) Lys;Gln;Asn ?Lys
Asn(N) Gln;His;Lys;Arg ?Gln
Asp(D) Glu ?Glu
Cys(C) Ser ?Ser
Gln(Q) Asn ?Asn
Glu(E) Asp ?Asp
Gly(G) Pro:Ala ?Ala
His(H) Asn;Gln;Lys;Arg ?Arg
Ile(I) Leu;Val;Met;Ala;Phe ?Leu
Leu(L) Ile;Val;Met;Ala;Phe ?Ile
Lys(K) Arg;Gln;Asn ?Arg
Met(M) Leu;Phe;Ile ?Leu
Phe(F) Leu;Val;Ile;Ala;Tyr ?Leu
Pro(P) Ala ?Ala
Ser(S) Thr ?Thr
Thr(T) Ser ?Ser
Trp(W) Tyr;Phe ?Tyr
Tyr(Y) Trp;Phe;Thr;Ser ?Phe
Val(V) Ile;Leu;Met;Phe;Ala ?Leu
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.As used herein, " varient of degeneracy " is meant that in the present invention coding has the protein of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.
The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence of an encoding mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.
Term " polynucleotide of coded polypeptide " can be the polynucleotide that comprise this polypeptide of encoding, and also can be the polynucleotide that also comprise additional code and/or non-coding sequence.
The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.
The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 50%, preferably at least 70%, the polynucleotide of at least 80% homogeny more preferably.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 90%, be more preferably 95% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.
The invention still further relates to nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " contains 15 Nucleotide at least, better is at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid to determine and/or the proteic polynucleotide of separation coding IPP2.
Polypeptide among the present invention and polynucleotide preferably provide with isolating form, more preferably are purified to homogeneous.
People IPP2 Nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.
In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.
In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.
At present, can be fully obtain the dna sequence dna of code book invention albumen (or its fragment, or derivatives thereof) by chemosynthesis.This dna sequence dna can be introduced in various existing dna moleculars as known in the art (or as carrier) and the cell then.In addition, also can will suddenly change and introduce in the protein sequence of the present invention by chemosynthesis.
Use method (Saiki, the et al.Science1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to obtain the cDNA of total length from the library, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with carrier of the present invention or IPP2 albumen coded sequence, and the method that produces polypeptide of the present invention through recombinant technology.
Recombinant DNA technology (Science, 1984 by routine; 224:1431), can utilize polymerized nucleoside acid sequence of the present invention to can be used to express or produce the IPP2 polypeptide of reorganization.In general following steps are arranged:
(1). with the polynucleotide (or varient) of coding of the present invention people IPP2 polypeptide, or with the recombinant expression vector that contains these polynucleotide proper host cell that transforms or transduce;
(2). the host cell of in suitable medium, cultivating;
(3). separation, protein purification from substratum or cell.
Among the present invention, people IPP2 polynucleotide sequence can be inserted in the recombinant expression vector.Term " recombinant expression vector " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carriers.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on T7 of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J BioChem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier can be used.A key character of expression vector is to contain replication orgin, promotor, marker gene and translation controlling elements usually.
Method well-known to those having ordinary skill in the art can be used to make up and contains people IPP2 DNA sequences encoding and suitable transcribing/the translate expression vector of control signal.These methods comprise (Sambroook, et al.Molecular Cloning, a LaboratoryManual, cold Spring Harbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; Lambda particles phage P LPromotor; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in protokaryon or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance.
Comprise the carrier of above-mentioned suitable dna sequence dna and suitable promotor or control sequence, can be used to transform appropriate host cell, so that it can marking protein.
Host cell can be a prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; The bacterial cell of Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; The insect cell of fruit bat S2 or Sf9; The zooblast of CHO, COS, 293 cells or Bowes melanoma cells etc.
When polynucleotide of the present invention are expressed in higher eucaryotic cells, be enhanced if will make to transcribe when in carrier, inserting enhancer sequence.Enhanser is the cis acting factor of DNA, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.
Persons skilled in the art all know how to select appropriate carriers, promotor, enhanser and host cell.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results 2Method is handled, and used step is well-known in this area.Another kind method is to use MgCl 2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.
The transformant that obtains can be cultivated with ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
The extracellular can be expressed or be secreted into to recombinant polypeptide in the above methods in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation handles, with protein precipitant handle (salt analysis method), centrifugal, the broken bacterium of infiltration, superly handle, the combination of super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
The people IPP2 albumen or the polypeptide of reorganization are of use in many ways.These purposes include, but is not limited to: the direct disease due to the low or forfeiture and be used to screen and promote or antibody, polypeptide or other part of antagonism IPP2 protein function as pharmacological agent IPP2 protein function.The peptide molecule that can suppress or stimulate people IPP2 protein function that can be used for seeking therapeutic value with the recombinant human IPP2 protein screening peptide library of expressing.
On the other hand, the present invention also comprises people IPP2 DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into people IPP2 gene product or fragment.Preferably, refer to that those can combine with people IPP2 gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress the proteic molecule of people IPP2, comprise that also those do not influence the antibody of people IPP2 protein function.The present invention also comprise those can with modify or without the people IPP2 gene product bonded antibody of modified forms.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab) 2Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule (people such as Ladner, U.S. Patent No. 4,946,778); Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.
Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the people IPP2 gene product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing human IPP2 albumen or its have antigenic segmental cell and can be used to immune animal and produce antibody.Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology prepare (see people such as Kohler, Nature256; 495,1975; People such as Kohler, Eur.J.Immunol.6: 511,1976; People such as Kohler, Eur.J.Immunol.6:292,1976; People such as Hammerling, In Monoclonal Antibodies and T Cell Hvbridomas, Elsevier, N.Y., 1981).Antibody of the present invention comprises the antibody that can block people IPP2 protein function and the antibody that does not influence people IPP2 protein function.Each antibody-like of the present invention can utilize the fragment or the functional zone of people IPP2 gene product, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of people IPP2 gene product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).
The proteic antibody of anti-people IPP2 can be used in the immunohistochemistry technology, detects the people IPP2 albumen in the biopsy specimen.In addition, with the also available labelled with radioisotope of the protein bound monoclonal antibody of people IPP2, inject in the body and can follow the tracks of its position and distribution.This radiolabeled antibody can be used as a kind of atraumatic diagnostic method and is used for the location of tumour cell and has judged whether transfer.
Antibody among the present invention can be used for treating or prevention and the relevant disease of people IPP2 albumen.The antibody that gives suitable dosage can stimulate or block proteic generation of people IPP2 or activity.
Antibody also can be used for being designed to the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of people IPP2 albumen high-affinity can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing the cell (for example lymph-node cell etc.) of people IPP2 protein positive.
The production of polyclonal antibody can choose IPP2 albumen or polypeptide immune animal, as rabbit, mouse, rat etc.Multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.
Utilize albumen of the present invention,, can filter out with IPP2 albumen interactional material takes place, as part, inhibitor, agonist or antagonist etc. by various conventional screening methods.
Albumen of the present invention and antibody thereof, inhibitor, agonist, antagonist or acceptor etc. when using (administration) in treatment, can provide different effects.Usually, can these materials are formulated in nontoxic, inert and the pharmaceutically acceptable aqueous carrier medium, wherein pH is about 5-8 usually, and preferably pH is about 6-8, although the pH value can be with being changed to some extent by preparation Substance Properties and illness to be treated.The pharmaceutical composition for preparing can carry out administration by conventional route, comprising (but being not limited to): intramuscular, intraperitoneal, intravenously, subcutaneous, intracutaneous or topical.
Polypeptide of the present invention or its agonist or antagonist can be directly used in disease treatment, for example, are used for tumour, inflammation, the treatment of neural system and cardiovascular diseases aspect.In use, also can use the other treatment agent simultaneously, as IFN-α, IFN-β, TNF-α, TNF-β etc.
The present invention also provides a kind of pharmaceutical composition, and it contains IPP2 polypeptide of the present invention or its agonist, antagonist and the pharmaceutically acceptable carrier or the vehicle of safe and effective amount.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.Pharmaceutical composition of the present invention can be made into the injection form, for example is prepared by ordinary method with the physiological saline or the aqueous solution that contains glucose and other assistant agents.Pharmaceutical composition such as tablet and capsule can be prepared by ordinary method.Pharmaceutical composition such as injection, solution, tablet and capsule should be made under aseptic condition.The dosage of activeconstituents is the treatment significant quantity, for example every day about 1 microgram/kg body weight-Yue 5 mg/kg body weight.In addition, polypeptide of the present invention also can use with the other treatment agent.
When making pharmaceutical composition, be that the IPP2 albumen of safe and effective amount or its antagonist, agonist are applied to Mammals, wherein this safe and effective amount is usually at least about 10 micrograms/kg body weight, and in most of the cases be no more than about 8 mg/kg body weight, preferably this dosage is about 10 micrograms/kg body weight-Yue 1 mg/kg body weight.Certainly, concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.
The proteic polynucleotide of people IPP2 also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treating because cell proliferation, growth or the metabolic disturbance due to the proteic expression of IPP2 of the proteic nothing expression of IPP2 or unusual/non-activity.The IPP2 albumen that the gene therapy vector (as virus vector) of reorganization can be designed to express variation is to suppress endogenic IPP2 protein-active.Deriving from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. can be used for the IPP2 transgenosis to cell.The method that structure carries the recombinant viral vector of IPP2 gene is found in existing document (Sambrook, et al.).Recombinant human IPP2 gene can be packaged in the liposome in addition, and then is transferred in the cell.
Suppress the oligonucleotide (comprising sense-rna and DNA) of people IPP2mRNA and ribozyme also within the scope of the invention.Ribozyme is the enzyme sample RNA molecule that a kind of energy specificity is decomposed specific RNA, and its mechanism of action is to carry out the endonuclease effect after ribozyme molecule and the hybridization of complementary target RNA-specific.The RNA of antisense and DNA and ribozyme can obtain with existing any RNA or DNA synthetic technology, as the technology widespread use of solid phase phosphoamide chemical synthesis synthetic oligonucleotide.Antisense rna molecule can be transcribed acquisition by the dna sequence dna of this RNA that encodes in external or body.This dna sequence dna has been incorporated into the downstream of rna polymerase promoter of carrier.In order to increase the stability of nucleic acid molecule, available several different methods is modified it, and as increasing the sequence length of both sides, the connection between the ribonucleoside is used phosphoric acid thioester bond or peptide bond but not phosphodiester bond.
Polynucleotide imports tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.
Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with the protein bound peptide molecule of people IPP2 obtains.During screening, must carry out mark to people IPP2 protein molecular.
The invention still further relates to the diagnostic testing process of quantitative and detection and localization people IPP2 protein level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.The people IPP2 protein level that is detected in the test can be with laying down a definition the importance of people IPP2 albumen in various diseases and be used to the disease of diagnosing IPP2 albumen to work.
Whether having the proteic method of IPP2 in a kind of detection test sample is to utilize the proteic specific antibody of IPP2 to detect, and it comprises: sample is contacted with the IPP2 protein specific antibody; Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample IPP2 albumen.
The proteic polynucleotide of IPP2 can be used for the diagnosis and the treatment of IPP2 protein related diseases.Aspect diagnosis, the proteic polynucleotide of IPP2 can be used for detecting the proteic expression of IPP2 IPP2 abnormal exprssion whether or under morbid state.Can be used for the hybridization of biopsy specimen to judge the proteic abnormal expression of IPP2 as the IPP2DNA sequence.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.Carry out RNA-polymerase chain reaction (RT-PCR) amplification in vitro with the special primer of IPP2 albumen and also can detect the proteic transcription product of IPP2.
The sudden change that detects the IPP2 gene also can be used for the disease of diagnosing IPP2 albumen relevant.The form of IPP2 protein mutation comprises that the point mutation compared with normal wild type IPP2 dna sequence dna, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.
Sequence of the present invention identifies it also is valuable to karyomit(e).In brief, the proteic cDNA of IPP2 prepares PCR primer (preferred 15-35bp) according to the present invention, sequence can be positioned on the karyomit(e).Then, these primers are used for the somatocyte hybrid cell that the PCR screening contains each bar human chromosome.Have only those hybrid cells that contain corresponding to the people's gene of primer can produce the fragment of amplification.
In case sequence is positioned to chromosome position accurately, the physical location of this sequence on karyomit(e) just can be associated with the gene map data.These data for example are found in, V.Mckusick, MendelianInheritance in Man (can by with the online acquisition of Johns Hopkins University Welch MedicalLibrary).Can pass through linkage analysis then, determine gene and navigated to relation between the disease on the chromosomal region already.
In an example of the present invention, a kind of isolating polynucleotide are provided, its coding has the polypeptide of aminoacid sequence shown in the SEQ IDNO:2.Polynucleotide of the present invention are isolated from human bone marrow substrate cell cDNA library.Its sequence is shown in SEQ ID NO:1, and the polynucleotide sequence total length that it comprises is 1637 bases, and its open reading frame is positioned at the 235-582 position, and the coding total length is 116 amino acid whose people IPP2 albumen (SEQ ID NO:2).This IPP2 albumen and 1 type Phosphoric acid esterase supressor homology have 44% consistence.The Northern blot hybridization shows that it has the tissue distribution different with OKL38, predominant expression in tissues such as liver, heart, testis and skeletal muscle.RT-PCR analysis revealed IPP2 is tumour such as Daudi, MOLT-4, Raji, THP-1, K562, HT-29, Hela, A549, NAM, TF-1,2162, Hut and Hela, A549, the expression in various degree of HT29 solid tumor in some hematopoiesis.The research prompting of having carried out, IPP2 has the function of the inhibition Phosphoric acid esterase similar to IPP2, infers that it is a novel Phosphoric acid esterase supressor.Existing result shows that IPP2 is relevant with memory with anti-apoptotic, and therefore, IPP2 albumen or its relevant antagonist, agonist etc. can be diseases such as treating tumour provides new immunodiagnosis and targeted therapy approach, thereby has great application prospect.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1: the clone of people IPP2 cDNA
Extract the total RNA of human bone marrow substrate cell with Trizol reagent (Life Technologies company).Then, from total RNA, separate poly (A) mRNA.Poly (A) mRNA after reverse transcription forms cDNA, is cloned test kit (Life Technologies) with SuperScriptII cDNA fragment orientation is inserted on the multiple clone site of carrier, transform DH5 α bacterium and form the cDNA plasmid library.Measure the sequence of random choose clone's 5 ' end with dideoxy method.CDNA sequence and the existing public dna sequence data storehouse measured are compared, found that a cDNA clone's dna sequence dna is new full-length cDNA.By synthetic a series of primers the contained dna sequence dna of new clone is carried out two-way mensuration.Computer Analysis shows that cloning contained full-length cDNA is a new cDNA sequence (shown in SEQ ID NO:1), the new protein (shown in SEQ ID NO:2) of encoding.This protein is named as 1 type Phosphoric acid esterase supressor IPP2 of human bone marrow substrate cell source, 1 type Phosphoric acid esterase supressor IPP2 gene of its encoding gene called after human bone marrow substrate cell source.
Sequence SEQ ID NO:1 total length is 1637bp, comprises 5 ' the end non-coding region of 234bp and 3 ' the end non-coding region of 1052bp, and coding contains 116 amino acid whose polypeptide.Calculating not in theory, the molecular weight of glycosylated ripe molecule is about 13kD.
They are different with known for the BLAST analysis revealed, and with people's 1 type Phosphoric acid esterase supressor, consistence reaches 64%,, belong to 1 type Phosphoric acid esterase supressor.
Embodiment 2: carry out the cell expressing analysis of people IPP2 with the RT-PCR method
Extract the total RNA that is in various clones such as logarithmic phase Hela with Trizol reagent, get 5 μ g cell total rnas and 1 μ g Oligo-dT 12- 18Mix, carry out reverse transcription.The reverse transcription system is 20 μ l, and reaction adds 80 μ l ddH after finishing 2O dilutes.The used primer of pcr amplification is as follows: adopted primer 5 ' TTGCCGTGCCTGTATTCCA (SEQ ID NO:3) is arranged, antisense primer 5 ' GAATCGGAGGTGGTGTTTGT (SEQ ID NO:4), simultaneously with β-actin as positive control.The PCR reaction volume is 50 μ l, wherein contains reverse transcription template 10 μ l, 0.5mM primer, 0.2mM dNTP and 1U rTaq archaeal dna polymerase (Takara), the amplification parameter be 95 ℃ 15 seconds, 57 ℃ 30 seconds, 72 ℃ 30 seconds, 28 circulations were extended 10 minutes for back 72 ℃.Capable 1.5% agarose gel electrophoresis of PCR product is tentatively confirmed.The dna sequence analysis result shows that the DNA sequences encoding of this PCR product and the 412-882 shown in the SEQ ID NO:1 are identical.
RT-PCR result (Fig. 1) shows, IPP2 is the expression that exists in tumour such as Daudi, MOLT-4, Raji, THP-1, K562, HT-29, Hela, A549, NAM, TF-1,2162, Hut and Hela, A549, the HT29 solid tumor in various degree in some hematopoiesis
Embodiment 3: the Northern engram analysis of people IPP2
Carry out the Northern trace by following ordinary method: filter membrane to be checked places the hybridization solution of 10ml through 68 ℃ of preheatings, in hybrid heater (Bellco) in 68 ℃ of prehybridizations 30 minutes; The cDNA probe that mark is good was in 95~100 ℃ of sex change 2~5 minutes, and (cDNA probe final concentration is 2~10ng/ml or 1~2 * 10 to put rapid cooling back adding hybridization solution on ice 6Cpm/ml), fully mixing was hybridized 2 hours in 68 ℃.After hybridization finishes, filter membrane with 2 * SSC, the drip washing of 0.05%SDS room temperature for several times, the washing lotion several is changed in continuing vibration flushing 30~40 minutes therebetween.Use 0.1 * SSC, 0.1%SDS in 50 ℃ of vibration flushings 20~40 minutes subsequently.Last filter membrane wrapped up with plastic fresh-keeping membrane, in-70 ℃ of exposure X line films 24~48 hours.
Northern blot hybridization result (Fig. 2) shows: expression (2.0kb) is in various degree arranged in healthy tissuess such as liver, testis, skeletal muscle, heart and spleen, and this shows that IPP2 albumen is a kind of albumen of particular expression.
Embodiment 4: people IPP2 protokaryon is recombinant expressed
In this embodiment, PCR Oligonucleolide primers with 5 ' and 3 ' following end of sequence, total mRNA with extractive HeLa cell is that template is passed through RT-PCR, and perhaps the total length plasmid DNA among the embodiment 1 is that template increases, and obtains people IPP2 DNA as inserting fragment.
5 ' the end Oligonucleolide primers sequence of using in the PCR reaction is:
5’-GTGGATCCGAGCCCAACAGTCCCAAAA-3’(SEQ?ID?NO:5)
This primer contains the restriction enzyme site of BamH I restriction enzyme, is the part encoding sequence since second amino acid of people IPP2 after this restriction enzyme site;
3 ' end primer sequence is:
5’-ATGAATTCGTAAGTAATGGTCCCGCTG-3’(SEQ?ID?NO:6)
This primer contains the part encoding sequence of restriction enzyme site, translation termination and the people IPP2 of EcoR I restriction enzyme.
With the PCR product purification that obtains after BamH I/EcoR I enzyme cut and recombinate according to a conventional method with plasmid pGEM-3ZF again and be converted into the competence e. coli bl21, the picking positive colony is identified back purifying and order-checking (377 type sequenators of ABI company, BigDye Terminator test kit, PE company).The people IPP2 cDNA EcoR I endonuclease bamhi of correct sequence is cloned into expression vector pGEX-2T (Pharmacia), forms carrier pGEX-2T-IPP2, then transformed into escherichia coli BL21.Positive colony is cut evaluation with BamH I/EcoR I enzyme, the capable 0.8% agarose gel electrophoresis analysis of product.Confirm through order-checking, inserted designed IPP2 encoding sequence.
Choosing the positive BL21 clone who expresses IPP2 is inoculated in 100ml 2 * YTA substratum, 37 ℃ of 300rpm shaking culture 12-15hr, 2 * YTA the substratum that is diluted in preheating at 1: 10 continues shaking culture 1.5hr, add behind the 100mM IPTG to 0.1mM 30 ℃ and induce 2-6hr, 5,4 ℃ of centrifugal 10min of 000g remove supernatant, put and use 50ml 1 * PBS (0.14M NaCl on ice, 2.7 mM KCl, 10.1mM Na 2HPO 4, 1.8mM KH 2PO 4PH7.3) resuspended, add 20%Triton X-100 to 1% jog 30min again after ultrasonic (B.Braun Labsonic U) fragmentation, then 12,4 ℃ of centrifugal 10min of 000g, supernatant with 0.8 μ m membrane filtration after, cross 1ml50% glutathione S epharose 4B chromatography column, behind 1 * PBS thorough washing, add 500ul gsh elution buffer (10mM gsh, 50mM Tris-HCl, pH8.0) room temperature leaves standstill after 30 minutes and collects elutriant, repeats wash-out 2-3 time, obtains the GST-IPP2 fusion rotein, the about 39Kda of molecular weight conforms to predictor.
Embodiment 5: anti-people IPP2 production of antibodies
The recombinant protein people IPP2 that obtains among the embodiment 4 is used for immune animal to produce antibody, and concrete grammar is as follows.Recombinant molecule is standby after separating with chromatography.Also available SDS-PAGE gel electrophoresis separates, electrophoretic band downcut from gel, and with isopyknic complete Freund ' s adjuvant emulsion.Albumen with 50-100 μ g/0.2ml emulsification carries out peritoneal injection to mouse.After 14 days,, mouse is carried out peritoneal injection with booster immunization with the dosage of 50-100 μ g/0.2ml with the same antigen of non-complete Freund ' s adjuvant emulsion.Carried out booster immunization one time every 14 days, carry out at least three times.The sero-fast specific reaction that obtains is active to be assessed in the ability of external precipitation people IPP2 gene translation product with it.Found that antibody can combine with albumen of the present invention specifically.
Embodiment 6: the structure of people IPP2 recombinant eukaryotic expression plasmid and mutant
1. express wild-type IPP2
In this embodiment, be template with total mRNA of extractive HeLa cell, with the PCR Oligonucleolide primers of 5 ' and 3 ' following end of sequence,, obtain people IPP2 DNA as the insertion fragment by RT-PCR.
5 ' end Oligonucleolide primers sequence is: 5 '-CAGAATTCATGGAGCCCAACAGTCCCA-3 ' (SEQ IDNO:7).This primer contains the restriction enzyme site of EcoRI restriction enzyme, is translation initiation and the part encoding sequence of people IPP2 after this restriction enzyme site;
3 ' end primer sequence is: 5 '-TCAAGCTTGAATGGTCCCGCTGCTCC-3 ' (SEQ ID NO:8).This primer contains the restriction enzyme site of Hind III restriction enzyme and the part encoding sequence of people IPP2.
With the PCR product purification that obtains after EcoR I/Hind III enzyme cut and recombinate according to a conventional method with plasmid pcDNA3.1/Myc-His (-) B again and be converted into the competence bacillus coli DH 5 alpha, the picking positive colony is identified back purifying and order-checking (377 type sequenators of ABI company, BigDye Terminator test kit, PE company), form wild-type carrier for expression of eukaryon pcDNA 3.1-IPP2 carrier (WT).Confirm through order-checking, inserted designed IPP2 encoding sequence.
2. express 40 Threonines and sport the IPP2 of Methionin and the IPP2 that 40 Threonines sport aspartic acid
With pcDNA 3.1-IPP2 carrier (WT) plasmid DNA is template, adopts the PCR Oligonucleolide primers of 5 ' and 3 ' following end of sequence to carry out the PCR point mutation, makes up the expression vector CA that 40 Threonines sport Methionin.
5 ' the end Oligonucleolide primers sequence of using in the PCR reaction is: 5 '-AGAAGACCTGCACCAGCATC-3 ' (SEQ ID NO:9).In this primer the codon ACA of Threonine is become the codon GCA of Methionin;
3 ' end primer sequence is: 5 '-GATGCTGGTGCAGGTCTTCT-3 ' (SEQ ID NO:10).
With pcDNA 3.1-IPP2 carrier (WT) plasmid DNA is template, the structure of 40 Threonine expression vector CD adopts the PCR Oligonucleolide primers of 5 ' and 3 ' following end of sequence to carry out the PCR point mutation, makes up 40 Threonines and sports aspartic acid expression vector CD.
5 ' the end Oligonucleolide primers sequence of using in the PCR reaction is: 5 '-AAGAAGACCTGATCCAGCATCAC-3 ' (SEQ ID NO:11).In this primer the codon ACA of Threonine is become the codon GAT of aspartic acid;
3 ' end primer sequence is: 5 '-GTGATGCTGGATCAGGTCTTCTT-3 ' (SEQ ID NO:12).
The PCR reaction volume is 50 μ l, wherein contain plasmid DNA template 1 μ l, 0.5mM primer, 0.2mM dNTP and 1U Pyrobest archaeal dna polymerase (Takara), the amplification parameter be 95 ℃ 15 seconds, 58 ℃ 30 seconds, 72 ℃ 30 seconds, 20 circulations were extended 10 minutes for back 72 ℃.Capable 0.8% agarose gel electrophoresis of PCR product is tentatively confirmed.With the PCR product purification acid treatment that obtains after the T4 polynucleotide kinase phosphorates, self flush end connects and is converted into the competence bacillus coli DH 5 alpha, the picking positive colony is identified back purifying and order-checking (377 type sequenators of ABI company, BigDye Terminator test kit, PE company).The clone of correct sequence is formed support C A or CD.Confirm through order-checking to undergo mutation in designed mutational site.
Embodiment 7: people IPP2 suppresses NO and induces the active detection of RAW 264.7 apoptosis
With the IPP2 expression vector WT among the embodiment 6 and CD plasmid DNA and pNGFP plasmid with LipofectAMINE reagent (Life Technologies company) cotransfection RAW 264.7 cells, with the pcDNA3.1 plasmid vector as irrelevant contrast.The two dyeing of PI/GFP are carried out in 48 hours adding NO generation agent 1mM SNP effect 24 after the transfection, detect with flow cytometer.
Detected result (Fig. 3) shows that wild-type (WT) and activated form (CD) IPP2 can suppress the ERK activation of LPS inductive RAW 264.7.
Embodiment 8:IPP2 suppresses LPS ERK, MEK1/2 activatory Western is detected
With IPP2 expression vector WT, CA among the embodiment 6 and CD plasmid DNA with LipofectAMINE reagent transfection RAW 264.7 cells, with the pcDNA3.1 plasmid vector as irrelevant contrast.The LPS that added 1ug/L after the transfection in 48 hours stimulated collecting cell (5 * 10 10 minutes 6Cell/sample), wash one time with PBS after, extract reagent (PIERCE) with the T-PER tissue protein and extract whole protein and be used for other detection, concrete operations are undertaken by the test kit explanation.Measure protein concentration with the BCA method afterwards, be adjusted to unanimity after, the per 20 μ l of sample and 6 times of sample-loading buffer (100mmol/L Tris-HCL of 4 μ l, 200mmol/L DTT, 4%SDS, 0.2% tetrabromophenol sulfonphthalein, 20% glycerine, PH6.8) mixing, after 100 ℃ of water-baths were boiled 5 minutes, row 12%SDS-PAGE electrophoresis moved on to the protein transduction in the polyacrylamide on the nitrocellulose filter in 4 ℃ with the 100V constant voltage subsequently, ponceau dyeing and label orientation mark the Marker position.4 hours (the TBST solution of 10% skim-milk) of room temperature blocking-up, be diluted in the skim-milk solution by 1: 1000 rabbit source ERK, MEK1/2 be how anti-, after 2 hours, wash 3 times each 10 minutes in room temperature reaction with TBST (the TBS solution of 0.05%Tween20) with cellulose nitrate film.In addition corresponding two of horseradish peroxidase-labeled anti-(dilutions in 1: 2000) then, incubated at room 60 minutes, TBST gives a baby a bath on the third day after its birth time, each 10 minutes, A liquid in the Western trace luciferase assay reagent and B liquid is mixed with equal-volume, and incubated at room dried after 1 minute, press mold, exposure is developed.
Result (Fig. 4) shows that wild-type (WT) and activated form (CD) IPP2 suppress the activation of LPS to ERK, MEK1/2, and negative control and inactivation type (CA) can not suppress the activation of LPS to ERK, MEK1/2.
Embodiment 9:IPP2 keeps the phosphorylation of NIH 3T3 and PC-12 cell CREB
With IPP2 expression vector WT, CA among the embodiment 6 and CD plasmid DNA with LipofectAMINE reagent transfection NIH 3T3 and PC-12 cell, with the pcDNA3.1 plasmid vector as irrelevant contrast.After the transfection 48 hours, serum starvation 36 hours, the IBMX/8 Br-cAMP that adds 0.5mM stimulates, and 0 hour, 1 hour, 5 hours collecting cells detect step with executing example 8.
Result (Fig. 5) shows that IBMX/8 Br-cAMP stimulated after 1 hour, and the CREB phosphorylation rises.After 5 hours, the CREB phosphorylation of negative control group and inactivation group (CA) drops to basal level, and positive control (IPP1) and wild-type IPP2, activated form (CD) can be kept the CREB phosphorylation level.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table<110〉Inst. of Immunology, Zhejiang Univ.<120〉1 type Phosphoric acid esterase supressor of new type human bone marrow substrate cell source, its encoding sequence and purposes<130〉024956<160〉12<170〉PatentIn version 3.1<210〉1<211〉1637<212〉DNA<213〉homo sapiens (Homo sapiens)<220〉<221〉CDS<222〉(235) .. (582)<223〉<220<221〉misc_feature<222〉(1432) .. (1432)<223〉n=a, t, c, g<400〉1agaggatcca agggattggt gggggaacag gcaagccagg catcaccgtg gatgttgaag 60aagggggtta ctcaaacctc ggcatcttca cttgctcgat ctggaattac agctatttat 120tacgaagcac tctgtgtggc ttagtggagt gtgtctgagg aaacacatcc cggacaccac 180ttagggttag tctttctgag ctcttcacat ctctgactaa ttatcatcat tacc atg 237
Met
1gag?ccc?aac?agt?ccc?aaa?aag?ata?cag?ttt?gcc?gtg?cct?gta?ttc?cag??????285Glu?Pro?Asn?Ser?Pro?Lys?Lys?Ile?Gln?Phe?Ala?Val?Pro?Val?Phe?Gln
5???????????????????10??????????????????15agt?cag?att?gca?cct?gaa?gca?gca?gag?cag?ctg?ggc?ttt?tgt?cgt?tca??????333Ser?Gln?Ile?Ala?Pro?Glu?Ala?Ala?Glu?Gln?Leu?Gly?Phe?Cys?Arg?Ser
20??????????????????25??????????????????30cag?atc?agg?aaa?aga?aga?cct?aca?cca?gca?tca?ctt?gtg?att?ctc?aat??????381Gln?Ile?Arg?Lys?Arg?Arg?Pro?Thr?Pro?Ala?Ser?Leu?Val?Ile?Leu?Asn
35??????????????????40??????????????????45gag?cat?aac?ccc?cca?gaa?ata?gat?gac?aag?agg?ggg?ccc?aac?aca?caa??????429Glu?His?Asn?Pro?Pro?Glu?Ile?Asp?Asp?Lys?Arg?Gly?Pro?Asn?Thr?Gln50??????????????????55??????????????????60??????????????????65ggg?gaa?tta?cag?aat?gca?tcc?cct?aag?caa?agg?aag?cag?agt?gtg?tac??????477Gly?Glu?Leu?Gln?Asn?Ala?Ser?Pro?Lys?Gln?Arg?Lys?Gln?Ser?Val?Tyr
70??????????????????75??????????????????80aca?cca?ccc?acc?ata?aaa?ggg?gtt?aag?cat?ctg?aaa?ggc?cag?aat?gaa??????525Thr?Pro?Pro?Thr?Ile?Lys?Gly?Val?Lys?His?Leu?Lys?Gly?Gln?Asn?Glu
85??????????????????90??????????????????95tca?gca?ttc?cct?gaa?gaa?gaa?gaa?ggc?acc?aat?gaa?aga?gag?gag?cag??????573Ser?Ala?Phe?Pro?Glu?Glu?Glu?Glu?Gly?Thr?Asn?Glu?Arg?Glu?Glu?Gln
100?????????????????105?????????????????110cgg?gac?cat?taattactgg?tgcaaaatga?gttgataaca?accagaagtt??????????????622Arg?Asp?His
115gacttgttag tgctgtgctt ctactcgagc ttggaaaaat cccaacacaa aacaaacacc 682acctccgatt ccatcatgat gccacgttgc tttctactgg attacctcct gaagcacttt 742agatatttta tacataagta ttgacatgtt tttcagaagc tgtttcttca cttattgctt 802ttttctaata atttttatta caccatttgc caagtccttc cctttggttt tagtttattc 862ctctctacaa ctaaaaaagg gatcttgagt ttaggtacat tttaagtgat tcatttttag 922tttttctaat tctggaatct gagccttctc ttacaacagg gagtctttca aaaacatttt 982tttgtttctt tttcaaattc cactgtgttt atttattgcc ttgtttcttt ttcaaattcc 1042attggtcttg atttaattta gttccacaga ttttactgat agtctactac ctgccaacta 1102ctgaattatg cagcagactt ataaaaataa aaaggctatt ttattgttat tgccatcctg 1162ctagtaaaga tttattcaat tatttataat taattaagtg gcttcaccta tatttctgtt 1222aataatcaca ttaattatgt atgacaggta ggatttatgt tatagataag aaaactagag 1282tccaaagaaa ataagtgtcc ccaaatgaac caataatcca acaaacgctt ccactaacta 1342gcttctgacc tgtttgagtt gtgatagatt ttagaataaa aaagcctatc ctccttagga 1402gccatagact tttattcttt cttatactgn cttatatatt gacttagagc taaacttcct 1462ccaattcaga cataaagcat aggcagatac ttttgctaat gaggctaagc tgggaagaaa 1522accctgagtt ctactttaat tcttgggcat tgacttcaaa ctaagatgac ttataagaaa 1582taaaagaagt aaatttgaaa ctttaataaa aaaagtacat ggttcattta aaaaa 1637<210〉2<211〉116<212〉PRT<213〉 ( Homo sapiens )<400〉2Met Glu Pro Asn Ser Pro Lys Lys Ile Gln Phe Ala Val Pro Val Phe1 5 10 15Gln Ser Gln Ile Ala Pro Glu Ala Ala Glu Gln Leu Gly Phe Cys Arg
20??????????????????25??????????????????30Ser?Gln?Ile?Arg?Lys?Arg?Arg?Pro?Thr?Pro?Ala?Ser?Leu?Val?Ile?Leu
35??????????????????40??????????????????45Asn?Glu?His?Asn?Pro?Pro?Glu?Ile?Asp?Asp?Lys?Arg?Gly?Pro?Asn?Thr
50??????????????????55??????????????????60Gln?Gly?Glu?Leu?Gln?Asn?Ala?Ser?Pro?Lys?Gln?Arg?Lys?Gln?Ser?Val65??????????????????70??????????????????75??????????????????80Tyr?Thr?Pro?Pro?Thr?Ile?Lys?Gly?Val?Lys?His?Leu?Lys?Gly?Gln?Asn
85??????????????????90??????????????????95Glu?Ser?Ala?Phe?Pro?Glu?Glu?Glu?Glu?Gly?Thr?Asn?Glu?Arg?Glu?Glu
100?????????????????105?????????????????110Gln?Arg?Asp?His
115<210〉3<211〉19<212〉DNA<213〉<400〉3ttgccgtgcc tgtattcca 19<210〉4<211〉20<212〉DNA<213〉<400〉4gaatcggagg tggtgtttgt 20<210〉5<211〉27<212〉DNA<213〉<400〉5gtggatccga gcccaacagt cccaaaa 27<210〉6<211〉27<212〉DNA<213〉<400〉6atgaattcgt aagtaatggt cccgctg 27<210〉7<211〉27<212〉DNA<213〉<400〉7cagaattcat ggagcccaac agtccca 27<210〉8<211〉26<212〉DNA<213〉<400〉8tcaagcttga atggtcccgc tgctcc 26<210〉9<211〉20<212〉DNA<213〉<400〉9agaagacctg caccagcatc 20<210〉10<211〉20<212〉DNA<213〉<400〉10gatgctggtg caggtcttct 20<210〉11<211〉23<212〉DNA<213〉<400〉11aagaagacct gatccagcat cac 23<210〉12<211〉23<212〉DNA<213〉<400〉12gtgatgctgg atcaggtctt ctt 23

Claims (10)

1. isolating people's Phosphoric acid esterase supressor IPP2 polypeptide is characterized in that it comprises: polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative with SEQ ID NO:2 aminoacid sequence.
2. polypeptide as claimed in claim 1 is characterized in that, this polypeptide is selected from down group:
(a) has the polypeptide of SEQ ID NO:2 aminoacid sequence;
(b) SEQ ID NO:2 aminoacid sequence is formed through replacement, disappearance or the interpolation of one or more amino-acid residues, and have suppress scavenger cell RAW 264.7 apoptosis functions by (a) polypeptides derived.
3. isolating polynucleotide is characterized in that, it comprises a nucleotide sequence, and this nucleotide sequence has at least 70% homogeny with a kind of nucleotide sequence territory that is selected from down group:
(a) coding is as the polynucleotide of polypeptide as described in claim 1 and 2;
(b) with polynucleotide (a) complementary polynucleotide.
4. polynucleotide as claimed in claim 3 is characterized in that this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ IDNO:2.
5. polynucleotide as claimed in claim 3 is characterized in that, the sequence of these polynucleotide is selected from down a kind of of group:
(a) has the sequence of 235-582 position among the SEQ ID NO:1;
(b) has the sequence of 1-1637 position among the SEQ ID NO:1.
6. a carrier is characterized in that, it contains the described polynucleotide of claim 3.
7. a genetically engineered host cell is characterized in that, contains the described carrier of claim 6.
8. preparation method with polypeptide of people's Phosphoric acid esterase supressor IPP2 polypeptide active is characterized in that this method comprises:
(a) under the condition that is fit to expressing human Phosphoric acid esterase supressor IPP2 polypeptide, cultivate the described host cell of claim 7;
(b) from culture, isolate polypeptide with people's Phosphoric acid esterase supressor IPP2 polypeptide active.
9. energy and the described people's Phosphoric acid esterase of claim 1 supressor IPP2 polypeptid specificity bonded antibody.
10. a pharmaceutical composition is characterized in that, it contains the described polypeptide of claim 1 and the pharmaceutically acceptable carrier of safe and effective amount.
CN 02136524 2002-08-16 2002-08-16 New type human bone marrow substrate cell source 1 type phosphoric acid enzyme inhibition factor, its coded sequence and use Expired - Fee Related CN1290861C (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN 02136524 CN1290861C (en) 2002-08-16 2002-08-16 New type human bone marrow substrate cell source 1 type phosphoric acid enzyme inhibition factor, its coded sequence and use

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 02136524 CN1290861C (en) 2002-08-16 2002-08-16 New type human bone marrow substrate cell source 1 type phosphoric acid enzyme inhibition factor, its coded sequence and use

Publications (2)

Publication Number Publication Date
CN1475501A true CN1475501A (en) 2004-02-18
CN1290861C CN1290861C (en) 2006-12-20

Family

ID=34146517

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 02136524 Expired - Fee Related CN1290861C (en) 2002-08-16 2002-08-16 New type human bone marrow substrate cell source 1 type phosphoric acid enzyme inhibition factor, its coded sequence and use

Country Status (1)

Country Link
CN (1) CN1290861C (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009030093A1 (en) * 2007-09-05 2009-03-12 Zhejiang University Functions and uses of human protein phosphatase 1 inhibitor-2

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009030093A1 (en) * 2007-09-05 2009-03-12 Zhejiang University Functions and uses of human protein phosphatase 1 inhibitor-2

Also Published As

Publication number Publication date
CN1290861C (en) 2006-12-20

Similar Documents

Publication Publication Date Title
CN1308346C (en) Novel human phosphotidylethanolamine binding protein, its coding sequence and application
CN1371916A (en) Human siali acid conjugated immunoglobulin-like agglutinant, its coding sequence and use
CN1475502A (en) New withered induced protein, its coded sequence and use
CN1475501A (en) New type human bone marrow substrate cell source 1 type phosphoric acid enzyme inhibition factor, its coded sequence and use
CN1343725A (en) Human angiogenin-like protein and coding sequence and application thereof
CN1223607C (en) Human calcium ion/calmodulin dependent protein kinase II inhibitory protein and its application
CN1477118A (en) Novel DnaJ/Hsp40 molecule DC-DJIII, its coding sequence and application
CN1299827A (en) New human CD20 homolgous molecule and its code sequence and use
CN1477115A (en) Novel human cyclin, its coding sequence and application
CN1475500A (en) New type human marrow differentiation tagged object its coded sequence and use
CN1477119A (en) Novel Human cysteine proteinase inhibitor sample molecule, its coding sequence and application
CN100425695C (en) Novel human Rab GTP enzyme, its coding sequence and application
CN1325874A (en) Human C-type lectin-like receptor and its coding sequence and application
CN100408597C (en) Human calcium ion / calmodulin deopendent protein kinase II inhibitory protein alpha, its coded sequence and use
CN1477114A (en) Immunoglobulin sample receptor originated from human dendritic cell, its coding sequence and application
CN1385441A (en) Novel human lymphokine, its coding sequence and use
CN1475568A (en) New type human death resist protein, its coded sequence and use
CN1475499A (en) New type human cell signal related protein, its code sequence and use
CN1475503A (en) New type human bone marrow substrate cell source growth inhibiting factor, its coded sequence and use
CN1477116A (en) Novel human secretion-related membrane protion, its coding sequence and its application
CN100443501C (en) Mitochondria traffic protein molecule for human marrow stromal cell and sequence encoding same and use thereof
CN1299832A (en) New human cell cycle regulating protein and its code sequence and use
CN1171901C (en) New interferon-like protein and its code sequence and use
CN1299828A (en) New cell factor acceptor and its code sequence and use
CN1299829A (en) New human cell cycle regulating protein and its code sequence and use

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20061220

Termination date: 20160816

CF01 Termination of patent right due to non-payment of annual fee