CN1462807A - Molecule marker method of wheat Nanda 2419 scab resistant major gene locus - Google Patents
Molecule marker method of wheat Nanda 2419 scab resistant major gene locus Download PDFInfo
- Publication number
- CN1462807A CN1462807A CN 03131961 CN03131961A CN1462807A CN 1462807 A CN1462807 A CN 1462807A CN 03131961 CN03131961 CN 03131961 CN 03131961 A CN03131961 A CN 03131961A CN 1462807 A CN1462807 A CN 1462807A
- Authority
- CN
- China
- Prior art keywords
- major gene
- wheat
- gene loci
- mark
- nanjing university
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A major gene site resisting bakanae disease extension for wheat "Nanda 2419" and its molecular marker are disclosed. After the genetic type, invalid ear rate and affected section length of each parentage for the recombinant selfing line obtained by hybridization between wheat "Wanshuibai" and "Nanda 2419" are analyzed in genetic linkage mode, said major gene sites QFhs.nau-4b and QFhs.nau-6dl are found out. Detecting if Nanda 2419 and its derivative variety contain the major gene site can predict its level resisting bakanae disease.
Description
One, technical field
The invention provides wheat Nanjing University 2419 anti gibberellic diseases expansion major gene loci and molecule marker thereof, belong to the molecular genetics field, be exclusively used in the seed selection of wheat scab disease-resistant variety and the utilization of germ plasm resource.
Two, technical background
Wheat is the important food crop of China.By the wheat scab that gibberella causes, not only cause the serious underproduction of wheat, reduce grain quality, and the toxin deoxynivalenol that this germ produces also influences people, animal health, caused very big loss to Wheat Production.In China, the harm that suffers head blight above 1/4th wheat belt is arranged, and just once be very popular every 3 ~ 5 years, only head blight generation area in 2002 promptly reaches 30,000,000 mu times.Therefore, research prevents and treats wheat scab and has also just become a urgent task on the current Wheat Production.Cultivating disease-resistant variety is to prevent and treat the safest, effective of wheat scab harm and save one of measure of cost.But traditional breeding way is wasted time and energy, and because the head blight phenotypic evaluation is very difficult, makes the wheat anti gibberellic disease breeding process slow unusually.Identify that by the location disease-resistant major gene loci comes assistant breeding effectively to address this problem.
Genetic research shows that wheat scab is controlled by a few major gene loci mainly, and its disease-resistant major gene loci position on karyomit(e) of different resistant materials is inconsistent, and be divided into anti-infect and resist expand two types.But the polymerization by the disease-resistant major gene loci of difference or introduce new anti-source and can select the good kind of resistance.
At present in the utilization of the research of scab resistance hereditary basis and breeding for disease resistance, focus mostly in Soviet Union wheat No. 3 and derive and be.Nanjing University 2419 is choosing systems of Italian wheat breed Mentana, has yielding ability preferably, and economical character is good, is one of backbone parent of China's wheat breeding.And the parent " Funo " of Mentana and Soviet Union three has the common ancestors, so may exist in the Nanjing University 2419 and scab resistance mechanism like the Su Sanxiang.
Three, disclosure of Invention Technical Problem the objective of the invention is: wheat Nanjing University 2419 anti gibberellic diseases expansion major gene loci and molecule marker thereof are provided, by detecting and the chain molecule marker of these anti-expansion major gene locis, can predict the scab resistance of wheat plant, accelerate the selection progress of wheat-resistance to scab.Technical scheme wheat Nanjing University 2419 anti gibberellic diseases expansion major gene loci is characterized in that: major gene loci QFhs.nau-4b, and by mark Xgwm107 location,
Left end primer sequence ATTAATACCTGAGGGAGGTGC
Right-hand member primer sequence GGTCTCAGGAGCAAGAACAC
Amplified fragments 188bp, this major gene loci are positioned at the 4B karyomit(e) of wheat Nanjing University 2419, utilize Data desk v.5.0 software record with the incoherent probability P value of scab resistance be 0.0004, to the contribution rate 17.9% of scab resistance; Major gene loci QFhs.nau-6d1, by mark Xgwm469 location,
Left end primer sequence CAACTCAGTGCTCACACAACG
Right-hand member primer sequence CGATAACCACTCATCCACACC
Amplified fragments 172bp, this major gene loci are positioned at the 6D karyomit(e) of wheat Nanjing University 2419, utilize Data desk v.5.0 software record with the incoherent probability P value of scab resistance be 0.0089, to the contribution rate 6.1% of scab resistance;
Above-mentioned wheat Nanjing University 2419 anti gibberellic diseases expansion major gene loci, be that to obtain mark by the following method localized: (1) wheat breed Wangshuibai (♀) is hybridized with Nanjing University 2419 (♂) and is obtained hybrid F1, the F1 selfing produces F2, adopts simple grain transmission method (SSD) to obtain the F6 RIL in generation then; (2) extract the DNA that each strain of recombinant inbred lines is with the SDS method, adopt simple repeated sequence mark SSR that two parents are carried out the polymorphism screening, PCR carries out on PE9600 amplification instrument, amplified production carries out electrophoretic analysis on 8% (g/ml) polyacrylamide gel, there is polymorphic primer in recombinant inbred lines, to analyze between the parent, the pcr amplification program is the same, obtains colony's genotype data; (3) according to chain exchange rule, utilize colony's genotype data to make up the genetic map of wheat, used software is Mapmaker 2.0, minimum LOD value is made as 3, obtains linkage map; (4) blooming stage carries out the scab resistance evaluation to each family of RIL, leading indicator is that disease spikelet number and sick joint length (5) are utilized Data desk v.5.0 software sick spikelet number that the colony's genotype data of each molecule marker and the scab resistance of its corresponding each family are identified and disease are saved length and carry out linkage analysis, One-way ANOVA records and the incoherent probability P value of scab resistance, the molecule marker of P＜0.05 promptly shows with a major gene loci chain: find the mark Xgwm107 of P=0.0004 and the mark Xgwm469 and anti-expansion major gene loci close linkage of P=0.0089 in Nanjing University 2419, promptly obtain the mark location of 2419 anti-expansion major gene loci QFhs.nau-4b of wheat Nanjing University and QFhs.nau-6d1.Beneficial effect wheat provided by the present invention Nanjing University 2419 anti gibberellic diseases expansion major gene loci and molecule marker thereof, have the following advantages: (1) the present invention obtains to have located the major gene loci of 2 anti gibberellic disease expansions in the wheat breed Nanjing University 2419, common soluble 39.6% scab resistance in the world first.The wheat cdna group is huge, is 40 times of rice genome size, and the accurate location work of wheat anti gibberellic disease major gene loci is occupy the same domain prostatitis; (2) major gene loci locality specific, it is convenient to identify.By detecting and the chain molecule marker of these anti-expansion major gene locis, promptly can predict the scab resistance of wheat plant, the genotype detection that is used for wheat breed or strain, judging whether this kind or strain have scab resistance, and then rapid screening disease-resistant variety or strain are used for wheat breeding.Major gene loci easy to detect fast, not affected by environment; (3) the assistant breeding select target is clear and definite, saves cost.In traditional breeding way, at first to collect parent and Cultivar and carry out a series of hybridization, and will carry out individual plant to scab resistance and select with disease-resistant gene.Wheat scab is carried out phenotypic evaluation will wait until blooming stage, be subjected to bigger environmental influence, the result reliability of phenotypic evaluation is low.Therefore breeding for disease resistance is not only time-consuming, and difficulty is big, the cost height.By detecting the anti gibberellic disease major gene loci, can just identify the individual plant of high anti gibberellic disease in seedling stage, eliminate other plant, not only save production cost but also improve the efficiency of selection of wheat-resistance to scab greatly.
Four, embodiment is of the present invention is described in detail as follows:
Studies show that wheat scab resistance is controlled by the minority major gene loci mainly.U.S. Anderson laboratory finds that the scab resistance of No. 3/Stoa of four major gene locis and Soviet Union wheat colony is significantly relevant, lays respectively at 2AL, 3BS, 4BS and 6BS and goes up (Anderson, 1998; Waldron, 1999; Anderson, 2000,2001).People such as U.S. Bai obtain two the scab resistance sites relevant with the RAPD mark, and Zhou integrated use SSR, AFLP in 2002 and aneuploid technology are positioned at this major gene loci that to lack be that 3BS-8 does not hold a last length to be about the chromosomal region of 8cM.Japan Ban infers that the resistance main effect gene locus of Soviet Union wheat 3 may be positioned on the 5AL.Austrian Buerstmayr (2000,2001) finds that three genome areas and the anti-extendability significant correlation of head blight are arranged, and is positioned on 3BS, 5A, the 1B.The present invention finds, there are 2 anti-expansion major gene locis in the 4B of wheat breed Nanjing University 2419 and the 6D karyomit(e), these major gene locis can be used to instruct the seed selection work of anti gibberellic disease kind, screen with chain with it molecule marker enantiopathy kind, make different disease-resistant major gene loci rapid polymerizations in same plant, thereby improve breeding efficiency greatly.Materials and methods: the structure and the phenotypic evaluation of (one) Nanjing University 2419 RILs:
(1) choosing to China's Jiangsu local variety Wangshuibai (♀) and Italian wheat breed Mentana is that acquisition F1 is hybridized in Nanjing University 2419 (♂), the F1 selfing produces F2,136 optional plantations of F2 individual plant, the method that adopts simple grain to pass is bred F6 generation, obtain RIL, comprise 136 familys;
(2) RIL is planted in Agricultural University Of Nanjing in experimental plot, the greenhouse and academy of agricultural sciences, Jiangsu Province in the school.Blooming stage carries out scab resistance to each family to be identified.Adopt single flower instillation, promptly choose the small ear of just having bloomed in wheat head middle part, instiling contains mixed bacteria liquid 20 microlitres of F4, F15, several strong gibberella spores that cause a disease of F17, F34, and atomizing was preserved moisture 3 days then.Inoculate after 21 days, measure state of an illness indexs such as disease spikelet number and sick joint length.(2) molecular marker analysis of recombinant inbred lines (1) is DNA with each strain of SDS method extraction recombinant inbred lines; (2) at first Wangshuibai and 2419 parents' of Nanjing University dna polymorphism is carried out initial analysis with 976 pairs of SSR primers.The PCR reaction volume is 25 microlitres, 10 * buffer, 2.5 microlitres wherein, 25mM MgCl
21.5 microlitre, 2.5mM dNTPs 2 microlitres, Taq enzyme (5 units/microlitre) 0.2 microlitre, template DNA 20 nanograms add water to 25 microlitres.After the SSR reaction system is 94 ℃ of pre-sex change 3min of DNA, 94 ℃ of sex change 1min, 60 ℃ of annealing 1min, 72 ℃ are extended exhibition 2min, circulate 35 times, and last 72 ℃ are extended 10min.In the enterprising performing PCR amplification of PE 9600 amplification instrument, amplified production carries out electrophoretic separation on 8% non-denaturing polyacrylamide gel (containing 7.6 gram acrylamides and 0.4 gram methylene diacrylamide in the 100ml polyacrylamide solution), on ultraviolet transilluminator, take a picture then, the record result, there is polymorphic primer in recombinant inbred lines, to analyze between the parent, obtains colony's genotype data; (3) according to chain exchange rule, utilize colony's genotype data to make up the genetic map of wheat, used software is Mapmaker 2.0, minimum LOD value is made as 3, obtains linkage map; (4) utilize Data desk v.5.0 software carry out linkage analysis, the location major gene loci to colony's genotype data of each molecule marker with sick spikelet number and sick joint length that the scab resistance of its corresponding each family is identified.(3) result and analysis:
Molecular marker screening is the result show, has 383 pairs of SSR primers variant between parents.Utilize Datadesk v.5.0 software sick spikelet number and sick joint length that the colony's genotype data of each molecule marker and the scab resistance of its corresponding each family are identified carry out linkage analysis, One-way ANOVA records and the incoherent probability P value of scab resistance and the site contribution rate R to scab resistance
2(table 2), the molecule marker of P＜0.05 are promptly chain with a major gene loci.The genotype of gained molecule marker in colony is by the genotype classification of parent's Wangshuibai and Nanjing University 2419, if the 2419 identical strains of genotype and Nanjing University are that phenotype is anti-, then the localized disease-resistant major gene loci of this mark is from Nanjing University 2419: find the mark Xgwm107 of P=0.0004 and the mark Xgwm469 and anti-expansion major gene loci close linkage of P=0.0089 in Nanjing University 2419, promptly obtain the mark location of 2419 anti-expansion major gene loci QFhs.nau-4b of wheat Nanjing University and QFhs.nau-6d1.
Be tested and appraised above-mentioned major gene loci and predict the wheat plant resistance, expectation can improve the breeding process of China's disease-resistant wheat kind rapidly.
The sequence of table 1. labeled primer and amplified fragments size
Clip size
Mark left end primer sequence right-hand member primer sequence
(bp)
Xgwm107 ATTAATACCTGAGGGAGGTGC GGTCTCAGGAGCAAGAACAC 188
Xawm469 CAACTCAGTGCTCACACAACG CGATAACCACTCATCCACACC 172
The One-way ANOVA of table 2. Nanjing University 2419 anti-expansion major gene locis
Sick spikelet number
The major gene loci mark
P R
2(％)
QFhs.nau-4b Xgwm107 0.0004 17.9
QFhs.nau-6d1 Xgwm469 0.0089 6.1P: expression and the incoherent probability of scab resistance, P＜0.05 this mark of table and scab resistance close linkage R
2: the site is to the contribution rate of scab resistance, value is big more show relevant more with scab resistance
Claims (3)
1, wheat Nanjing University 2419 anti gibberellic diseases expansion major gene loci is characterized in that: major gene loci QFhs.nau-4b, and by mark Xgwm107 location,
Left end primer sequence ATTAATACCTGAGGGAGGTGC
Right-hand member primer sequence GGTCTCAGGAGCAAGAACAC
Amplified fragments 188bp, this major gene loci are positioned at the 4B karyomit(e) of wheat Nanjing University 2419, utilize Data desk v.5.0 software record with the incoherent probability P value of scab resistance be 0.0004, to the contribution rate 17.9% of scab resistance; Major gene loci QFhs.nau-6d1, by mark Xgwm469 location,
Left end primer sequence CAACTCAGTGCTCACACAACG
Right-hand member primer sequence CGATAACCACTCATCCACACC
Amplified fragments 172bp, this major gene loci are positioned at the 6D karyomit(e) of wheat Nanjing University 2419, utilize Data desk v.5.0 software record with the incoherent probability P value of scab resistance be 0.0089, to the contribution rate 6.1% of scab resistance.
2, wheat according to claim 1 Nanjing University 2419 anti gibberellic diseases expansion major gene loci, it is characterized in that: these major gene locis are that to obtain mark by the following method localized: (1) wheat breed Wangshuibai (♀) is hybridized with Nanjing University 2419 (♂) and is obtained hybrid F1, the F1 selfing produces F2, adopts simple grain transmission method (SSD) to obtain the F6 RIL in generation then; (2) extract the DNA that each strain of recombinant inbred lines is with the SDS method, adopt simple repeated sequence mark SSR that two parents are carried out the polymorphism screening, PCR carries out on PE9600 amplification instrument, amplified production carries out the electrophoretic separation analysis on 8% (g/ml) polyacrylamide gel, according to the molecular marker screening result, filtering out has polymorphic primer between the parent, has polymorphic primer to analyze in recombinant inbred lines between the parent, the pcr amplification program is the same, obtains colony's genotype data; (3) according to chain exchange rule, utilize colony's genotype data to make up the genetic map of wheat, used software is Mapmaker 2.0, minimum LOD value is made as 3, obtains linkage map; (4) blooming stage inoculation head blight pathogenic bacteria carries out scab resistance to each family of RIL and identifies, obtains the sick spikelet number and the sick joint length of each family of RIL; (5) utilize Data desk v.5.0 software sick spikelet number and sick joint length that the colony's genotype data of each molecule marker and the scab resistance of its corresponding each family are identified carry out linkage analysis, One-way ANOVA records and the incoherent probability P value of scab resistance, the molecule marker of P＜0.05 is promptly chain with a major gene loci, the position of anti gibberellic disease expansion major gene loci is determined by the chromosome position of molecule marker: find the mark Xgwm107 of P=0.0004 and the mark Xgwm469 and anti-expansion major gene loci close linkage of P=0.0089 in Nanjing University 2419, promptly obtain the mark location of 2419 anti-expansion major gene loci QFhs.nau-4b of wheat Nanjing University and QFhs.nau-6d1.
3, the molecule marker of claim 1 or 2 described wheat Nanjing Universitys, 2419 anti gibberellic diseases expansion major gene loci, it is characterized in that, be positioned at anti gibberellic disease expansion major gene loci QFhs.nau-4b on 4B, the 6D karyomit(e) and the molecule marker of QFhs.nau-6d1 in the Nanjing University 2419 and be respectively Xgwm107 and Xgwm469.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 03131961 CN1246477C (en) | 2003-06-23 | 2003-06-23 | Molecule marker method of wheat Nanda 2419 scab resistant major gene locus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 03131961 CN1246477C (en) | 2003-06-23 | 2003-06-23 | Molecule marker method of wheat Nanda 2419 scab resistant major gene locus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1462807A true CN1462807A (en) | 2003-12-24 |
| CN1246477C CN1246477C (en) | 2006-03-22 |
Family
ID=29748489
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 03131961 Expired - Fee Related CN1246477C (en) | 2003-06-23 | 2003-06-23 | Molecule marker method of wheat Nanda 2419 scab resistant major gene locus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1246477C (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100336905C (en) * | 2004-05-08 | 2007-09-12 | 南京农业大学 | Wheat fertility recovery gene molecular mark and its obtaining method |
-
2003
- 2003-06-23 CN CN 03131961 patent/CN1246477C/en not_active Expired - Fee Related
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100336905C (en) * | 2004-05-08 | 2007-09-12 | 南京农业大学 | Wheat fertility recovery gene molecular mark and its obtaining method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1246477C (en) | 2006-03-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Saxena et al. | Application of SSR markers for molecular characterization of hybrid parents and purity assessment of ICPH 2438 hybrid of pigeonpea [Cajanus cajan (L.) Millspaugh] | |
| CN108165656B (en) | Wheat molecular marker and application thereof in identification of wheat powdery mildew resistance | |
| CN106755481A (en) | A kind of SSR molecular marker VI for identifying Gala apple Progeny plants and its application | |
| CN105200160B (en) | A kind of relevant SNP marker of dissolved oxygen tolerance low to litopenaeus vannamei and its screening and application | |
| CN102140506B (en) | Molecular marker linked with gummy stem blight resistance gene Gsb-2 and application thereof | |
| CN106048042A (en) | Single nucleotide polymorphism marker site, primers and reagent kit for identifying peach fruit flesh color characteristic and application | |
| Bakooie et al. | Development of an SNP marker for sugar beet resistance/susceptible genotyping to root-knot nematode | |
| CN110777216B (en) | Method for identifying purity of Jingke waxy 2000 corn hybrid based on SNP marker | |
| CN112899376B (en) | Method for detecting economic traits of Tibetan chicken by FOXO1 gene SNP marker and application thereof | |
| BR112013027408B1 (en) | method to identify a rust-resistant sugar cane strain | |
| CN1246478C (en) | Molecule marker method of wheat Wangshuibai scab resistant major gene locus | |
| CN1246479C (en) | Molecule marker method of wheat Wangshuibai scab resistant major gene locus | |
| Liu et al. | Development and validation of functional markers (tetra-primer ARMS and KASP) for the bacterial blight resistance gene xa5 in rice | |
| CN102653759A (en) | Molecular marker of wheat scab resistance expansion gene Fhbl and application thereof | |
| CN1246476C (en) | Molecule marker method of wheat Nanda 2419 scab resistant major gene locus | |
| Talebi et al. | Molecular characterization of'Carthamus tinctorius' and'C. oxyacanthus' germplasm using sequence related amplified polymorphism (SRAP) markers | |
| CN1246477C (en) | Molecule marker method of wheat Nanda 2419 scab resistant major gene locus | |
| de Oliveira et al. | Dominant versus codominant marker aiming to characterize Capsicum spp. | |
| Dang et al. | Triploid and aneuploid hybrids obtained from hybridization between Eriobotrya japonica and E. cavaleriei | |
| CN101942521A (en) | Molecular marker detection method of rice blast bacterium non-toxic genes Avr-Pit and primers thereof | |
| BR112020026955A2 (en) | MARKER ASSOCIATED WITH SMUT RESISTANCE IN THE PLANT BELONGING TO THE SACCHARUM GENDER AND USE OF THE SAME | |
| CN104878004B (en) | One kind SNP marker detection associated with haliotis diversicolor Reeve growth traits and its application | |
| KR101878539B1 (en) | Nucleotide polymorphism markers for Foxglove aphid resistance in soybean and the use thereof | |
| CN117757983B (en) | Molecular marker primer co-separated from powdery mildew resistance gene PmYD-001 of durum wheat and application thereof | |
| Chen et al. | Using genome-wide SSR analysis to understand the genetic diversity and structure of 174 Akebia trifoliata accessions |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |