CN1952177A - Molecular marker method for avirulence gene of rice blast - Google Patents
Molecular marker method for avirulence gene of rice blast Download PDFInfo
- Publication number
- CN1952177A CN1952177A CNA2006100964939A CN200610096493A CN1952177A CN 1952177 A CN1952177 A CN 1952177A CN A2006100964939 A CNA2006100964939 A CN A2006100964939A CN 200610096493 A CN200610096493 A CN 200610096493A CN 1952177 A CN1952177 A CN 1952177A
- Authority
- CN
- China
- Prior art keywords
- gene
- nontoxic
- mark
- avr
- pyricularia oryzae
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention of molecular labeling method of Pyricularia grisea avirulent gene belongs to the field of agricultural biotechnology. The molecular labeling technology includes performing molecular labeling to avirulent gene though assessment from two parental strains and filial generation groups of Pyricularia grisea. M355-356 labeled by SSR near NO. 1 chromosome telomere links with avirulent gene Avr-Pit with a genetic distance of 2.3cm; S487 labeled by RAPD located near NO. 7 chromosome telomere links with avirulent gene Avr-Pia with a genetic distance of 3.5cm; S361 labeled by m677-678 and RAPD located at middle of N0. 3 chromosome telomere links with Pyricularia grisea specified avirulent gene PRE1 with genetic distances of 5.9cm and 6.4. The invention can not only make use of the nontoxic gene marker as gene probe, but also set foundations for further clone of the gene through physical mapping.
Description
(1) technical field
This research has been invented Pyricularia oryzae (Magnaporthe grisea) at linkage molecule mark and chromosomal localization that the special nontoxic gene Avr-Pit of rice varieties, Avr-Pia and host plant special nontoxic gene PRE1, belongs to biological technical field.Be exclusively used in the monitoring of Pyricularia oryzae field toxicity composition and development law, can be used for the clone of avirulence gene of rice blast simultaneously.
(2) technical background
Paddy rice is one of important crops, and rice blast is that world's distribution is the widest, one of the most serious rice disease causes harm, (Ou S H.1980 to have become the major obstacle factor of rice high yield, stable yields, Pathogenvariability and host resistance in rice blast disease.Ann Rev Phytopathol.18:167-187.), human grain security in the positive serious threat of the harm that it causes.Control rice blast is also the same with other rice diseases, is by utilizing sterilant, and cultivation step carries out with the mode that the plantation disease-resistant variety combines, and the plantation disease-resistant variety is to prevent and treat one of most economical effective way of rice blast.Yet to carry out breeding for disease resistance work fruitfully, except seeking the good anti-source, also must further investigate and make mechanism etc. mutually between the mechanism of causing a disease of Pyricularia oryzae and paddy rice and the Pyricularia oryzae, and in pathogenic bacteria and host's coevolution process, pathogen virulence genomic constitution meeting changes along with the variation of host's disease-resistant gene composition, (Zeigler R S.1998 finally to cause the forfeiture of disease-resistant variety resistance, Recombination in Magnaporthe grisea.Annu RevPhytopathol, 36:249-275.).This interaction of research on molecular level not only otherwise broken hair is existing and utilize new disease-resistant gene, is carried out the analysis of rice varieties disease-resistant gene, with a plurality of disease-resistant genes mix use outside, also must analyze simultaneously the nontoxic gene in the rice blast fungus population.Excavate the nontoxic gene of Pyricularia oryzae more, the molecular mechanism that helps clear and definite Pyricularia oryzae and paddy rice to do mutually, in addition, recent result of study also shows, the toxicity group structure feature of research Pyricularia oryzae, disclose its variation law and dynamic, the rational deployment that also can be disease-resistant variety provides theoretical foundation with cultivation disease-resistant variety and disease control, thereby reaches the purpose of controlling this disease for a long time, effectively.
The method of forming (physiological strain) evaluation according to traditional Pyricularia oryzae toxicity is to identify that by the pathotype of differential variety dividing physiological strain studies population structure of Magnaporthe grisea from rice, can understand by this method that physiological strain in the rice blast fungus population is formed and the variation of dominant population, thereby it is dynamic to grasp population structure of Magnaporthe grisea from rice and heritable variation, but the physiological strain of dividing is often different because of differential variety, and workload is big, the result easily is subject to seasonal restrictions, the envrionment conditions artificial factor is difficult to accurately reflect population structure of Magnaporthe grisea from rice.
With seeing molecular genetics and development of molecular biology, fingerprinting technology on the dna level is (as MGR-RFLP, RAPD, rep-PCR) composition for research rice blast fungus population nontoxic gene provide efficiently, method fast, avoided the extensive work of identifying by the pathotype of differential variety.Therefore all pay much attention to the molecular marker screening work of avirulence gene of rice blast both at home and abroad.Utilize dna molecular marker to identify nontoxic gene (the Dioh W of more than 30 Pyricularia oryzae at present, et al.2000, Mapping of avirulence genes In theRice Blast Fungus, Magnaporthe Grisea with RFLP and RAPD Markers.Mol Plant-MicrobeInteract, 13:217-227), and cloned 5 nontoxic genes (Pw11, Pw12, Avr-C039, Avr-Pita and ACE1) by a figure position method, this is just for identifying that by molecule marker toxicity forms the convenient condition of having created.The chain molecule marker (the used molecule marker in especially early stage location) of some nontoxic genes is the RFLP mark mostly.Because this class mark needs complicated operations program, the biochemical reagents of costliness and the DNA of great amount of samples, be not easy to the toxicity compositional analysis of nontoxic gene.The molecule marker of PCR-based technology is then more convenient feasible, especially in recent years Pyricularia oryzae according to the up-to-date whole genome sequence of delivering (
Http:// www.broad.mit.edu/annotation/fungi/magnaporthe) the SSR mark that obtains, (simple sequence repeats SSR, Simple Sequence Repeats), claim microsatellite marker again, be based on a kind of novel molecular mark of PCR, it shows as codominance in genetic analysis, has higher polymorphism, also have simple to operate, advantages such as economical and effective, thereby, microsatellite marker is at molecular biology, genetics, research fields such as thremmatology are used widely, and (Kaye is development of simple sequence repeatmarkers for Magnaporthe grisea and their integration into an established genetic linkage map.Fungal Genetics and Biology C.2003.The, 40:207-214).The SSR mark has higher polymorphism, it is relatively stable that SSR is marked in the genetic map of different rice blast fungus combination the position, thereby between the collection of illustrative plates that makes the different experiments chamber finish certain reference is arranged, and make at test requirements document, improve different positions mark abundance fast and become possibility.In addition, announcement and continual renovation along with the rice blast fungus genome sequence, utilize the new microsatellite locus of the rice blast genome sequence search announced and be converted into the PCR mark and become very convenient, in addition because it is simple to operate, good reproducibility, be a kind of indicia means that is worthy to be popularized, can increase the PCR mark saturation ratio of target chromosome section greatly, thereby accelerate evaluation and clone's work of goal gene.
(3) summary of the invention
Technical problem the objective of the invention is to obtain with nontoxic gene Avr-Pit, Avr-Pia and PRE1 close linkage and molecule marker not affected by environment and carry out chromosomal localization by screening, and the toxicity composition of molecule marker and germ is closely connected.Each big rice district Pyricularia oryzae of comprehensive and systematic analysis China toxicity form and variation law, for the popularization of disease-resistant variety in the planted in different ecological areas provides guidance, simultaneously as the starting point of cloning these 3 nontoxic genes.
Molecule marker, location that technical scheme avirulence gene of rice blast Avr-Pit, Avr-Pia and PRE1 are chain obtain by the following method:
1) (parent strain is public to utilize two cover parent Guy11 and JS153, CH87 and 6023, Agricultural University Of Nanjing plants disease system and preserves bacterial strain, guaranteeing externally provided in 20 years) hybridize the acquisition sexual progeny, the pathogenic mensuration on paddy rice differential variety Aichi-asahi, K59 and Lijiang xintuanheigu with parent and offspring's bacterial strain, by the poisonous and nontoxic reaction of bacterial strain on differential variety, identify corresponding nontoxic gene Avr-Pia, Avr-Pit and PRE1;
2) adopt to contain 100 pairs of SSR molecule markers of SSR mark m355-356, SCAR mark S487F/R, m363-364, m677-678 and to contain the molecule marker that 228 RAPD primer amplifications of RAPD mark S361 obtain and carry out the screening of nontoxic gene linked marker in conjunction with population mixture partition method (BSA).The PCR response procedures of SSR mark is: 10 * PCR buffer, 2.0 μ l, MgCl
21.5mM, dNTPs, 0.1mM, TaqDNA polysaccharase 1.0U, primer respectively are 0.5 μ M, template DNA 10ng adds aseptic ultrapure water to 20 μ l.PCR reaction parameter: 94 ℃ of sex change 30S; 94 ℃ of sex change 30S, 53 (55) ℃ of annealing 30S, 72 ℃ are extended 30S, 25 circulations; 72 ℃ are extended 8min; PCR is reflected on the MJ Rsearch PT200 thermal cycler and carries out.Amplified production 3% agarose gel electrophoresis, with the dyeing of 0.5 μ g/ml ethidium bromide solution, ultraviolet lamp is observed down and is taken a picture with the Bio-rad gel imaging system; The RAPD response procedures is: 10 * PCR buffer2.5 μ l, MgCl
21.5mM, dNTPs50 μ M, random primer 0.3 μ M, template DNA 10ng, Taq archaeal dna polymerase 1U adds aseptic ultrapure water to 25 μ l, after reaction added the paraffin oil covering, (MJ Research) increased by following program on PTC-200 type PCR instrument: 95 ℃ of pre-sex change 2.5min; And carry out 95 ℃ of sex change 1min continuously, and 35 ℃ of annealing 1min, 72 ℃ are extended 1min 30sec totally 45 circulations; 72 ℃ are extended 15min.Reaction finishes the every sample in back and gets 10 μ l, sepharose with 1% is in 1 * TAE (10mMTris, pH7.8, the 5mM sodium-acetate, 0.5mM electrophoresis EDTA), move to rinsing 5～10min in the clear water after then amplified production being soaked 10～15min respectively in the solution that contains ethidium bromide (0.5 μ g/ml), under ultraviolet lamp, observe and take a picture with the Bio-rad gel imaging system.
3) adopt population mixture partition method bulked segregation analysis (BSA) (Michelmore, et al.1991.Identification of markers linked to disease-resistance genes by bulked segregationanalysis:A rapid method to detect markers in specific genomic regions by usingsegregating population.Proc.Natl.Acad.Sci.USA.88:9828-9832.) screening obtains and the chain RAPD mark of nontoxic gene, labeled fragment is reclaimed, order-checking, the design special primer is converted into more stable SCAR mark.The PCR response procedures of SCAR mark is DNA 30ng, and dNTPs 0.1 μ M, primer respectively are 0.5 μ M, 1.5UTaq archaeal dna polymerase, 2.5 μ l10 * amplified reaction damping fluid, MgCl
21.5mM, add aseptic ultrapure water to 25 μ l.After reaction added the paraffin oil covering, (MJResearch) increased by following program on PTC-200 type PCR instrument: 95 ℃ of pre-sex change 2.5min; And carry out 95 ℃ of sex change 1min continuously, and 60 ℃ of annealing 1min, 72 ℃ are extended 1min 30sec totally 35 circulations; 72 ℃ are extended 10min.Reaction finishes the every sample in back and gets 10 μ l, sepharose with 1% is in 1 * TAE (10mM Tris, pH7.8, the 5mM sodium-acetate, 0.5mM electrophoresis EDTA), move to rinsing 5～10min in the clear water after then amplified production being soaked 10～15min respectively in the solution that contains ethidium bromide (0.5 μ g/ml), under ultraviolet lamp, observe and take a picture with the Bio-rad gel imaging system.
4) with SSR, the RAPD-BSA toxicity test in conjunction with bacterial strain, carry out genetic linkage analysis, screening obtains altogether
5 closely linked molecule markers:
SSR mark m355-356 and nontoxic gene Avr-Pit near the 1st fringes of chromosome are chain, and genetic distance is 2.3cM;
It is chain to be positioned the 7th fringes of chromosome neighbouring SCAR mark S487F/R, m363-364 and nontoxic gene Avr-Pia, and genetic distance is respectively 3.5cM and 4.6cM;
SSR mark m677-678, RAPD mark S361 and the Pyricularia oryzae specific specificity nontoxic gene PRE1 at the 3rd chromosomal middle part are chain, and genetic distance is respectively 5.9cM and 6.4cM.
The present invention not only can utilize the mark of this nontoxic gene to make probe, studies the distribution situation of this nontoxic gene in natural population, discloses germ colony toxicity and forms and the variation characteristics, and clone the starting point of this nontoxic gene as further physical mapping method.
Beneficial effect the present invention uses labeling techniques such as SSR, RAPD, SCAR, make up and located the genetic map of rice blast fungus nontoxic gene Avr-Pia and Avr-Pit, obtained and the closely linked molecule marker of nontoxic gene, up to now, do not appear in the newspapers as yet both at home and abroad about the molecule marker location of avirulence gene of rice blast Avr-Pia and Avr-Pit and specific specificity nontoxic gene PRE1.By obtaining and the closely linked molecule marker of avirulence gene of rice blast, not only can utilize the mark of this nontoxic gene to make probe, study the distribution situation of this nontoxic gene in natural population, disclose germ colony toxicity and form and the variation characteristics, and clone this nontoxic gene for further physical mapping method and lay the foundation.This research and utilization molecular marking technique has been located 3 nontoxic genes of Pyricularia oryzae.
The present invention adopts two cover parent hybridization simultaneously, obtains the molecular marker screening of sexual hybridization group expansion nontoxic gene, and carries out chromosomal localization, compares with existing molecular marking technique, and its advantage and positively effect show:
(1) mark is stable: the nontoxic gene molecule marker that the present invention obtains is the SSR mark, and RAPD is converted into more reliable and stable SCAR mark, and these chain molecule markers are stable, is not subject to the influence of reaction system, condition, DNA concentration.
(2) save time and cost: the traditional method that rice blast fungus population toxicity is formed monitoring is to identify that by the pathotype of differential variety dividing physiological strain studies population structure of Magnaporthe grisea from rice, can understand by this method that physiological strain in the rice blast fungus population is formed and the variation of dominant population, thereby it is dynamic to grasp population structure of Magnaporthe grisea from rice and heritable variation, but identify and be subjected to the restriction in season, the physiological strain of dividing is often different because of differential variety, and the result is subject to the envrionment conditions artificial factor, accuracy is low, is difficult to accurately reflect population structure of Magnaporthe grisea from rice.What filter out by the present invention is not affected by environment with the closely linked molecule marker of nontoxic gene, and target is decided nontoxic gene exactly, saves plenty of time and cost, composition, distribution and the development law of real-time analysis field avirulence gene of rice blast.
SSR primer, RAPD primer and SCAR primer sequence, annealing temperature and amplified fragments.
| Mark | The primer numbering | Primer sequence | Karyomit(e) | Tm | The product size |
| SSR | ms355-356 | AACCCTCCGTGCACCTTAG | I | 55 | 292 |
| GCTTCTTCTCGCTTGCTGTT | |||||
| ms363-364 | TCTCGGGAAGCTGATTGAGT | VII | 55 | 285 | |
| CTAACGGCCGGCTAACAAAC | |||||
| m677-678 | TCGTGAGGGTTCCTATCTGC | III | 55 | 255 | |
| GACCTTTATCGGATGCGTGT | |||||
| RAPD | S487 | CCCCGATGGT | 42 | ||
| S361 | CATTCGAGCC | 42 | |||
| SCAR | S487F/R | TGGTATTGTTCGCGTTGATATG | 60 | 306 | |
| CCCCGATGGTCTAATATACG |
(4) description of drawings
Fig. 1 electrophoresis detection is by the result of SSR primer m677-678 amplification Pyricularia oryzae parent strain and part filial generation genomic dna product.23 swimming lanes and 24 swimming lanes are parent strain, and other swimming lanes are filial generation;
Fig. 2 RAPD primer S361 is to CH87 and 6023 and sexual progeny amplification electrophoretogram.Arrow is represented the labeled fragment chain with nontoxic gene; A: avirulent strains, V: toxic strain, R: reorganization is individual; M:marker.
Fig. 3 SCAR primer S487F/S487R is to Pyricularia oryzae parent and sexual progeny amplification electrophoretogram thereof.Arrow is represented the labeled fragment chain with nontoxic gene Avr-Pia; A: avirulent strains, V: toxic strain, R: reorganization is individual; M:100bp ladder marker;
The partial linkage genetic map of Fig. 4 nontoxic gene Avr-Pit and Avr-Pia
The partial linkage genetic map of the special nontoxic gene PRE1 of Fig. 5 rice blast bacterial classification
Five, embodiment
The molecule marking method that avirulence gene of rice blast Avr-Pit, Avr-Pia and PRE1 are chain comprises:
1) utilize two cover parent Guy11 and JS153, CH87 and 6023, parent strain is public (Chen Qinghe, Wang Yuanchao, Zheng Xiaobo.The difference of Pyricularia oryzae mating type distribution of the main rice district of China and fertility ability thereof, Scientia Agricultura Sinica 2004,37 (6): 840-845) the sick worm monitoring of the Ministry of Agriculture externally provides with improvement key lab, hybridize the acquisition sexual progeny, (Aichi-asahi, K59 and Lijiang xintuanheigu kind are public at paddy rice differential variety Aichi-asahi, K59 and Lijiang xintuanheigu with parent and offspring's bacterial strain, the sick worm monitoring of the Ministry of Agriculture externally provides with improvement key lab,) go up pathogenic mensuration, method and kind document: the Lu Fan etc. that see reference.The toxicity diversity of Jiangsu Province's Pyricularia oryzae and the disease resistance of rice varieties, species diversity, 2001,9 (3): 201-206 by the poisonous and nontoxic reaction of bacterial strain on differential variety, identifies corresponding nontoxic gene Avr-Pia, Avr-Pit and PRE1;
2) adopt to contain 100 pairs of SSR molecule markers of SSR mark m355-356, SCAR mark S487F/R, m363-364, m677-678 etc. and to contain the molecule marker that 228 RAPD primer amplifications of RAPD mark S361 obtain and carry out the screening of nontoxic gene linked marker in conjunction with population mixture partition method (BSA).The PCR response procedures of SSR mark is: 10 * PCR buffer, 2.0 μ l, MgCl
21.5mM, dNTPs, 0.1mM, Taq archaeal dna polymerase 1.0U, primer respectively are 0.5 μ M, template DNA 10ng adds aseptic ultrapure water to 20 μ l.PCR reaction parameter: 94 ℃ of sex change 30S; 94 ℃ of sex change 30S, 53 (55) ℃ of annealing 30S, 72 ℃ are extended 30S, 25 circulations; 72 ℃ are extended 8min; PCR is reflected on the MJ Rsearch PT200 thermal cycler and carries out.Amplified production 3% agarose gel electrophoresis, with the dyeing of 0.5 μ g/ml ethidium bromide solution, ultraviolet lamp is observed down and is taken a picture with the Bio-rad gel imaging system; The RAPD response procedures is: 10 * PCRbuffer, 2.5 μ l, MgCl
21.5mM, dNTPs50 μ M, random primer 0.3 μ M, template DNA 10ng, Taq archaeal dna polymerase 1U adds aseptic ultrapure water to 25 μ l, after reaction added the paraffin oil covering, (MJ Research) increased by following program on PTC-200 type PCR instrument: 95 ℃ of pre-sex change 2.5min; And carry out 95 ℃ of sex change 1min continuously, and 35 ℃ of annealing 1min, 72 ℃ are extended 1min 30sec totally 45 circulations; 72 ℃ are extended 15min.Reaction finishes the every sample in back and gets 10 μ l, sepharose with 1% is in 1 * TAE (10mM Tris, pH7.8, the 5mM sodium-acetate, 0.5mM electrophoresis EDTA), move to rinsing 5～10min in the clear water after then amplified production being soaked 10～15min respectively in the solution that contains ethidium bromide (0.5 μ g/ml), under ultraviolet lamp, observe and take a picture with the Bio-rad gel imaging system.
3) adopt population mixture partition method (BSA) screening to obtain and the chain RAPD mark of nontoxic gene, labeled fragment is reclaimed, order-checking, the design special primer (S487F:5 '-TGGTATTGTTCGCGTTGATATG-3 '; S487R:CCCCGATGGTCTAATATACG), be converted into more reliable and more stable SCAR mark.The PCR response procedures of SCAR mark is DNA 30ng, and dNTPs 0.1 μ M, primer respectively are 0.5 μ M, 1.5UTaq archaeal dna polymerase, 2.5 μ l10 * amplified reaction damping fluid, MgCl
21.5mM, add aseptic ultrapure water to 25 μ l.After reaction added the paraffin oil covering, (MJ Research) increased by following program on PTC-200 type PCR instrument: 95 ℃ of pre-sex change 2.5min; And carry out 95 ℃ of sex change 1min continuously, and 60 ℃ of annealing 1min, 72 ℃ are extended 1min 30sec totally 35 circulations; 72 ℃ are extended 10min.Reaction finishes the every sample in back and gets 10 μ l, sepharose with 1% is in 1 * TAE (10mM Tris, pH7.8, the 5mM sodium-acetate, 0.5mMEDTA) middle electrophoresis, move to rinsing 5～10min in the clear water after then amplified production being soaked 10～15min respectively in the solution that contains ethidium bromide (0.5 μ g/ml), under ultraviolet lamp, observe and with the photograph of Bio-rad gel imaging system, the result can obtain the specific fragment of a 306bp.
4) 5 closely linked molecule markers of screening acquisition carry out genetic linkage analysis according to chain exchange rule altogether, utilize colony's genotype data to make up the genetic linkage maps of rice blast fungus, used software is Mapmaker3.0, and minimum LOD value is made as 3, obtains the genetic distance linkage map:
SSR mark m355-356 and nontoxic gene Avr-Pit near the 1st fringes of chromosome are chain, and genetic distance is 2.3cM;
It is chain to be positioned the 7th fringes of chromosome neighbouring SCAR mark S487F/R, m363-364 and nontoxic gene Avr-Pia, and genetic distance is respectively 3.5cM and 4.6cM;
SSR mark m677-678, RAPD mark S361 and the Pyricularia oryzae specific specificity nontoxic gene PRE1 at the 3rd chromosomal middle part are chain, and genetic distance is respectively 5.9cM and 6.4cM.
SSR primer, RAPD primer and SCAR primer sequence, annealing temperature and amplified fragments.
| Mark | The primer numbering | Primer sequence (5 '-3 ') | Karyomit(e) | Tm | The product size |
| SSR | ms355-356 | AACCCTCCGTGCACCTTAG | I | 55 | 292 |
| GCTTCTTCTCGCTTGCTGTT | |||||
| ms363-364 | TCTCGGGAAGCTGATTGAGT | VII | 55 | 285 |
| CTAACGGCCGGCTAACAAAC | |||||
| m677-678 | TCGTGAGGGTTCCTATCTGC | III | 55 | 255 | |
| GACCTTTATCGGATGCGTGT | |||||
| RAPD | S487 | CCCCGATGGT | 42 | ||
| S361 | CATTCGAGCC | 42 | |||
| SCAR | S487F | TGGTATTGTTCGCGTTGATATG | 60 | 306 | |
| S487R | CCCCGATGGTCTAATATACG |
The present invention not only can utilize the mark of this nontoxic gene to make probe, studies the distribution situation of this nontoxic gene in natural population, discloses germ colony toxicity and forms and the variation characteristics, and clone the starting point of this nontoxic gene as further physical mapping method.
Claims (2)
1, the molecule marking method of avirulence gene of rice blast is characterized in that:
Use labeled primer ms355-356,
Left end primer sequence AACCCTCCGTGCACCTTAG
Right-hand member primer sequence GCTTCTTCTCGCTTGCTGTT
Amplification Pyricularia oryzae DNA if can amplify the amplified fragments of 292bp, then indicates the existence of avirulence gene of rice blast Avr-Pit, this nontoxic gene is positioned near the 1st fringes of chromosome, utilize software Mapmaker3.0, minimum LOD value is made as 3, and acquisition is 2.3cM with the genetic distance of mark;
Perhaps use labeled primer S487F/R,
Left end primer sequence TGGTATTGTTCGCGTTGATATG
Right-hand member primer sequence CCCCGATGGTCTAATATACG
Amplification Pyricularia oryzae DNA if can amplify the amplified fragments of 306bp, then indicates the existence of avirulence gene of rice blast Avr-Pia, this nontoxic gene is positioned near the 7th fringes of chromosome, utilize software Mapmaker3.0, minimum LOD value is made as 3, and acquisition is 3.5cM with the genetic distance of mark;
Perhaps use labeled primer ms363-364,
Left end primer sequence TCTCGGGAAGCTGATTGAGT
Right-hand member primer sequence CTAACGGCCGGCTAACAAAC
Amplification Pyricularia oryzae DNA if can amplify the amplified fragments of 285bp, then indicates the existence of avirulence gene of rice blast Avr-Pia, this nontoxic gene is positioned near the 7th fringes of chromosome, utilize software Mapmaker3.0, minimum LOD value is made as 3, and acquisition is 4.6cM with the genetic distance of mark;
Perhaps use labeled primer ms677-678,
Left end primer sequence TCGTGAGGGTTCCTATCTGC
Right-hand member primer sequence GACCTTTATCGGATGCGTGT
Amplification Pyricularia oryzae DNA if can amplify the amplified fragments of 255bp, then indicates the existence of Pyricularia oryzae specific specificity nontoxic gene PRE1, this nontoxic gene is positioned at the 3rd karyomit(e) middle part, utilize software Mapmaker3.0, minimum LOD value is made as 3, and acquisition is 5.9cM with the genetic distance of mark;
2, the molecule marking method of avirulence gene of rice blast according to claim 1, the screening process of its molecule marker is as follows:
1) utilize two cover parent Guyll and JS153, CH87 and 6023 to hybridize the acquisition sexual progeny, the pathogenic mensuration on paddy rice differential variety Aichi-asahi, K59 and Lijiang xintuanheigu with parent and offspring's bacterial strain, by the poisonous and nontoxic reaction of bacterial strain on differential variety, concern according to gene-for-gene theory, when showing as on the differential variety of bacterial strain at known resistant gene when nontoxic, identify this bacterial strain and contain the nontoxic gene of this disease-resistant gene correspondence, identify corresponding nontoxic gene Avr-Pia, Avr-Pit and PRE1;
2) extract Pyricularia oryzae parent and filial generation bacterial strain DNA with the CTAB method, the molecule marker that adopts SSR molecule marker and RAPD primer amplification to obtain carries out the polymorphism screening in conjunction with population mixture partition method (BSA) to the parent, PCR carries out on MJ-200 amplification instrument, amplified production carries out the electrophoretic separation analysis on 3% sepharose, according to the molecular marker screening result, filter out polymorphic primer is arranged between the parent, there is polymorphic primer in filial generation colony, to analyze between the parent, the pcr amplification program is the same, obtains colony's genotype data;
3) according to chain exchange rule, utilize colony's genotype data to make up the genetic map of avirulence gene of rice blast, used software is Mapmaker3.0, minimum LOD value is made as 3, obtains linkage map;
4) paddy rice differential variety Aichi-asahi, K59 and Lijiang xintuanheigu four leaves are wholeheartedly inoculated Pyricularia oryzae seedling stage, and Pyricularia oryzae parent and offspring's bacterial strain thereof are carried out the toxicity evaluation, obtain parent and filial generation toxicity phenotype;
5) utilize Mapmaker3.0 software that colony's genotype data of each molecule marker and Pyricularia oryzae parent and the filial generation toxicity phenotype corresponding with it are carried out linkage analysis, minimum LOD value is made as 3, carry out genetic linkage analysis according to chain exchange rule, obtain the genetic distance linkage map, screening obtains 5 closely linked molecule markers altogether: SSR mark m355-356 and nontoxic gene Avr-Pit near the 1st fringes of chromosome are chain, and genetic distance is 2.3cM; It is chain to be positioned the 7th fringes of chromosome neighbouring SCAR mark S487F/R, m363-364 and nontoxic gene Avr-Pia, genetic distance is respectively 3.5cM and 4.6cM: SSR mark m677-678, RAPD mark S361 and the Pyricularia oryzae specific specificity nontoxic gene PRE1 at the 3rd chromosomal middle part are chain, and genetic distance is respectively 5.9cM and 6.4cM.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2006100964939A CN1952177A (en) | 2006-09-28 | 2006-09-28 | Molecular marker method for avirulence gene of rice blast |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2006100964939A CN1952177A (en) | 2006-09-28 | 2006-09-28 | Molecular marker method for avirulence gene of rice blast |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1952177A true CN1952177A (en) | 2007-04-25 |
Family
ID=38058733
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2006100964939A Pending CN1952177A (en) | 2006-09-28 | 2006-09-28 | Molecular marker method for avirulence gene of rice blast |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1952177A (en) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101942521A (en) * | 2010-10-14 | 2011-01-12 | 南京农业大学 | Molecular marker detection method of rice blast bacterium non-toxic genes Avr-Pit and primers thereof |
| CN102703443A (en) * | 2012-05-23 | 2012-10-03 | 华南农业大学 | Functional specific molecular marker of rice blast resistance gene Pia and method and application thereof |
| CN102766691A (en) * | 2010-10-14 | 2012-11-07 | 南京农业大学 | Molecular markers for avirulence gene Avr-Pit of Pyricularia grisea |
| CN102051368B (en) * | 2010-02-02 | 2012-12-19 | 华南农业大学 | Rice blast resistance gene Pik and application thereof |
| CN104328114A (en) * | 2014-10-23 | 2015-02-04 | 华南农业大学 | Magnaporthe oryzae avirulence gene AvrPib specific molecular marker, and method and application thereof |
| CN105063030A (en) * | 2015-08-04 | 2015-11-18 | 苏州市种子管理站 | ISSR-SCAR marker for identifying Suyunuo and screening method thereof |
| CN108707687A (en) * | 2018-05-30 | 2018-10-26 | 河北省农林科学院谷子研究所 | A kind of PCR Testing and appraisal methods that can distinguish millet blast bacterium and Pyricularia oryzae |
| CN110904124A (en) * | 2019-10-25 | 2020-03-24 | 华南农业大学 | Magnaporthe grisea avirulence gene AvrPit and application thereof |
-
2006
- 2006-09-28 CN CNA2006100964939A patent/CN1952177A/en active Pending
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102051368B (en) * | 2010-02-02 | 2012-12-19 | 华南农业大学 | Rice blast resistance gene Pik and application thereof |
| CN101942521A (en) * | 2010-10-14 | 2011-01-12 | 南京农业大学 | Molecular marker detection method of rice blast bacterium non-toxic genes Avr-Pit and primers thereof |
| CN102766691A (en) * | 2010-10-14 | 2012-11-07 | 南京农业大学 | Molecular markers for avirulence gene Avr-Pit of Pyricularia grisea |
| CN102766691B (en) * | 2010-10-14 | 2013-11-06 | 南京农业大学 | Molecular markers for avirulence gene Avr-Pit of Pyricularia grisea |
| CN102703443A (en) * | 2012-05-23 | 2012-10-03 | 华南农业大学 | Functional specific molecular marker of rice blast resistance gene Pia and method and application thereof |
| CN102703443B (en) * | 2012-05-23 | 2014-09-24 | 华南农业大学 | Functional specific molecular marker of rice blast resistance gene Pia and method and application thereof |
| CN104328114A (en) * | 2014-10-23 | 2015-02-04 | 华南农业大学 | Magnaporthe oryzae avirulence gene AvrPib specific molecular marker, and method and application thereof |
| CN105063030A (en) * | 2015-08-04 | 2015-11-18 | 苏州市种子管理站 | ISSR-SCAR marker for identifying Suyunuo and screening method thereof |
| CN108707687A (en) * | 2018-05-30 | 2018-10-26 | 河北省农林科学院谷子研究所 | A kind of PCR Testing and appraisal methods that can distinguish millet blast bacterium and Pyricularia oryzae |
| CN108707687B (en) * | 2018-05-30 | 2021-04-27 | 河北省农林科学院谷子研究所 | PCR detection and identification method capable of distinguishing blast bacteria and rice blast bacteria |
| CN110904124A (en) * | 2019-10-25 | 2020-03-24 | 华南农业大学 | Magnaporthe grisea avirulence gene AvrPit and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Singh et al. | Evaluation of microsatellite markers for genetic diversity analysis among sugarcane species and commercial hybrids | |
| CN103320437B (en) | Gene-specific molecular marker Pi2SNP of rice blast-resistant gene Pi2 as well as preparation method and application thereof | |
| CN1952177A (en) | Molecular marker method for avirulence gene of rice blast | |
| Guidot et al. | The nuclear ribosomal DNA intergenic spacer as a target sequence to study intraspecific diversity of the ectomycorrhizal basidiomycete Hebeloma cylindrosporum directly on Pinus root systems | |
| CN103146691B (en) | SNP loci linked with blight resistant gene Fon-1 in watermelon, and markers thereof | |
| CN103305510A (en) | Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof | |
| CN109913577B (en) | Molecular marker closely linked with wheat stripe rust resistance gene Yr1152 and application thereof | |
| CN102220430A (en) | Auxiliary screening method for stripe rust-resistance wheat and its special primers | |
| Habib et al. | Near-isogenic lines developed for a major QTL on chromosome arm 4HL conferring Fusarium crown rot resistance in barley | |
| CN102140506B (en) | Molecular marker linked with gummy stem blight resistance gene Gsb-2 and application thereof | |
| Valenzuela et al. | Identification of aphid species (Hemiptera: Aphididae: Aphidinae) using a rapid polymerase chain reaction restriction fragment length polymorphism method based on the cytochrome oxidase subunit I gene | |
| Pester et al. | Genetic diversity of jointed goatgrass (Aegilops cylindrica) determined with RAPD and AFLP markers | |
| CN109913582A (en) | A kind of molecular labeling and its application with resistance gene of rice blast close linkage | |
| CN104293774A (en) | Functional SSR labels obviously related with wood quality characters in populus CesAs gene, and applications and kit thereof | |
| Larsen et al. | Development of a real-time polymerase chain reaction assay for quantifying Verticillium albo-atrum DNA in resistant and susceptible alfalfa | |
| CN116200528B (en) | SNP molecular marker linked with wheat stripe rust resistance gene QYr.sicau. -2BL and application thereof | |
| CN102766691B (en) | Molecular markers for avirulence gene Avr-Pit of Pyricularia grisea | |
| Patzoldt et al. | Localization of a quantitative trait locus providing brown stem rot resistance in the soybean cultivar Bell | |
| Krishnamoorthy et al. | Molecular markers for the identification and diversity analysis of arbuscular mycorrhizal fungi (AMF) | |
| KR102024212B1 (en) | Composition for selecting variety resistant to rice bakanae disease containing qBK1WD gene comprising DNA marker and method for selecting variety resistant to rice bakanae disease using DNA marker | |
| CN101942521B (en) | Molecular marker detection method of rice blast bacterium non-toxic genes Avr-Pit and primers thereof | |
| CN100491541C (en) | Molecular mark closely linked to Sumai No.3 head blight resistance main effect QTL and its application | |
| CN113897457B (en) | KASP molecular marker linked with wheat stripe rust resistance QTL and application | |
| Karatas et al. | Genetic characterization of grapevine germplasm (Vitis vinifera L.) by SSR (simple sequence repeats) in Sanliurfa province, South-East Turkey | |
| Castillo et al. | Molecular variability among isolates of Mycosphaerella graminicola, the causal agent of septoria tritici blotch, in Argentina |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |