CN101942521A - Molecular marker detection method of rice blast bacterium non-toxic genes Avr-Pit and primers thereof - Google Patents
Molecular marker detection method of rice blast bacterium non-toxic genes Avr-Pit and primers thereof Download PDFInfo
- Publication number
- CN101942521A CN101942521A CN 201010506165 CN201010506165A CN101942521A CN 101942521 A CN101942521 A CN 101942521A CN 201010506165 CN201010506165 CN 201010506165 CN 201010506165 A CN201010506165 A CN 201010506165A CN 101942521 A CN101942521 A CN 101942521A
- Authority
- CN
- China
- Prior art keywords
- pit
- enzyme
- avr
- rice blast
- detection method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for rapidly detecting rice blast bacterium non-toxic genes Avr-Pit by utilizing molecular markers. In the invention, two pairs of specific primers are used, wherein an upstream primer in one pair of primers is ACCGCGATCAGTGGAAAACT, and a downstream primer is ATTGGCAGAGCCAGCTACTC; and an upstream primer in the other pair of primers is TTGTGTTCCTGTCAATCGCG, and a downstream primer is CGCAGCTTATATCTCGGATAG. The method in the invention has the advantages of simple operation, explicit result and time and cost saving.
Description
Technical field
The present invention relates to a kind of molecule marker primer that detects avirulence gene of rice blast Avr-Pit, and utilize described primer to detect the molecule marking method of avirulence gene of rice blast Avr-Pit.
Background technology
Paddy rice is one of important crops, and rice blast is that world's distribution is the widest, one of the most serious rice disease causes harm, oneself becomes the major obstacle factor of rice high yield, stable yields, and (Ou S H.1980, Pathogen variability and hostresistance in rice blast disease.Ann Rev Phytopathol.18:167-187.), human grain security in the positive serious threat of the harm that it causes.Control rice blast is also the same with other rice diseases, is by utilizing sterilant, and cultivation step carries out with the mode that the plantation disease-resistant variety combines, and the plantation disease-resistant variety is to prevent and treat one of most economical effective way of rice blast.Yet to carry out breeding for disease resistance work fruitfully, except seeking the good anti-source, also must further investigate and make mechanism etc. mutually between the mechanism of causing a disease of Pyricularia oryzae and paddy rice and the Pyricularia oryzae, and in pathogenic bacteria and host's coevolution process, pathogen virulence genomic constitution meeting changes along with the variation of host's disease-resistant gene composition, (Zeigler R S.1998 finally to cause the forfeiture of disease-resistant variety resistance, Recombination in Magnaporthe grisea.AnnuRev Phytopathol, 36:249-275.).This interaction of research on molecular level not only otherwise broken hair is existing and utilize new disease-resistant gene, is carried out the analysis of rice varieties disease-resistant gene, with a plurality of disease-resistant genes mix use outside, also must analyze simultaneously the nontoxic gene in the rice blast fungus population.Research to the nontoxic gene product is the important means of further understanding specific molecular genetic mechanism, nontoxic gene can be used as the toxicity group structure feature that a kind of molecular probe is used to study Pyricularia oryzae, disclose its variation law and dynamic, the rational deployment that also can be disease-resistant variety provides theoretical foundation with cultivation disease-resistant variety and disease control, thereby reach the purpose (Shi Jun etc. that control this disease for a long time, effectively, the avirulence gene of rice blast progress. Chinese biological engineering magazine, 2006,26 (12): 112～116).
The method of forming (physiological strain) evaluation according to traditional Pyricularia oryzae toxicity is to identify that by the pathotype of differential variety dividing physiological strain studies population structure of Magnaporthe grisea from rice, can understand by this method that physiological strain in the rice blast fungus population is formed and the variation of dominant population, thereby it is dynamic to grasp population structure of Magnaporthe grisea from rice and heritable variation, but the physiological strain of dividing is often different because of differential variety, and workload is big, the result easily is subject to seasonal restrictions, the envrionment conditions artificial factor, be difficult to accurately reflect population structure of Magnaporthe grisea from rice (Chen Qinghe, the genetic analysis of rice blast fungus population genetic diversity and nontoxic gene thereof and molecule marker location .2005. Agricultural University Of Nanjing doctorate paper).
Along with molecular genetics and development of molecular biology, fingerprinting technology on the dna level (as, SSR, RAPD, CAPS) composition for research rice blast fungus population nontoxic gene provide efficiently, method fast, avoided extensive work, therefore all paid much attention to the molecular marker screening work of avirulence gene of rice blast both at home and abroad by the pathotype evaluation of differential variety.Utilize dna molecular marker to identify the nontoxic gene (Ma of more than 40 Pyricularia oryzae at present, J.H., Wang, L., Feng, S.J., Lin, F., Xiao, Y., and Pan, Q.H.2006.Identification and fine mapping of AvrPi15, a novel avirulence gene of Magnaporthe grisea.Theor Appl Genet 113:875-883.), and 9 nontoxic gene (Pw11 have been cloned into, Pw12, Avr-C039, Avr-Pita, ACE1, Avr-Pia, Avr-Pii, AvrPiz-t and Avr-Pik), this is just for identifying that by molecule marker toxicity forms the convenient condition of having created.The chain molecule marker (the used molecule marker in especially early stage location) of some nontoxic genes is the RFLP mark mostly, but, be not easy to the toxicity compositional analysis of nontoxic gene because this class mark needs complicated operations program, the biochemical reagents of costliness and the DNA of great amount of samples.In recent years, the biological gene group sequence of more and more kinds is announced out, makes that the development of molecule marker is rapid.
The CAPS mark (enzyme is cut the amplification polymorphism sequence, Cleaved Amplified PolymorphismSequences) that this research is adopted is based on the development of RFLP mark, is combined with restriction enzyme digestion and is produced by special primer PCR.When the electrophoretic band of the specific amplified product of SCAR or STS does not show polymorphism, can carry out enzyme to amplified production with restriction enzyme and cut, and then detect its polymorphism by agarose or polyacrylamide gel electrophoresis.What it disclosed is the information of restriction enzyme site variation in the specific PCR product D NA sequence, is used widely in research fields such as molecular biology, genetics, thremmatologies at present.CAPS is a kind of molecule marker of PCR-based technology, have characteristics such as codominance, locus specificity, good reproducibility, simple to operate and cost be low, it is a kind of indicia means that is worthy to be popularized, the variation law that helps to disclose big Tanaka's nontoxic gene reaches dynamically, can increase the PCR mark saturation ratio of target chromosome section greatly, accelerate clone's work of nontoxic gene.
Summary of the invention
Technical problem to be solved by this invention provides a kind of method of utilizing molecule marker fast, accurately to detect avirulence gene of rice blast Avr-Pit, screening obtains with nontoxic gene Avr-Pit close linkage and molecule marker not affected by environment and carries out chromosomal localization, and the toxicity composition of molecule marker and germ is closely connected.
Technical scheme provided by the invention is: a kind of molecule marker primer that detects avirulence gene of rice blast Avr-Pit, its upstream primer sequence be as described in the SEQ ID No.1, and the downstream primer sequence is as described in the SEQ ID No.2.
The molecular mark detection method of a kind of avirulence gene of rice blast Avr-Pit: utilize above-mentioned primer amplification Pyricularia oryzae genomic dna to be measured, getting amplified production carries out enzyme with enzyme EarI and cuts, then endonuclease bamhi is carried out gel electrophoresis, if the fragment that two length are respectively 268bp and 101bp occurs, Pyricularia oryzae genome then to be measured contains nontoxic gene Avr-Pit.
Above-mentioned detection method, wherein the EarI enzyme system of cutting is: 10 * 4buffer, 2.0 μ l, DNA 0.5 μ g, EarI enzyme 0.5 μ l adds aseptic ultrapure water to 20 μ l.
The invention provides the another kind of molecule marker primer that detects avirulence gene of rice blast Avr-Pit, its upstream primer sequence is as described in the SEQ ID No.3, and the downstream primer sequence is as described in the SEQ ID No.4.
The invention provides the molecular mark detection method of another kind of avirulence gene of rice blast Avr-Pit: utilize above-mentioned primer amplification Pyricularia oryzae genomic dna to be measured, getting amplified production carries out enzyme with enzyme PciI and cuts, then endonuclease bamhi is carried out gel electrophoresis, if the fragment that two length are respectively 472bp and 382bp occurs, Pyricularia oryzae genome then to be measured contains nontoxic gene Avr-Pit.
Above-mentioned detection method, its PciI enzyme system of cutting is: 10 * 3buffer, 2.0 μ l, DNA 0.5 μ g, 100 * BSA, 0.2 μ l, PciI enzyme 0.5 μ l adds aseptic ultrapure water to 20 μ l.
Above-mentioned detection method, the PCR reaction system of the Pyricularia oryzae genomic dna to be measured that increases is: 10 * Ex Taqbuffer, 5.0 μ l, MgCl
22mM, dNTPs 0.2mM, Ex Taq archaeal dna polymerase 1.25U, upper and lower primer respectively are 0.5 μ M, template DNA 2.5ng adds aseptic ultrapure water to 50 μ l; The PCR reaction parameter is: 94 ℃ of pre-sex change 5min; 94 ℃ of sex change 30S, 57 ℃ of annealing 30S, 72 ℃ are extended 1min, 31 circulations; 72 ℃ are extended 8min.
The present invention has following beneficial effect:
Compare with existing molecular marking technique, its advantage and positively effect show:
(1) mark is stable: the nontoxic gene molecule marker that the present invention obtains is the CAPS mark, and two chain molecule markers are stable, is not subject to the influence of reaction system, condition, DNA concentration, and simple to operate, and the result is clear and definite.
(2) save time and cost: the traditional method that rice blast fungus population toxicity is formed monitoring is to identify that by the pathotype of differential variety dividing physiological strain studies population structure of Magnaporthe grisea from rice, can understand by this method that physiological strain in the rice blast fungus population is formed and the variation of dominant population, thereby it is dynamic to grasp population structure of Magnaporthe grisea from rice and heritable variation, but identify and be subjected to the restriction in season, the physiological strain of dividing is often different because of differential variety, and the result is subject to the envrionment conditions artificial factor, accuracy is low, is difficult to accurately reflect population structure of Magnaporthe grisea from rice.What filter out by the present invention is not affected by environment with the closely linked molecule marker of nontoxic gene, and target is decided nontoxic gene exactly, saves plenty of time and cost, composition, distribution and the development law of real-time analysis field avirulence gene of rice blast.
The present invention carries out genetic analysis by the thecaspore progeny population that the rice blast strain mating is produced, and uses the CAPS labeling technique, can make up and locate the genetic map of rice blast fungus nontoxic gene Avr-Pit, has obtained and the closely linked molecule marker of nontoxic gene.By obtaining and the closely linked molecule marker of avirulence gene of rice blast, not only can utilize the mark of this nontoxic gene to make probe, study the distribution situation of this nontoxic gene in natural population, disclose germ colony toxicity and form and the variation characteristics, and clone this nontoxic gene for further physical mapping method and lay the foundation.The present invention's molecular marking technique has been located the nontoxic gene Avr-Pit of Pyricularia oryzae.
Description of drawings
Fig. 1 a is that electrophoresis detection is cut the result by the enzyme of CAPS labeled primer CAPS77 amplification Pyricularia oryzae parent strain genomic dna product; Fig. 1 b is that electrophoresis detection is cut the result by the enzyme of CAPS labeled primer CAPS77 amplification Pyricularia oryzae part filial generation genomic dna product; A: avirulent strains, V: toxic strain; M:2kb plus marker.
Fig. 2 cuts the result for electrophoresis detection by the enzyme of CAPS labeled primer CAPS88 amplification Pyricularia oryzae parent strain and part filial generation genomic dna product; A: avirulent strains, V: toxic strain; M:2kb plus marker.
Fig. 3 is the partial linkage genetic map of nontoxic gene Avr-Pit.
Embodiment
Detailed description below by embodiment is further illustrated the present invention, but is not limitation of the present invention, only does the example explanation.
Embodiment 1:
Molecule marker, location that avirulence gene of rice blast Avr-Pit is chain obtain by the following method:
1) utilizes the sexual progeny that parent Guy11 and JS153 (parent strain be Agricultural University Of Nanjing plant disease system preserve bacterial strain) and hybridization obtains evaluations such as () Chen Qinghe, (Chen QH on that tentatively obtain and SSR mark m355-356 nontoxic gene Avr-Pit linkage inheritance basis, Wang YC, Li AN, Zhang ZG, Zheng XB.2007.Molecularmapping of two cultivar-specific avirulence genes in the rice blast fungus Magnaporthe grisea.Mol Genet Genomics.277 (2): 139-48.), design CAPS labeled primer, primer sequence such as table 1:
Table 1
2) molecule marker that adopts two pairs of CAPS molecule marker primer amplifications containing CAPS mark CAPS77, CAPS88 to obtain carries out the screening with nontoxic gene Avr-Pit linked marker in two parents.The PCR response procedures of CAPS mark is: 10 * Ex Taq buffer, 5.0 μ l, MgCl
22mM, dNTPs 0.2mM, Ex Taq archaeal dna polymerase 1.25U, primer respectively are 0.5 μ M, template DNA 2.5ng adds aseptic ultrapure water to 50 μ l.PCR reaction parameter: 94 ℃ of pre-sex change 5min; 94 ℃ of sex change 30S, 57 ℃ of annealing 30S, 72 ℃ are extended 1min, 31 circulations; 72 ℃ are extended 8min; PCR is reflected on the MJ Rsearch PT200 thermal cycler and carries out.Reaction finishes the every sample 50 μ l in back, sepharose with 1% is in 1 * TAE (10mM Tris, pH 7.8, the 5mM sodium-acetate, 0.5mM electrophoresis EDTA), move to rinsing 5～10min in the clear water after then amplified production being soaked 10～15min in the solution that contains ethidium bromide (0.5 μ g/ml), under ultraviolet lamp, observe and with the photograph of Bio-rad gel imaging system, check.
3) fragment is reclaimed, carry out enzyme with corresponding enzyme EarI, PciI respectively and cut, the EarI enzyme is cut system: 10 * 4buffer2.0 μ l, and DNA 0.5 μ g, EarI enzyme 0.5 μ l adds aseptic ultrapure water to 20 μ l.The PciI enzyme is cut system: 10 * 3buffer, 2.0 μ l, and DNA 0.5 μ g, 100 * BSA, 0.2 μ l, PciI enzyme 0.5 μ l adds aseptic ultrapure water to 20 μ l.After enzyme is cut 10h, every sample is got 10 μ l, sepharose with 1.5% is in 1 * TAE (10mM Tris, pH 7.8, the 5mM sodium-acetate, 0.5mM electrophoresis EDTA), move to rinsing 5～10min in the clear water after then amplified production being soaked 10～15min respectively in the solution that contains ethidium bromide (0.5 μ g/ml), under ultraviolet lamp, observe and with the photograph of Bio-rad gel imaging system, check, cut out the fragment that existing two length are respectively 268bp and 101bp if carry out enzyme with enzyme EarI, Pyricularia oryzae genome then to be measured contains nontoxic gene Avr-Pit; Cut out the fragment that existing two length are respectively 472bp and 382bp if carry out enzyme with enzyme PciI, Pyricularia oryzae genome then to be measured contains nontoxic gene Avr-Pit.
Embodiment 2:
Primer CAPS77, CAPS88 among the embodiment 1 are increased in 65 filial generations, the PCR reaction system is identical with embodiment 1 with program, reaction finishes the every sample 50 μ l in back, sepharose with 1% is in 1 * TAE (10mM Tris, pH 7.8, the 5mM sodium-acetate, 0.5mM electrophoresis EDTA), move to rinsing 5～10min in the clear water after then amplified production being soaked 10～15min in the solution that contains ethidium bromide (0.5 μ g/ml), under ultraviolet lamp, observe and take a picture with the Bio-rad gel imaging system.Fragment is reclaimed, carry out enzyme with corresponding enzyme EarI, PciI and cut 10h rear electrophoresis observations.Cut out the fragment that existing two length are respectively 268bp and 101bp if carry out enzyme with enzyme EarI, Pyricularia oryzae genome then to be measured contains nontoxic gene Avr-Pit; Cut out the fragment that existing two length are respectively 472bp and 382bp if carry out enzyme with enzyme PciI, Pyricularia oryzae genome then to be measured contains nontoxic gene Avr-Pit.
The present invention screens altogether and obtains 2 closely linked molecule markers, carry out genetic linkage analysis according to chain exchange rule, utilize colony's genotype data to make up the genetic linkage maps of rice blast fungus, used software is JoinMap 3.0, minimum LOD value is made as 7, obtain genetic distance linkage map (see figure 3): CAPS mark CAPS77, CAPS88 and nontoxic gene Avr-Pit near the 1st fringes of chromosome are chain, and genetic distance is respectively 0.9cM and 2.7cM.The present invention not only can utilize the mark of this nontoxic gene to make probe, studies the distribution situation of this nontoxic gene in natural population, discloses germ colony toxicity and forms and the variation characteristics, and clone the starting point of this nontoxic gene as further physical mapping method.
Claims (7)
1. molecule marker primer that detects avirulence gene of rice blast Avr-Pit is characterized in that: its upstream primer sequence is as described in the SEQ ID No.1, and the downstream primer sequence is as described in the SEQ ID No.2.
2. molecule marker primer that detects avirulence gene of rice blast Avr-Pit is characterized in that: its upstream primer sequence is as described in the SEQ ID No.3, and the downstream primer sequence is as described in the SEQ ID No.4.
3. the molecular mark detection method of an avirulence gene of rice blast Avr-Pit, it is characterized in that: utilize the described primer amplification of claim 1 Pyricularia oryzae genomic dna to be measured, getting amplified production carries out enzyme with enzyme EarI and cuts, then endonuclease bamhi is carried out gel electrophoresis, if the fragment that two length are respectively 268bp and 101bp occurs, Pyricularia oryzae genome then to be measured contains nontoxic gene Avr-Pit.
4. detection method according to claim 3 is characterized in that: the EarI enzyme system of cutting is: 10 * 4buffer, 2.0 μ l, and DNA 0.5 μ g, EarI enzyme 0.5 μ l adds aseptic ultrapure water to 20 μ l.
5. the molecular mark detection method of an avirulence gene of rice blast Avr-Pit, it is characterized in that: utilize the described primer amplification of claim 2 Pyricularia oryzae genomic dna to be measured, getting amplified production carries out enzyme with enzyme PciI and cuts, then endonuclease bamhi is carried out gel electrophoresis, if the fragment that two length are respectively 472bp and 382bp occurs, Pyricularia oryzae genome then to be measured contains nontoxic gene Avr-Pit.
6. detection method according to claim 5 is characterized in that: the PciI enzyme system of cutting is: 10 * 3buffer, 2.0 μ l, and DNA 0.5 μ g, 100 * BSA, 0.2 μ l, PciI enzyme 0.5 μ l adds aseptic ultrapure water to 20 μ l.
7. according to each described detection method of claim 3 to 6, it is characterized in that: the PCR reaction system of the Pyricularia oryzae genomic dna to be measured that increases is: 10 * Ex Taq buffer, 5.0 μ l, MgCl
22mM, dNTPs 0.2mM, Ex Taq archaeal dna polymerase 1.25U, upper and lower primer respectively are 0.5 μ M, template DNA 2.5ng adds aseptic ultrapure water to 50 μ l; The PCR reaction parameter is: 94 ℃ of pre-sex change 5min; 94 ℃ of sex change 30S, 57 ℃ of annealing 30S, 72 ℃ are extended 1min, 31 circulations; 72 ℃ are extended 8min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010506165A CN101942521B (en) | 2010-10-14 | 2010-10-14 | Molecular marker detection method of rice blast bacterium non-toxic genes Avr-Pit and primers thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010506165A CN101942521B (en) | 2010-10-14 | 2010-10-14 | Molecular marker detection method of rice blast bacterium non-toxic genes Avr-Pit and primers thereof |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201210242542 Division CN102766691B (en) | 2010-10-14 | 2010-10-14 | Molecular markers for avirulence gene Avr-Pit of Pyricularia grisea |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101942521A true CN101942521A (en) | 2011-01-12 |
| CN101942521B CN101942521B (en) | 2012-09-05 |
Family
ID=43434727
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201010506165A Expired - Fee Related CN101942521B (en) | 2010-10-14 | 2010-10-14 | Molecular marker detection method of rice blast bacterium non-toxic genes Avr-Pit and primers thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101942521B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113744800A (en) * | 2021-06-09 | 2021-12-03 | 华南农业大学 | Technical system with inclusion and accurate identification and excavation of rice blast Pik disease-resistant allele family |
| CN117165711A (en) * | 2023-09-28 | 2023-12-05 | 江苏省农业科学院 | RPA-LFD primer probe group for detecting avirulence gene Avr-Piz-t, kit and application thereof |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110904124B (en) * | 2019-10-25 | 2020-12-11 | 华南农业大学 | Magnaporthe grisea avirulence gene AvrPit and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1952177A (en) * | 2006-09-28 | 2007-04-25 | 南京农业大学 | Molecular marker method for avirulence gene of rice blast |
-
2010
- 2010-10-14 CN CN201010506165A patent/CN101942521B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1952177A (en) * | 2006-09-28 | 2007-04-25 | 南京农业大学 | Molecular marker method for avirulence gene of rice blast |
Non-Patent Citations (2)
| Title |
|---|
| 《Mol Genet Genomics》 20070228 Chen QH,et al 《Molecular mapping of two cultivar-specific avirulence genes in the rice blast fungus Magnaporthe grisea》 139-148 1-4 第277卷, 第2期 2 * |
| 《中国生物工程杂志》 20061231 石军，等 《稻瘟病菌无毒基因研究进展》 112-116 1-4 第26卷, 第12期 2 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113744800A (en) * | 2021-06-09 | 2021-12-03 | 华南农业大学 | Technical system with inclusion and accurate identification and excavation of rice blast Pik disease-resistant allele family |
| CN117165711A (en) * | 2023-09-28 | 2023-12-05 | 江苏省农业科学院 | RPA-LFD primer probe group for detecting avirulence gene Avr-Piz-t, kit and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101942521B (en) | 2012-09-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103305510B (en) | Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof | |
| CN103320437B (en) | Gene-specific molecular marker Pi2SNP of rice blast-resistant gene Pi2 as well as preparation method and application thereof | |
| Singh et al. | Evaluation of microsatellite markers for genetic diversity analysis among sugarcane species and commercial hybrids | |
| Zhou et al. | Molecular mapping of leaf rust resistance gene LrNJ97 in Chinese wheat line Neijiang 977671 | |
| CN103146691B (en) | SNP loci linked with blight resistant gene Fon-1 in watermelon, and markers thereof | |
| CN101173311B (en) | Molecule marking method for gene locus for preventing mycosphaerella melonis of muskmelon | |
| CN102220430A (en) | Auxiliary screening method for stripe rust-resistance wheat and its special primers | |
| CN105154442A (en) | Indel mark of powdery mildew resistance allele er1-7 of peas and application thereof | |
| CN1952177A (en) | Molecular marker method for avirulence gene of rice blast | |
| CN101942521B (en) | Molecular marker detection method of rice blast bacterium non-toxic genes Avr-Pit and primers thereof | |
| CN102766691B (en) | Molecular markers for avirulence gene Avr-Pit of Pyricularia grisea | |
| CN101988064A (en) | Marker primer interlocked with wheat powdery mildew resistance gene PmHNK54 and application thereof | |
| CN104293774A (en) | Functional SSR labels obviously related with wood quality characters in populus CesAs gene, and applications and kit thereof | |
| CN110093435B (en) | Wheat SSR molecular marker primer and screening method thereof | |
| CN102031301B (en) | Molecular marking method for indica-japonica segment substitution of fertility loci of indica-japonica hybrid | |
| Zhou et al. | Identification of new sources of aluminum resistance in wheat | |
| CN100491541C (en) | Molecular mark closely linked to Sumai No.3 head blight resistance main effect QTL and its application | |
| CN113897457B (en) | KASP molecular marker linked with wheat stripe rust resistance QTL and application | |
| CN105349677B (en) | Recover round-grained rice Rice Resistance black streak dwarf site and molecule labelling method | |
| Keka et al. | Identifying simple sequence repeat (SSR) marker linked to mite tolerance in jute species | |
| Wang et al. | Genetic analysis and molecular mapping of leaf rust resistance genes in the wheat line 5R618 | |
| Jiang et al. | Mapping quantitative trait loci conferring resistance to Marssonina leaf spot disease in Populus deltoides | |
| CN105316423B (en) | Rice varieties recover the anti-black streak dwarf site qRBSDV18 of round-grained rice and its molecule labelling method | |
| CN116121433B (en) | KASP molecular marker for detecting wheat powdery mildew resistance and application thereof | |
| CN111073990B (en) | Dominant molecular marker of rice blast resistance gene Pi67(t) and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120905 Termination date: 20131014 |