WO2009030093A1

WO2009030093A1 - Functions and uses of human protein phosphatase 1 inhibitor-2

Info

Publication number: WO2009030093A1
Application number: PCT/CN2007/070638
Authority: WO
Inventors: Xiaojian Wang; Nan Li; Xuetao Cao
Original assignee: Zhejiang University
Priority date: 2007-09-05
Filing date: 2007-09-05
Publication date: 2009-03-12

Abstract

The present invention provides uses of human protein phosphatase 1 inhibitor-2 (IPP2) for manufacturing the compositions which inhibit secretion of inflammatory factors including IL-6 and TNFα. It also discloses a method for screening the substances which inhibit secretion of inflammatory factors, by using IPP2 as a target for drug screening.

Description

Function and use of novel human type 1 phosphatase inhibitory protein IPP2

The present invention is in the field of biotechnology and medicine, and in particular, the present invention relates to a novel use of a human phosphatase inhibitor IPP2 polypeptide. Background technique

Phosphorylation is the most important and fastest way to regulate metabolism and signaling pathways. This approach is achieved through the perfect coordination of kinases and phosphatases. Type 1 protein phosphatase (PP-1) is a very important class of serine/threonine phosphatases that regulate the cell cycle by dephosphorylation of proteins. Physiological functions such as gene expression, protein synthesis, glycolipid metabolism, and memory formation. It consists of a catalytic subunit and a regulatory subunit that determines the substrate specificity, activity, and subcellular localization of the phosphatase.

Inhibitor of protein phosphatase 1 (IPP-1) is the first endogenous molecule to be found to regulate type 1 protein phosphatase activity. IPP-1 is able to inhibit PP1 against pCREB (cAMP response element binding protein; Dephosphorylation maintains high levels of pCREB, and activation of CREB, phosphorylation, is essential for many cells, especially neuronal survival and long-term memory formation.

Phosphorylation-related factors have important physiological functions. Therefore, there is an urgent need in the art to develop new phosphorylation-related factors and to study the functions of these factors in order to provide effective targets for drug development. Purpose of the invention

The object of the present invention is to provide a novel human bone marrow stromal cell-derived type 1 phosphatase inhibitor

IPP2 protein as well as fragments, analogs and derivatives thereof.

Another object of the invention is to provide polynucleotides encoding these polypeptides.

Another object of the invention is to provide methods and uses for the production of these polypeptides.

In a first aspect of the invention, there is provided a use of a human phosphatase inhibitor IPP2 or a gene encoding the same or an agonist thereof for the preparation of a composition for inhibiting the production of inflammatory cytokines.

In another preferred embodiment, the inflammatory cytokine is selected from the group consisting of: interleukin-6 (IL-6), or tumor necrosis factor a (TNF) ₀

In another preferred embodiment, the inflammatory cytokine is induced by lipopolysaccharide endotoxin (LPS). In another preferred embodiment, the composition is also useful for inhibiting apoptosis. In another preferred embodiment, the apoptosis is induced by NO.

In another preferred embodiment, the human phosphatase inhibitor IPP2 is selected from the group consisting of:

(1) a protein of the amino acid sequence of SEQ ID NO: 2; or

(2) A protein derived from (1) which is formed by substitution, deletion or addition of the amino acid sequence of SEQ ID NO: 2 by one or more amino acid residues, and which has an IL-6-producing function.

In another preferred embodiment, the composition is a pharmaceutical composition.

In a second aspect of the invention, there is provided a use of the human phosphatase inhibitor IPP2 for screening for a substance which inhibits the production of inflammatory cytokines.

In a third aspect of the invention, a method of screening for a potential substance that inhibits an inflammatory cytokine, the method comprising:

(a) contacting the candidate substance with a system containing the human phosphatase inhibitor IPP2;

(b) observing the effect of the candidate substance on the expression or activity of the human phosphatase inhibitor IPP2; wherein, if the candidate substance promotes the expression or activity of the human phosphatase inhibitor IPP2, it indicates that the candidate substance is an inhibitory inflammatory cell The potential substance of the factor.

In another preferred embodiment, step (a) comprises: adding a candidate substance to the system containing the human phosphatase inhibitor IPP2 in the test group; and/or

Step (b) comprises: detecting the expression or activity of the human phosphatase inhibitor IPP2 in the system of the test group, and comparing the control group with the human phosphatase inhibitor IPP2 without adding the candidate substance System

If the expression or activity of the human phosphatase inhibitor IPP2 in the test group is statistically higher (preferably significantly higher than, for example, 20% higher; more preferably 40% higher; further preferably 60% higher or higher), the control group This candidate is indicated to be a potential substance that inhibits inflammatory cytokines.

In another preferred embodiment, the method further includes the steps of:

Further cellular and/or animal tests are performed on the potential substances obtained to select substances useful for inhibiting inflammatory cytokines.

In another preferred embodiment, the system is a cellular system.

In another aspect, the invention provides a method of inhibiting inflammatory cytokines in vitro (therapeutic or non-therapeutic) or in vivo, the method comprising: increasing expression or activity of a human phosphatase inhibitor IPP2 in a cell.

Other aspects of the invention will be apparent to those skilled in the art from this disclosure. DRAWINGS

The following drawings are used to illustrate the specific embodiments of the invention and are not intended to limit the scope of the invention as defined by the appended claims.

Figure 1 shows the human IPP2 RT-PCR expression analysis of the present invention, suggesting that IPP2 is expressed in certain tumor cells; wherein, Figure 1A and Figure 1B are expressions in subcultured tumor cell lines; Figure 1C is in normal humans. Expression in different parts of the fetal brain.

Figure 2 shows the distribution shown by human IPP2 Northern blot hybridization of the present invention. The results suggest that IPP2 is a molecule with a specific tissue distribution; Figure 2A shows the distribution in normal adult tissues; Figure 2B shows the distribution in normal fetal tissues.

Figure 3 shows the inhibitory effect of human IPP2 on NO-induced apoptosis in RAW 264.7 cells.

Figure 4 shows that human IPP2 inhibits LPS-stimulated RAW264.7 cells producing cytokines TNF (Α) and IL-6 (B). detailed description

After long-term research, the present inventors have found for the first time that the human phosphatase inhibitor IPP2 (pr ₀ tein phosphatase 1 inhibitor-2) has the function of inhibiting inflammatory factors such as interleukin-6 or tumor necrosis factor alpha. Significant inhibition of the production of intracellular inflammatory factors. Therefore, the human phosphatase inhibitor ΙΡΡ2 itself can be used for the preparation of a composition for inhibiting inflammatory factors, or the human phosphatase inhibitor ΙΡΡ2 can be used as a target for drug screening for screening for substances which inhibit inflammatory factors by promoting their activity. . The present invention has been completed on this basis.

Specifically, the inventors' studies have shown that the human phosphatase inhibitor ΙΡΡ2 is expressed in some hematopoietic tumors such as Daudi, MOLT-4, Raji, THP-K K562, HT-29, Hela, A549, NAM, TF. There were different degrees of expression in -1, 2162, Hut, and Hela, A549, and HT29 solid tumors. Northern blotting revealed that IPP2 mRNA is specifically expressed in the heart, liver, skeletal muscle, and testis of normal humans, with three transcripts in the myocardium and skeletal muscle. The molecule was confirmed to inhibit PP-1 enzyme activity by in vitro kinase assay, and the IC50 was similar to the human IPP-1 protein. It was also found that IPP2 inhibits LPS-induced ERK1/2 activation and inhibits NO-induced RAW 264.7 apoptosis. Transiently transfected NIH 3T3 and PC-12 cells with IPP2 maintained a high level of CREB phosphorylation by 8-Br-cAMP/IBMX. Phosphorylation of CREB can increase the expression of the anti-apoptotic protein Bcl-2. Meanwhile, the present inventors screened a cell line stably expressing RAW264.7 of IPP2 and the mutant and confirmed that RAW264.7 cells overexpressing IPP2, shI-2, and shl-1 were able to resist NO-induced apoptosis. Further research on the mechanism of apoptosis shows that IPP2 can It inhibits NO-induced caspase-3 activation, decreased Bcl-2 and Bcl-xl protein levels. Interestingly, IPP2 is significantly more effective than shI-2, shl-l. However, for LPS/IFN Y-induced apoptosis, IPP2 inhibition was not obvious. Similarly, IPP2 could not inhibit LPS/IFNγ-induced caspase-3 activation, Bcl-2 and Bcl-xl protein levels. The inactivating mutant (; CA) does not have the above functions, suggesting that the above functions of IPP2 are related to its inhibition of PP 1 enzyme activity. These results suggest that IPP2 up-regulates some survivin expression by inhibiting PP1 and maintaining activation of some signaling proteins and transcription factors. In turn, it resists apoptosis caused by external factors.

In conclusion, IPP2 acts as a novel phosphatase inhibitor, by inhibiting phosphatase, maintaining the phosphorylation of certain important signaling pathway mediators or transcription factors, transmitting and amplifying certain signals, in anti-apoptosis, anti-infection, etc. The aspect plays an important role, so the molecule has important development and application value.

For example, based on the novel findings of the present inventors, IPP2 can be used to prepare a composition that inhibits the production of inflammatory cytokines or to screen for substances that inhibit inflammatory cytokines. Usually, cells are infected with inflammatory cytokines such as IL-6 or TNF ci after infection (such as endotoxin-induced infection), thereby inhibiting the production or activity of inflammatory cytokines to inhibit the occurrence or development of inflammation. .

In addition, IPP2 can also be used to inhibit apoptosis, for example, when IPP2 is contacted with NO-induced cells, the proportion of apoptosis of the cells can be greatly reduced. Human phosphatase inhibitor IPP2

In the present invention, the terms "IPP2 protein", "IPP2 polypeptide" or "bone marrow stromal cell-derived type 1 phosphatase inhibitor IPP2" are used interchangeably and refer to type 1 phosphatase inhibitors derived from human bone marrow stromal cells. A protein or polypeptide of the IPP2 amino acid sequence (SEQ ID NO: 2).

As used herein, "isolated" means that the substance is separated from its original environment (if it is a natural substance, the original environment is the natural environment). For example, the polynucleotides and polypeptides in the natural state in living cells are not isolated and purified, but the same polynucleotide or polypeptide is separated and purified, such as from other substances existing in the natural state. .

As used herein, "isolated IPP2 protein or polypeptide" means that the IPP2 polypeptide is substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated. Those skilled in the art will be able to purify the IPP2 protein using standard protein purification techniques. A substantially pure polypeptide produces a single major band on a non-reducing polyacrylamide gel.

The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, preferably a recombinant polypeptide. The polypeptide of the present invention may be a naturally purified product, or a chemically synthesized product, or may be regenerated from the pronuclear using a recombinant technique. Or produced in eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). The polypeptide of the invention may be glycosylated, or may be non-glycosylated, depending on the host used in the recombinant production protocol. Polypeptides of the invention may also or may not include an initial methionine residue.

The invention also includes fragments, derivatives and analogs of the human IPP2 protein. As used herein, the terms "fragment," "derivative," and "analog" refer to a polypeptide that substantially retains the same biological function or activity of the native human IPP2 protein of the present invention. The polypeptide fragment, derivative or analog of the present invention may be (i) a polypeptide having one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) substituted, and such substituted amino acid residues It may or may not be encoded by the genetic code, or (ii) a polypeptide having a substituent group in one or more amino acid residues, or (iii) a mature polypeptide and another compound (such as a compound that extends the half-life of the polypeptide, for example a polypeptide formed by fusion of a polyethylene glycol) or (iv) an additional amino acid sequence fused to the polypeptide sequence (eg, a leader or secretion sequence or a sequence or proprotein sequence used to purify the polypeptide, or A fusion protein for the formation of an antigenic IgG fragment). These fragments, derivatives and analogs are within the purview of those skilled in the art in light of the teachings herein.

In the present invention, the term "human IPP2 polypeptide" refers to a polypeptide having the sequence of SEQ ID NO. 2 of human IPP2 protein activity. The term also encompasses variant forms of the sequence of SEQ ID NO. 2 that have the same function as the human IPP2 protein. These variants include, but are not limited to, a number (usually 1-50, preferably 1-30, more preferably 1-20, optimally 1-10) amino acid deletions, insertions And/or substitution, and addition of one or several (usually within 20, preferably within 10, more preferably within 5) amino acids at the C-terminus and/or N-terminus. For example, in the art, when substituted with amino acids of similar or similar properties, the function of the protein is usually not altered. As another example, the addition of one or more amino acids at the C-terminus and/or N-terminus will generally not alter the function of the protein. The term also encompasses active fragments and active derivatives of the human IPP2 protein.

Variants of the polypeptide include: homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, proteins encoded by DNA that hybridize to human IPP2 DNA under high or low stringency conditions And a polypeptide or protein obtained by using an antiserum against the human IPP2 polypeptide. The invention also provides other polypeptides, such as fusion proteins comprising a human IPP2 polypeptide or a fragment thereof. In addition to the nearly full length polypeptide, the present invention also encompasses soluble fragments of the human IPP2 polypeptide. Typically, the fragment has at least about 10 contiguous amino acids of the human IPP2 polypeptide sequence, typically at least about 30 contiguous amino acids, preferably at least about 50 contiguous amino acids, more preferably at least about 80 contiguous amino acids, optimally at least about 100 consecutive amino acids.

The invention also provides analogs of human IPP2 proteins or polypeptides. The difference between these analogs and the natural human IPP2 polypeptide may be a difference in amino acid sequence, or may be a difference in the modification form that does not affect the sequence, or Both have both.

In the present invention, the "human IPP2 protein conservative variant polypeptide" means up to 10, preferably up to 8, more preferably up to 5, most preferably up to the amino acid sequence of SEQ ID NO: 2. The three amino acids are replaced by amino acids of similar or similar nature to form a polypeptide.

IPP2 coding sequence

The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA or synthetic DNA. DNA can be single-stranded or double-stranded. The DNA can be a coding strand or a non-coding strand. The coding region sequence encoding the mature polypeptide may be the same as or the degenerate variant of the coding region shown in SEQ ID NO: 1. As used herein, a "degenerate variant" in the present invention refers to a nucleic acid sequence which encodes a protein having SEQ ID NO: 2 but differs from the coding region sequence set forth in SEQ ID NO: 1.

Polynucleotides encoding the mature polypeptide of SEQ ID NO: 2 include: a coding sequence encoding only the mature polypeptide; a coding sequence for the mature polypeptide and various additional coding sequences; a coding sequence for the mature polypeptide (and optionally additional coding sequences) and Non-coding sequence.

The term "polynucleotide encoding a polypeptide" may be a polynucleotide comprising the polypeptide, or may be a polynucleotide further comprising additional coding and/or non-coding sequences.

The present invention also relates to variants of the above polynucleotides which encode fragments, analogs and derivatives of polypeptides or polypeptides having the same amino acid sequence as the present invention. Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As is known in the art, an allelic variant is an alternative form of a polynucleotide which may be a substitution, deletion or insertion of one or more nucleotides, but does not substantially alter the function of the polypeptide encoded thereby. .

The invention also relates to polynucleotides which hybridize to the sequences described above and which have at least 50%, preferably at least 70%, more preferably at least 80% identity between the two sequences. The invention particularly relates to polynucleotides that hybridize to the polynucleotides of the invention under stringent conditions. In the present invention, "stringent conditions" means: (1) hybridization and elution at a lower ionic strength and a higher temperature, such as 0.2 X SSC, 0.1% SDS, 60 ° C _; or 2) Hybridization is carried out with a denaturing agent such as 50% (v/v) formamide, 0.1% calf serum/0.1% Ficol l, 42 °C, etc.; or (3) only in two sequences Hybridization occurs when the identity is at least 90% or more, more preferably 95% or more. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide represented by SEQ ID NO: 2. Antagonists or agonists of IPP2 and uses thereof

The invention also relates to antagonists and agonists of IPP2.

As used herein, an antagonist of IPP2 refers to a substance that is capable of combating, or reducing, the activity or expression of an IPP2 polypeptide. Common antagonists are antibodies, antisense nucleotides, and interfering RNA (RNAi). The antagonist can be used to alleviate the inhibitory effect of IPP2 on the production of inflammatory cytokines (e.g., IL-6 or TNF-o).

As used herein, an agonist of IPP2 refers to any substance that increases the activity of IPP2, maintains the stability of IPP2, promotes IPP2 expression, prolongs the effective duration of IPP2, or promotes transcription and translation of IPP2. These substances can be used to potentiate the inhibitory effects of IPP2 on the production of inflammatory cytokines (such as IL-6 or TNF-o. Screening for substances that inhibit inflammatory cytokines)

After learning about the effect of IPP2 on inflammatory cytokines, a variety of methods well known in the art can be used to screen for potential substances that inhibit inflammatory cytokines. Substances that are truly useful for inhibiting inflammatory cytokines can ultimately be found from the potential substances described.

Accordingly, the present invention provides a method of screening for potential substances that inhibit inflammatory cytokines, comprising the steps of:

The candidate substance is contacted with a system containing IPP2; the effect of the candidate substance on the expression or activity of IPP2 is observed; wherein, if the candidate substance can increase the expression or activity of IPP2, it indicates that the candidate substance is a potential for inhibiting inflammatory cytokine substance.

In the present invention, the system is selected from, but not limited to, a solution system, a cell system, a subcellular system, a tissue system, an organ system, or an animal system.

In a preferred mode of the present invention, in order to make it easier to observe changes in IPP2, a control group may be provided, and the control group may be an IPP2-containing system to which the candidate substance is not added. These initially screened materials can form a screening library for further cellular and/or animal testing of these materials so that they can ultimately be screened for drugs that are truly useful for inhibiting inflammatory cytokines.

Therefore, the present invention also includes a class of substances which inhibit inflammatory cytokines obtained by the screening method of the present invention, which act on IPP2, improve the activity of IPP2, maintain the stability of IPP2, promote the expression of IPP2, and prolong the effective effect of IPP2. Time, or promote the transcription and translation of IPP2 to play a role in inhibiting inflammatory cytokines. Compositions and methods of treatment

The present invention also provides a composition comprising an effective amount (such as 0.00001-0.01 g / 60 kg body weight / day; preferably, 0.0001 - 0.005 g / 60 kg body weight / day) of the IPP2 protein, Or an agonist of IPP2, and a pharmaceutically or food acceptable carrier.

As used herein, a "pharmaceutically or foodly acceptable" ingredient is suitable for use in humans and/or mammals without excessive adverse side effects (eg, toxicity, irritation, and allergies), ie, has reasonable benefits/ The substance of the risk ratio. The term "pharmaceutically acceptable carrier" refers to a carrier for the administration of a therapeutic agent, including various excipients and diluents. The term refers to pharmaceutical carriers which are not themselves essential active ingredients and which are not excessively toxic after administration. Suitable carriers are well known to those of ordinary skill in the art. In

A full description of pharmaceutically acceptable carriers can be found in Remington's Pharmaceutical Sc. (Mack Pub. Co., N. J. 1991). The pharmaceutically acceptable carrier in the composition may contain a liquid such as water, saline, glycerin and ethanol. In addition, auxiliary substances such as lubricants, glidants, wetting or emulsifying agents, pH buffering substances and the like may also be present in these carriers.

The invention also provides a method of inhibiting an inflammatory cytokine comprising administering to the subject an effective amount of an IPP2 protein, or an agonist of IPP2.

It will be appreciated that when used to inhibit inflammatory cytokines, the effective dose of IPP2 or its agonist used may vary with the severity of the subject to be treated. The specific circumstances are determined by the individual circumstances of the subject, and these factors are within the range judged by the skilled physician or dietitian.

After knowing the use of the IPP2 or an agonist thereof, the IPP2 or an agonist thereof, or a gene encoding the same, or a pharmaceutical composition thereof, can be administered by various methods well known in the art. mammal. Preferably, it can be carried out by means of gene therapy. For example, IPP2 or an agonist thereof can be directly administered to a subject by a method such as injection; or, an expression unit carrying an IPP2 or an agonist thereof (such as an expression vector or a virus, etc.) can be delivered to a target by a certain route. Point and expression of active IPP2 or an agonist thereof will depend, inter alia, on the type of agonist described, which are well known to those skilled in the art.

Preferably, a gene encoding IPP2 or an agonist thereof, or a vector carrying the gene can be introduced into a target cell or a target tissue by a conventional method to effect expression of an IPP2 protein or an agonist thereof. The target tissue is a site of inflammation. The main advantages of the invention are:

The human phosphatase inhibitor IPP2 was first revealed to significantly inhibit inflammatory factors. Therefore, human phosphatase inhibition The factor IPP2 itself can be used to prepare a composition for inhibiting inflammatory factors, or the human phosphatase inhibitor IPP2 can be used as a target for drug screening for screening for substances that inhibit inflammatory factors by promoting their activity. The invention is further illustrated below in conjunction with specific embodiments. It is to be understood that the examples are merely illustrative of the invention and are not intended to limit the scope of the invention. The experimental methods in the following examples which do not specify the specific conditions are usually carried out according to the conditions described in conventional conditions such as Sambrook et al., Molecular Cloning: Laboratory Guide (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer. The suggested conditions. Percentages and parts are by weight unless otherwise stated. Example 1 Cloning of human IPP2 cDNA

Total RNA from human bone marrow stromal cells was extracted with Trizol reagent (Invitrogen). The poly(A) mRNA is then isolated from total RNA. After the poly(A) mRNA was reverse-transcribed to form a cDNA, the cDNA fragment was inserted into the multiple cloning site of the vector by SuperScriptll cloning kit (Invitrogen), and DH5oc bacteria were transformed to form a cDNA plasmid library. The sequence of the 5' end of the randomly selected clone was determined by the dideoxy method. Comparing the determined cDNA sequence with the existing public DNA sequence database revealed that the DNA sequence of one cDNA clone was a new full-length cDNA. The DNA sequence contained in the new clone was bidirectionally determined by synthesizing a series of primers. Computer analysis indicated that the full-length cDNA contained in the clone was a new cDNA sequence (as shown in SEQ ID NO: 1) encoding a new protein (as shown in SEQ ID NO: 2; This protein is called human bone marrow stromal cell-derived type 1 phosphatase inhibitor IPP2, and its coding gene is called human bone marrow stromal cell-derived type 1 phosphatase inhibitor IPP2 gene.

The sequence SEQ ID NO: l is 1637 bp in length and comprises a 234 bp 5' non-coding region and a 1052 bp 3' non-coding region encoding a polypeptide of 116 amino acids. Theoretically, the molecular weight of the unglycosylated mature molecule is about 39 kD.

BLAST analysis showed that it is 64% identical to the known type 1 phosphatase inhibitor and belongs to the novel type 1 phosphatase inhibitor. Example 2 Cellular expression analysis of human IPP2 by RT-PCR

Human peripheral blood mononuclear cell-derived dendritic cells were extracted from the corresponding cell lines in logarithmic growth phase, human peripheral blood mononuclear cells and endotoxin lipopolysaccharide (LPS), Sigma at different times with Trizol reagent. Total RNA, 5 g of total cellular RNA was mixed with lg Oligo-dT ₁₂ - ₁₈ for reverse transcription. The reverse transcription system was 20 μl, and after the reaction was completed, 80 μl ddH ₂ O was added for dilution. PCR amplification of IPP2 The primers used are as follows:

Sense primer 5,: TTGCCGTGCCTGTATTCCA (SEQ ID NO: 3),

Antisense primer 5,: GAATCGGAGGTGGTGTTTGT (SEQ ID NO: 4),

At the same time, β-actin was used as a positive control. The PCR reaction volume is 50μ1, which contains the reverse transcription template 10μ1, 0.5mM primer, 0.2mM dNTP and 1U rTaq DNA polymerase (Takara). The amplification parameters are 95 °C for 15 seconds, 57 °C for 30 seconds, 72 °. C 30 seconds, extended for 10 minutes at 72 °C after 28 cycles.

The PCR product was initially confirmed by 1.5% agarose gel electrophoresis. The results of DNA sequence analysis indicated that the DNA sequence of the PCR product was identical to that of 412-882 shown in SEQ ID NO: 1.

RT-PCR results showed that IPP2 was expressed in THP-1, K562, TF-1, Molt-4, Daudi, Hela, A549, HT-29, U251 tumor cells (all of which were obtained from ATCC), as shown in Figure 1A. And Figure 1B. Moreover, IPP2 is also expressed in the fetal brain, fetal hippocampus, and fetal cerebellum, as shown in Figure 1C. Example 3 Northern blot analysis of human IPP2

Northern blotting was performed as follows: The filter to be tested was placed in 10 ml of a pre-warmed hybridization solution at 68 ° C, pre-hybridized in a hybridization oven (Bellco) at 68 ° C for 30 minutes; the labeled cDNA probe was 95 Denature at ~100 °C for 2 to 5 minutes, add rapidly to the ice and add the hybridization solution (final concentration of cDNA probe is 2~10ng/ml or l~2 X 10 ⁶ cpm/ml), mix well, at 68° C hybridization for 2 hours. After the hybridization, the filter was rinsed several times with 2xSSC, 0.05% SDS at room temperature, followed by shaking for 30 to 40 minutes, during which the lotion was changed several times. Subsequently, it was rinsed with 0. 1xSSC, 0.1% SDS at 50 ° C for 20 to 40 minutes. Finally, the filter was wrapped in a plastic wrap and exposed to X-ray film at -70 ° C for 24 to 48 hours.

Northern blot hybridization showed that IPP2 was expressed in different degrees in normal tissues such as liver, testis, skeletal muscle, heart and spleen (2.0 kb), indicating that IPP2 protein is a specific expressed protein, see Figure 2A. Moreover, IPP2 is also expressed to some extent in fetal brain and fetal liver, as shown in Figure 2B. Example 4 Human IPP2 prokaryotic expression

In this example, the full-length plasmid DNA of Example 1 was used as a template, and amplification was carried out using PCR primers at the 5' and 3' ends of the sequence below to obtain human IPP2 DNA as an insert.

The 5'-end oligonucleotide primer sequence used in the PCR reaction is:

5 '-GTGGATCCGAGCCCAACAGTCCCAAAA-3 '(SEQ ID NO : 5)

The primer contains a restriction endonuclease of BamH I restriction endonuclease, followed by a partial coding sequence of human IPP2; The 3' primer sequence is:

5'-ATGAATTCGTAAGTAATGGTCCCGCTG-3 '(SEQ ID NO: 6)

This primer contains the EcoR I restriction endonuclease cleavage site, translational terminator and partial coding sequence of human IPP2.

The obtained PCR product was purified, digested with BamH I/EcoR I and then recombined with plasmid pGEM-3ZF (Promega) according to a conventional method and transformed into competent E. coli BL21, and the positive clone was picked, identified, purified and sequenced (ABI company Model 377 Sequencer, BigDye Terminator Kit, PE). The correct sequence of human IPP2 cDNA EcoR I was cloned into the expression vector pGEX-2T (Pharmacia) to form vector pGEX-2T-IPP2, which was then transformed into E. coli BL21. Positive clones were identified by BamH I/EcoR I digestion and the products were analyzed by 0.8% agarose gel electrophoresis. It was confirmed by sequencing that the designed IPP2 coding sequence was inserted.

The positive BL21 clone expressing IPP2 was inoculated into 100 ml 2xYTA medium, and cultured at 37 ° C, 300 rpm, shaking 12-151 °, 1:10 diluted in pre-warmed 2 ¥ butyl medium and shaking culture 1.5111", adding lOOmM IPTG to O. lmM was induced at 30 ° C for 2-6 hr, 5,000 g at 4 ° C for 10 min to remove the supernatant, and placed on ice with 50 ml of lxPBS (0.14 M NaCl, 2.7 mM KC1, lO. lmM Na ₂ HPO ₄ , 1.8 mM KH ₂ PO ₄ , pH 7.3) Resuspend, ultrasonic (B. Braun Labsonic U) was crushed and then added with 20% Triton X-100 to 1% for 30 min, then 12,000 g for 10 min at 4 ° C. The supernatant was filtered with 0.8 μηι After membrane filtration, after washing with 1 ml of 50% glutathione Sepharose 4B column and lxPBS, add 500 ul of glutathione elution buffer (10 mM glutathione, 50 mM Tris-HCl, pH 8.0). After standing at room temperature for 30 minutes, the eluate was collected and eluted 2-3 times to obtain human IPP2 protein. Example 5 Production of anti-human IPP2 antibody

The recombinant protein human IPP2 obtained in Example 4 was used to immunize an animal to produce an antibody, as follows. The recombinant molecules are separated by chromatography and used. Separation can also be performed by SDS-PAGE gel electrophoresis, and the electrophoresis band is excised from the gel and emulsified with an equal volume of complete Freund's adjuvant. Mice were intraperitoneally injected with 50-100 μg/0.2 ml of the emulsified protein. After 14 days, mice were intraperitoneally injected with a dose of 50-100 g/0.2 ml with the same antigen emulsified with incomplete Freund's adjuvant to boost the immunization. A booster immunization was performed every 14 days, at least three times. The specific reactivity of the obtained antiserum was evaluated by its ability to precipitate the translation product of the human IPP2 gene in vitro. As a result, it was found that the antibody specifically binds to the protein of the present invention. Example 6 Construction of human IPP2 eukaryotic recombinant expression vector and mutant

In this example, using the full-length plasmid DNA of Example 1 as a template, amplification was carried out using PCR oligonucleotide primers at the 5' and 3' ends of the sequence below to obtain human IPP2 DNA as an insert.

The 5' oligonucleotide primer sequence used in the PCR reaction was: 5 '-CAGAATTCATGGAGCCCAACAGTCCCA-3, (SEQ ID NO: 7). This primer contains EcoR

a restriction endonuclease site of restriction endonuclease, which is followed by a translation initiator and a partial coding sequence of human IPP2;

3. The end primer sequence is: 5,- TCAAGCTTGAATGGTCCCGCTGCTCC -3' (SEQ ID NO: 8). This primer contains a restriction endonuclease of Hind III restriction endonuclease and a partial coding sequence of human IPP2.

The obtained PCR product was purified, digested with EcoR I/Hind III, and then recombined with plasmid pcDNA 3.1/Myc-His (-) B (Invitrogen) according to a conventional method and transformed into competent E. coli DH5oc, and the positive clone was identified. Purification and sequencing (ABI's Model 377 sequencer, BigDye Terminator kit, PE) was used to form the wild-type eukaryotic expression vector pcDNA 3.1-IPP2 vector (WT;). It was confirmed by sequencing that the designed IPP2 coding sequence was inserted.

The pcDNA 3.1-IPP2 vector (WT) plasmid DNA was used as a template, and the PCR primers at the 5' and 3' ends of the sequence were used for PCR point mutation to construct a 40-threonine mutant expression vector CA.

The 5' oligonucleotide primer sequence used in the PCR reaction was: 5'-AGAAGACCTGCACCAGCATC -3' (SEQ ID NO: 9). The primer converts the codon ACA of threonine to the codon GCA of lysine;

3. The end primer sequence is: 5, - GATGCTGGTGCAGGTCTTCT -3, (SEQ ID NO: 10).

The PCR reaction volume was 50 μl, including plasmid DNA template 1μ1, 0.5ηιΜ bow, 0.2 mM dNTP, and 1U Pyrobest DNA polymerase (Takara). The amplification parameters were 95 °C for 15 seconds, 58 °C for 30 seconds, and 72°. C 30 seconds, 20 cycles and 72 ° C extension for 10 minutes. The PCR product was initially confirmed by 0.8% agarose gel electrophoresis. The obtained PCR product was purified and treated with T4 polynucleotide kinase and phosphoric acid, and blunt-ligated and transformed into competent Escherichia coli DH5oc. The positive clones were identified and purified and sequenced (ABI's Model 377 sequencer, BigDye Terminator reagent) Box, PE company). The clone of the correct sequence is formed into a vector CA. It was confirmed by sequencing that the designed mutation site had been mutated. Example 7 Human IPP2 inhibits NO-induced apoptosis in RAW 264.7 cells

The IPP2 expression vector WT and the mutant of Example 6 were transfected into RAW 264.7 cells (ATCC: TIB-71) with LipofectAMINE reagent (Invitrogen), and G418 (Sigma) was sieved stably. Determine the expression of cell lines. 10 ⁶ cells were plated in a 6-well plate, and the cells were attached to the wall and then added with a NO generator, lmM SNP (Sigma) for 24 hours for PI/Anne _X inV (BD) staining, and detected by flow cytometry.

The results showed that IPP2 inhibited NO-induced apoptosis of RAW264.7 cells, showing that the proportion of viable cells in the IPP2 group was significantly higher than that in the CA mutant group and the mock control group (Mock). Example 8 IPP2 inhibition LPS induction ELISA detection of inflammatory cytokines in RAW 264.7 cells

The IPP2 expression vector WT and the mutant of Example 6 were transfected into RAW 264.7 cells with LipofectAMINE reagent, and G418 was used to screen out stable expression cell lines. 10 ⁶ cells were plated in 6-well plates, and cells were ligated with lug/ml of LPS Sigma for 18 h. The content of IL-6 and TNF in the cell supernatant was quantitatively determined by ELISA, and the main steps were in accordance with the kit instructions (R&D;).

The results showed that IPP2 significantly inhibited the production of the inflammatory cytokines IL-6 and TNFoc. Similarly, CA mutations do not inhibit cytokine production, see Figure 4. Example 9 Screening for substances that inhibit the production of inflammatory cells

The RAW 264. 7 cells transfected with the IPP2 expression vector WT of Example 6 were used as the subject, and the expression of IPP2 in the cells before and after the stimulation of the candidate substance was quantitatively detected, and the antibiotic prepared by the above was used. The human IPP2 antibody was subjected to a hybridization test, and the expression of IPP2 in the cells was determined by detecting the binding strength of the IPP2-IPP2 antibody to each other.

Test group: RAW 264. 7 cells with candidate substance added, the cells were transfected with IPP2 expression vector WT; control group: RAW 264. 7 cells without candidate substance, the cell was transfected with IPP2 expression vector

WT.

If the expression of IPP2 is enhanced in RAW 264. 7 cells in the test group compared with the control group, it indicates that the candidate substance can promote the expression of IPP2, thereby inhibiting the production of inflammatory cytokines. All documents mentioned in the present application are hereby incorporated by reference in their entirety in their entireties in the the the the the the the the the In addition, it is to be understood that various modifications and changes may be made by those skilled in the art in the form of the appended claims.

Claims

Rights request

A use of a human phosphatase inhibitory factor IPP2 or a gene encoding the same or an agonist thereof, which is characterized in that it is used for the preparation of a composition for inhibiting the production of inflammatory cytokines.

The use according to claim 1, wherein the inflammatory cytokine is selected from the group consisting of: interleukin-6, or tumor necrosis factor alpha.

3. Use according to claim 1 wherein the composition is also for inhibiting apoptosis.

4. The use according to claim 1, wherein the human phosphatase inhibitor ΙΡΡ2 is selected from the group consisting of:

(1) a protein of the amino acid sequence of SEQ ID NO: 2; or

5. The use according to claim 1, wherein the composition is a pharmaceutical composition.

A use of the human phosphatase inhibitor IPP2, which is for screening for a substance which inhibits the production of inflammatory cytokines.

7. A method of screening for potential substances that inhibit inflammatory cytokines, the method comprising:

8. The method according to claim 7, wherein step (a) comprises: adding a candidate substance to a system containing the human phosphatase inhibitor IPP2 in the test group; and/or

If the expression or activity of the human phosphatase inhibitor IPP2 in the test group is statistically higher than the control group, it indicates that the candidate is a potential substance for inhibiting inflammatory cytokines.

9. The method according to claim 7, further comprising the steps of:

10. The method of claim 7, wherein the system is a cellular system.