CN101988064A - Marker primer interlocked with wheat powdery mildew resistance gene PmHNK54 and application thereof - Google Patents
Marker primer interlocked with wheat powdery mildew resistance gene PmHNK54 and application thereof Download PDFInfo
- Publication number
- CN101988064A CN101988064A CN 201010572276 CN201010572276A CN101988064A CN 101988064 A CN101988064 A CN 101988064A CN 201010572276 CN201010572276 CN 201010572276 CN 201010572276 A CN201010572276 A CN 201010572276A CN 101988064 A CN101988064 A CN 101988064A
- Authority
- CN
- China
- Prior art keywords
- pmhnk54
- labeled primer
- powdery mildew
- gene
- wheat
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a marker primer interlocked with a wheat powdery mildew resistance gene PmHNK54 and application thereof in molecular marker-assisted selection. The sequence of the marker primer on a genetic map is Xbarc5, PnHNK54 and Xgwm312, and the genetic distances between Xbarc5 and PnHNK54 and between Xgwm312 and PnHNK54 are respectively 5.0cM and 6.0cM. 10 mu l of PCR (Polymerase Chain Reaction) reaction system during SSR (Simple Sequence Repeat) marker selection comprises 1 mu l of 10*buffer, 0.2 mu L of 10nM/mu l dNTP, 0.2 mu l of 20u M/mu L primer, 0.1 mu l of 5U/mu lTaq enzyme, 8.1 mu l of deionized water and 0.4 mu l of 20 ng/mu l genome DNA. An amplification procedure comprises the following steps of: pre-denaturing at 94 DEG C for 3 min, denaturing at 94 DEG C for 1 min, renaturing at 55 or 60 DEG C for 1 min, extending at 72 DEG C for 2 min, and repeating for 40 cycles; extending at 72 DEG C for 10 min; and performing 6% denaturing polyacrylamide gel electrophoresis or 8% nondenaturing polyacrylamide gel electrophoresis on amplification products, observing and taking pictures after silver nitrate dyeing. The invention finds the position of the powdery mildew resistance gene PmHNK54 in wheat parent material Zheng 9754, has the advantages of strong marker specificity, high stability, cost saving and high selection efficiency and is applicable to large scale, high throughput and automation.
Description
Technical field
The present invention relates to the labeled primer of powdery mildew resistance gene in wheat, belong to the molecular genetics field, particularly relate to and the wheat powdery mildew disease-resistant gene
PmHNK54Closely linked labeled primer and the application in molecular mark thereof.
Background technology:
Wheat powdery mildew be by wheat powdery mildew [
Blumeria graminis(DC)
SpeerF. sp.
Tritici, abbreviate as
Bgt] caused a kind of gas passes the property fungal disease, is one of main disease of each main Mai Qu of the world, and the morbidity scope enlarges day by day, hazard rating constantly increases the weight of, and can cause 13.4%～34% production loss.Seed selection and use efficient disease-resistance kind are most economical, safe and effective terms of settlement, according to " gene pairs gene " hypothesis, the toxicity microspecies of its resistance all can appear overcoming in any disease-resistant gene, vice versa, the two is the relation of coevolution, and promptly a new disease-resistant gene is after application after a while, and the toxicity microspecies that just have at it occur, make it lose disease resistance gradually, cause heavy losses to Wheat Production.Therefore, excavate the new anti-source of Powdery Mildew and become very urgent task of present wheat anti-powdery mildew breeding work.
Up to the present, international wheat cdna NK altogether definite designation from 61 powdery mildew disease-resistant genes in 43 sites (powdery mildew,
Pm) (
Pm1-
Pm43), wherein 35 disease-resistant genes have found chain or common isolating molecule marker.In recent years, molecule marker plotting technique development rapidly, and is the most extensive with simple repeated sequence mark (SSR), amplification length polymorphism mark (AFLP) and sequence tagged site (STS) tag application that transformed by restriction fragment length polymorphism mark (RFLP) in numerous molecule marker types.The new constructed genetic map of excavating of powdery mildew disease-resistant gene substantially all is this three classes mark of using.
Flourish along with wheat cdna group research, the quantity of information of expressed sequence tag (EST) database presents exponential growth, the EST sequence (http://www.ncbi.nlm.nih.gov/dbEST/index.html) of wheat EST database login surpasses 1 by in November, 2008,250, article 932,, while EST-SSR advantages such as cost is low because of having, specificity is good, for new marker development provides abundant sequence resource, become a new direction of SSR mark development.
The wheat sibling species belong to as one grained wheat, emmer wheat, aegilops tauschii etc. become the very important source of the new disease-resistant gene of Powdery Mildew (
Pm30-Pm37, Pm41-Pm43), these disease-resistant genes mostly are the quality resistance, and the physiological strain of current popular is had resistance preferably.But the anti-source of this class is often linked with disadvantageous economical character, when importing Cultivar as anti-source, the offspring need backcross through too much generation and break chain with unfavorable gene, that have even still can't break this chainly after too much generation backcrosses, this has restricted this type of application of anti-source in breeding to a great extent.
Summary of the invention:
The technical problem to be solved in the present invention: provide a kind of and the wheat powdery mildew resistant gene
PmHNK54Closely linked mark and application thereof, by the molecule marker of excavating, first the new gene of powder mildew resistance among wheat parent material Zheng 9754 is carried out chromosomal localization, make up its linkage map simultaneously, for the application of this gene in wheat white powder breeding for disease resistance provides anti-source material and theoretical the support.
Technical scheme of the present invention:
With the wheat powdery mildew resistant gene
PmHNK54Chain labeled primer, the nucleotides sequence of described labeled primer is classified as:
Labeled primer Xbarc5,
P1：5’-GCGCCTGGACCGGTTTTCTATTTT-3’，
P2：5’-GCGTTGGGAATTCCTGAACATTTT?-3’，
Perhaps labeled primer Xgwm312,
P3：5’-ATCGCATGATGCACGTAGAG?-3’，
P4：5’-ACATGCATGCCTACCTAATGG?-3’。
The order of described labeled primer on genetic map be Xbarc5,
PmHNK54,Xgwm312, described labeled primer Xbarc5 and gene
PmHNK54Genetic distance be 5.0cM, described labeled primer Xgwm312 with
PmHNK54Genetic distance be 6.0 cM.
Response procedures when labeled primer is used for the SSR label screening is:
(1) PCR reaction:
Described PCR reaction system is 10 μ l, contains 10 * buffer, 1 μ l, 10 mM/ μ l dNTP, 0.2 μ L, 20 uM/ μ L primers, 0.2 μ l, 5 U/ul Taq enzyme 0.1ul, deionized water 8.1 μ l, 20 ng/ μ l genomic dnas, 0.4 μ l;
(2) amplification program is: 94 ℃ of pre-sex change 3 min, and 94 ℃ of sex change 1 min, 55 ℃ or 60 ℃ of renaturation 1 min, 72 ℃ are extended 2 min, 40 circulations; 72 ℃ are extended 10 min;
(3) amplified production is observed behind the cma staining and is taken a picture with 6% denaturing polyacrylamide gel or 8% native polyacrylamide gel electrophoresis.
Described and wheat powdery mildew resistant gene
PmHNK54The application of chain labeled primer in assistant breeding.
The method that the present invention adopts is with disease-resistant wheat Zheng parent 9754 and susceptible parent's China spring (Chinese Spring, CS) hybridization, selfing, parents and filial generation thereof are carried out the evaluation in seedling stage, carry out genetic analysis with wheat powdery mildew 10YY2, utilize SSR, EST-SSR mark that parents and anti-sense pond are screened and analyze, and in conjunction with China spring lack-the limbs material carries out chromosomal localization.
Test-results shows: the resistance of 9754 pairs of high virulence microspecies of powdery mildew of wheat parent material Zheng 10YY2 is good, and its disease resistance is controlled by a pair of dominance nuclear gene, with the temporary called after of this gene
PmHNK54The present invention screened with
PmHNK54Closely linked 2 microsatellite markers, the order on genetic map be Xbarc5,
PmHNK54,Xgwm312.Two chain flanks are marked on
PmHNK54Genetic distance is respectively 5.0 cM, 6.0 cM, and will
PmHNK54Be positioned on the 2AL karyomit(e).
Positive beneficial effect of the present invention
Mildew-resistance gene among common wheat parent material Zheng 9754 provided by the invention
PmHNK54Molecule marking method, have following characteristics:
1, molecule marker primer of the present invention has been located the new gene of powder mildew resistance among wheat parent material Zheng 9754 first
PmHNK54The high specificity of mark, stability are high, and the screening method of mark is simple and quick, and be less demanding to test set and primer template quality, and it is few to have a test reagent consumption, and speed is fast, and cost is low, is fit to big batch, the advantage of high-throughput, automatization.Be fit to very much the realization of modern agriculture molecular breeding.
2, the functional objective of assistant breeding of the present invention is very clear and definite, can save cost in a large number.Traditional powdery mildew disease-resistant breeding at first utilizes anti-source of excellent Powdery Mildew and improvement parent to hybridize, and then progeny population is carried out the powdery mildew disease-resistant inoculation and identifies, this method is subject to the amblent air temperature influence, selects accuracy lower.Therefore traditional breeding for disease resistance not only time-consuming, take a lot of work, and efficient is low, cost is high.Utilize the new gene of powdery mildew disease-resistant gene molecule marker of the present invention and powder mildew resistance
PmHNK54Close linkage just can identify in seedling stage fast, high-throughput and to contain the new gene of powder mildew resistance
PmHNK54Segregating population and Gao Dai strain, when reducing the breeding cost, also improved efficiency of selection significantly.
3, the present invention is a mildew-resistance gene
PmHNK54Map based cloning important molecular genetics information is provided.Two orders that are marked on the genetic map be Xbarc5,
PmHNK54,Xgwm312.Two chain flanks are marked on
PmHNK54Genetic distance is respectively 5.0 cM, 6.0 cM, and will
PmHNK54Be positioned on the 2AL karyomit(e).Above-mentioned information can be the new gene of powder mildew resistance
PmHNK54Map based cloning test lay the foundation.
4,9754 pairs of Powdery Mildews of parent material Zheng of utilization of the present invention have excellent resistance, and self economical character is good, and the difficulty that imports wheat breed as the anti-source of new Powdery Mildew is little, do not have unfavorable chainly, have greater advantage aspect breeding.Utilize classical genetics, China spring nullisomic-limbs location and molecule marking method that the new gene of powder mildew resistance that wheat parent material Zheng 9754 carries is carried out genetic analysis, clear and definite its genetic development, the enantiopathy gene positions, develop molecule marker closely linked with it, for the powdery mildew disease-resistant breeding provides new anti-source, also be simultaneously
PmHNK54Carry out molecular mark aborning technical support is provided.
5, powdery mildew disease-resistant gene molecule marker primer of the present invention is applied in the breeding work, the popular wheat yield loss that causes of Powdery Mildew will be reduced greatly, reduce the agricultural chemicals usage quantity simultaneously, help reducing production costs and improving grain yield, have very big application potential and higher economic value.
Description of drawings:
Fig. 1 linked marker Xgwm312 is to the amplification of 2A homology group's nullisomic-limbs and 2A disappearance system.
Among the figure, arrow is depicted as polymorphism purpose band.M:Marker, 1: Zheng 9754,2: China spring, 3: disease-resistant DNA pond, 4: susceptible DNA pond, 5: nullisomic 2A limbs 2B (N2AT2B), 6: nullisomic 2A limbs 2D (N2AT2D), 7: nullisomic 2B limbs 2A (N2BT2A), 8: nullisomic 2B limbs 2D (N2BT2D), 9: nullisomic 2D limbs 2A (N2DT2A), 10: nullisomic 2D limbs 2B (N2DT2B), 11: disappearance system (2AL-1).
The anti-white powder gene of Fig. 2
PmHNK54Microsatellite marker linkage inheritance collection of illustrative plates, show molecule marker with
PmHNK54The left side is the site title among Fig. 2, and the right is a genetic distance, and unit is cM.
The anti-white powder gene of Fig. 3
PmHNK54The microsatellite marker physical map, proved
PmHNK54The existence zone of gene on karyomit(e) 2AL.A represents genetic map among the figure; B represents physical map.
Fig. 4
PmLK906With
Pm4Anti-, sense pond detected result that chain molecule marker enantiopathy parent material Zheng 9754 and China spring and filial generation thereof are formed are in order to check
PmHNK54With
PmLK906With
Pm4Difference on molecular level shows
PmHNK54Be different from
PmLK906With
Pm4,It is a new gene that is positioned on the karyomit(e) 2AL.
Among the figure, M:Marker, 1: Zheng 9754,2: China spring, 3: disease-resistant DNA pond, 4: susceptible DNA pond.
Embodiment:
Describe the present invention in detail below in conjunction with embodiment, wherein the percentage concentration of Chu Xianing all refers to mass percent concentration if no special instructions.
Embodiment 1: with the wheat powdery mildew resistant gene
PmHNK54Chain labeled primer and application thereof
Materials and methods
(1) for the wheat lines of testing: the quadrature and the reciprocal cross F of parent material Zheng 9754 and China spring (CS)
1Generation, F
2Generation, F
2:3, for colony, and China spring and nullisomic-(nullisomic-tetrasomic lines of limbs system thereof, NT): N2A-T2B, N2A-T2D, N2B-T2A, N2B-T2D, N2D-T2A and N2D-T2B, 2 disappearances of karyomit(e) 2A are 2AS-5 (FL=0.78), 2AL-1 (FL=0.85), disease-resistant control material: Aramda (
Pm4b), Kavkaz (
Pm8), the week 22 (
PmHNK), Zheng wheat 883 (
Pm21), teeth rough (
Pm24), Lankao 906 (
PmLK906).
(2) analytical procedure: 1. powdery mildew disease-resistant analysis in seedling stage: disease resistance is identified the artificial inoculation method that adopts, when growing to tri-leaf period for the examination wheat seedling, with tremble powder method inoculation be placed between isolated inoculation in (temperature: 15-20 ℃/daytime, 10-15 ℃/night, illumination: 14-16 h/hd-1, light intensity: 10000 lx, relative humidity: incobation morbidity 80%), treat the susceptible contrast China spring back (7-10d) of fully falling ill, divide disease-resistant classification promptly by containing the precious 6 grades of classification of admiring: 0,0; , 1,2,3,4,0-0 wherein; Be immunity, 1 is high anti-, and 2 is anti-in being, 3 be middle sense, and 4 be that height is felt.To F
2, F
2:3The offspring separates than test of goodness of fit with chi square test, determines the contained disease-resistant gene number of kind and makes mode mutually.
2. DNA extraction and anti-sense pond make up: the CTAB method is adopted in the extraction of wheat cdna group DNA.At F
2DNA is extracted in the susceptible strain of difference disease-resistant plant of picked at random 10 strains and 10 strains in the colony, and the balanced mix of respectively asking for is set up disease-resistant pond and susceptible pond.
3. the analysis of SSR primer: the SSR primer is synthetic according to the primer of the 610 couples of SSR of SSR cooperative groups and EST-SSR primer (http://wheat.pw.usda.gov/ggpages/SSR/) report.
PCR is reflected on the Bio-RAD Thermocycler and carries out.
Reaction system is 10 μ l, contains 10 * buffer (Mg
2+) 1 μ l, 10 mM/ μ l dNTP, 0.2 μ L, 20 uM/ μ L primers, 0.2 μ l, 5 U/ul Taq enzyme 0.1ul, deionized water 8.1 μ l, 20 ng/ μ l genomic dnas, 0.4 μ l.
Amplification program: 94 ℃ of pre-sex change 3 min, 94 ℃ of sex change 1 min, 50 ℃, 55 ℃, 60 ℃ renaturation 1min, 72 ℃ are extended 2min, 40 circulations; 72 ℃ are extended 10min.Amplified production is observed behind cma staining and is taken a picture with 6% denaturing polyacrylamide gel or 8% native polyacrylamide gel electrophoresis.
The chromosomal localization of 4. genetic distance estimation, linkage analysis and powdery mildew disease-resistant gene:
With the genetic distance between Mapmarker 3.0b computed in software mark and mildew-resistance gene (LOD 〉=3.0).Draw the genetic linkage maps of this gene with Mapdraw software.According to the SSR amplification, find the primer that between parents, disease-resistant pond and susceptible pond, has polymorphism, pass through F
2:3Colony verifies polymorphism primer, utilizes the locating information enantiopathy gene of this primer to position, and utilizes the nullisomic limbs (the second homology group) of a cover China spring that positioning result is further verified.Then, in conjunction with the physical map of wheat micro-satellite primers, the Fine Mapping of this disease-resistant gene is further analyzed.
Result and analysis
(1) resistance is identified and genetic analysis
, inoculate the result seedling stage and show connecing bacterium with 7 highly pathogenicity wheat powdery mildew physiological strains in Henan Province for the examination material, 9754 pairs of 6 microspecies wherein of parent material Zheng show as high anti-or in anti-, with Lankao 906 (
PmLK906) disease-resistant performance difference is fairly obvious: susceptible variety China spring, Armada (
Pm4b) and Kavkaz (
Pm8) above 7 microspecies are all shown as high sense, infecting type is the 3-4 type; Teeth rough (
Pm24) show as susceptible to 08B1 and 10YY2; Week 22 (
PmHNK), Zheng wheat 883 (
Pm21) then above microspecies are shown good resistance.Test-results shows: disease-resistant gene
PmHNK54With
Pm4,
PmLK906Fairly obvious to 7 fungus strain resistance level performance differences, parent material Zheng 9754 resistance performance is excellent.(seeing Table 1)
The disease-resistant qualification result of table 1 wheat parent material Zheng 9754 monospore microspecies (0-2: disease-resistant; 3-4: susceptible)
Show as high resisting behind Zheng 9754 inoculation fungus strain 10YY2, infecting type is 1, shows as high sense behind susceptible parent's China spring inoculation 10YY2, and infecting type is 4 types.To F
1, F
2And F
2:3Genetic analysis is carried out in inoculation, and the result shows (table 2): 40 strain quadrature F
1All disease-resistant, at the F of Zheng 9754 with China spring
2In the hybridization colony (516 strain), wherein disease-resistant 404 strains, susceptible 112 strains are through χ
2Check meet the 3R:1S of 1 pair of dominant gene control segregation ratio (
χ 2 =2.987,1
Df,
P=0.084).327 F of Zheng 9754 and China spring hybridization
2:3Family has been inoculated fungus strain 10YY2 equally, and the result shows that 81 familys have resistance and resistance separation, 163 F do not take place
2:3Family generation resistance is separated, and 83 family performances are susceptible not to separate χ
2Assay (
χ 2 =0.052,2
Df,
P=0.974) shows that its dominance single-gene that meets 1:2:1 separates ratio.These results show that the powder mildew resistance of 9754 couples of 10YY2 of parent material Zheng is controlled by 1 pair of dominant gene, with the temporary called after of this gene
PmHNK54
Table 2 10YY2 is to Zheng 9754 powdery mildew disease-resistant genetic analysis result
(2)
PmHNK54The screening of gene linkage mark and chromosomal localization:
On 21 karyomit(e)s of wheat, wheat SSR genetic map according to up-to-date announcement, the contriver has synthesized a large amount of SSR primers, between disease-resistant Zheng parent 9754, susceptible parent's China spring, resistance pond and susceptible pond, carry out PCR amplification, screening, discovery has 3 pairs of SSR primers can amplify polymorphism between anti-sense pond and parents, and process is to F
2The electrophoretic analysis of segregating population (referring to Fig. 1) is therefrom chosen two reliabilities of Xbarc5, Xgwm312, stable best primer as the new gene of powdery mildew disease-resistant
PmHNK54Selective marker.
Labeled primer Xbarc5,
P1：5’-GCGCCTGGACCGGTTTTCTATTTT-3’，
P2：5’-GCGTTGGGAATTCCTGAACATTTT?-3’，
Labeled primer Xgwm312,
P3：5’-ATCGCATGATGCACGTAGAG?-3’，
P4：5’-ACATGCATGCCTACCTAATGG?-3’。
(3) genetic linkage analysis and chromosomal localization
By the testing goal gene locus with the genetic linkage of acquisition marker site, with F
2327 individual plants of offspring extract genomic dna respectively.Utilize these linked markers further these 327 individual plants to be analyzed, to determine mildew-resistance gene
PmHNK54And the linkage relationship between the marker site.With Mapmarker 3.0b software to mildew-resistance gene
PmHNK54Carry out linkage analysis (LOD 〉=3.0) with the SSR site, the result shows: mark Xbarc5, Xgwm312 and mildew-resistance gene
PmHNK54Genetic distance is respectively 5.0cM and 6.0cM(referring to Fig. 2).
Utilize the second homology group's nullisomic limbs material that linked marker is analyzed, can find that it is positioned at karyomit(e) 2A and goes up (referring to Fig. 1), the test-results of disappearance system shows that this mark just in time is positioned at the Bin 2AL-1-0-0.85(of 2AL referring to Fig. 3 simultaneously).
Conclusion
The present invention utilizes 7 Henan Province's popular microspecies of current wheat powdery mildew to estimate parent material Zheng 9754 disease resistance, confirms that it has very strong resistance to a plurality of powdery mildew microspecies.Utilize the classical genetics analysis, find that the disease resistance of 9754 couples of 10YY2 of Zheng is controlled by 1 pair of dominance nuclear gene, be located on karyomit(e) 2AL with the SSR mark, and utilize nullisomic-limbs of the second homology group to verify.Up to the present, being positioned on the 2AL, the powdery mildew disease-resistant gene of definite designation has three:
Pm4a, Pm4bWith
PmLK906
Pm4a, Pm4bThe allelotrope that belongs to same site, be found in respectively wild emmer (
T. dicoccum, 2n=28, AABB) and the Persian wheat (
T. carthlicum, 2n=28, AABB), the modes by how for continuous backcross import (The et al. 1979) in the common wheat, have found its isolating RFLP mark BCD1231 altogether, utilize BCD1231 develop a series of with
Pm4Other chain type analysis mark, these marks can detect simultaneously
Pm4aWith
Pm4bExistence, on producing, well utilized.And another gene on the karyomit(e) 2A comes from common wheat kind Lankao 906, finds a recessive powdery mildew disease-resistant gene therein, and with its called after
PmLK906, also announced simultaneously 2 with this gene closely linked molecule marker with Molecular Selection with this gene of opposing.
Resistance by the full fungus strain of 7 powdery mildew lists is identified, has seen
PmHNK54With
Pm4With
PmLK906Distinct disease-resistant performance, promptly they are respectively different disease-resistant genes.For further this conclusion of proof, the contriver utilize respectively with
Pm4a, Pm4b(BCD1231-STS) and
PmLK906(Xgwm265, Xgdm93) chain molecule marker detects (referring to Fig. 4) to Zheng 9754 with anti-, sense pond that China spring and filial generation thereof are formed.Result's demonstration,
Pm4a, Pm4bWith
PmLK906All there is not polymorphism in Zheng 9754 and China spring offspring's anti-, sense in chain molecule marker between the pond.Therefore in conjunction with the result of resistance evaluation and Molecular Detection two aspects, can reach a conclusion:
PmHNK54It is a new powdery mildew disease-resistant gene.Because parent material Zheng 9754 self economical character is not seen this disease-resistant gene and disadvantageous gene linkage, therefore as yet than more excellent
PmHNK54And carrier Zheng 9754 of this gene has breeding utility value preferably.Two molecule markers of the present invention can be used for
PmHNK54Carry out the reliable mark of high-throughput, selection in early stage in breeding is produced, the present invention simultaneously also is the excellent anti powdery mildew gene
PmHNK54Map based cloning important molecular genetic information is provided, have very big application potential and higher economic value.
Sequence table
＜110〉Henan Academy of Agricultural Sciences
＜120〉with the wheat powdery mildew resistant gene
PmHNK54Chain labeled primer and application thereof
＜130〉clone of PCR product and order-checking
<160>?4
<170>?PatentInversion3.4
<210>?1
<211>?24
<212>?DNA
＜213〉artificial sequence
<400>?1
GCGCCTGGACCGGTTTTCTATTTT 24
<210>?2
<211>?24
<212>?DNA
＜213〉artificial sequence
<400>?2
GCGTTGGGAATTCCTGAACATTTT 24
<210>?3
<211>?20
<212>?DNA
＜213〉artificial sequence
<400>?3
ATCGCATGATGCACGTAGAG 20
<210>?4
<211>21
<212>?DNA
＜213〉artificial sequence
<400>?4
ACATGCATGCCTACCTAATGG 21
Claims (4)
1. with the wheat powdery mildew resistant gene
PmHNK54Chain labeled primer is characterized in that, the nucleotides sequence of described labeled primer is classified as:
Labeled primer Xbarc5,
P1：5’-GCGCCTGGACCGGTTTTCTATTTT-3’，
P2：5’-GCGTTGGGAATTCCTGAACATTTT?-3’，
Perhaps labeled primer Xgwm312,
P3：5’-ATCGCATGATGCACGTAGAG?-3’，
P4：5’-ACATGCATGCCTACCTAATGG?-3’。
2. labeled primer according to claim 1 is characterized in that, the order of described labeled primer on genetic map be Xbarc5,
PmHNK54,Xgwm312, described labeled primer Xbarc5 and gene
PmHNK54Genetic distance be 5.0cM, described labeled primer Xgwm312 with
PmHNK54Genetic distance be 6.0 cM.
A claim 1 described with the wheat powdery mildew resistant gene
PmHNK54The usage of chain labeled primer is characterized in that, the response procedures when described labeled primer is used for the SSR label screening is:
(1) PCR reaction: the PCR reaction system is 10 μ l, contains 10 * buffer, 1 μ l, 10 mM/ μ l dNTP, 0.2 μ L, 20 uM/ μ L primers, 0.2 μ l, 5 U/ul Taq enzyme 0.1ul, deionized water 8.1 μ l, 20 ng/ μ l genomic dnas, 0.4 μ l;
(2) amplification program is: 94 ℃ of pre-sex change 3 min, and 94 ℃ of sex change 1 min, 55 ℃ or 60 ℃ of renaturation 1 min, 72 ℃ are extended 2 min, 40 circulations; 72 ℃ are extended 10 min;
(3) amplified production is observed behind the cma staining and is taken a picture with 6% denaturing polyacrylamide gel or 8% native polyacrylamide gel electrophoresis.
4. claim 1 or 2 described and wheat powdery mildew resistant genes
PmHNK54The application of chain labeled primer in assistant breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010572276 CN101988064A (en) | 2010-12-03 | 2010-12-03 | Marker primer interlocked with wheat powdery mildew resistance gene PmHNK54 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010572276 CN101988064A (en) | 2010-12-03 | 2010-12-03 | Marker primer interlocked with wheat powdery mildew resistance gene PmHNK54 and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101988064A true CN101988064A (en) | 2011-03-23 |
Family
ID=43744858
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010572276 Pending CN101988064A (en) | 2010-12-03 | 2010-12-03 | Marker primer interlocked with wheat powdery mildew resistance gene PmHNK54 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101988064A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102433327A (en) * | 2011-08-22 | 2012-05-02 | 江苏省农业科学院 | Molecular marker closely linked with powdery-mildew-resistant gene of wheat Tabasco |
| CN102559911A (en) * | 2012-02-16 | 2012-07-11 | 中国农业大学 | Method for assisting in identifying powdery mildew resistant plants and special primers for method |
| CN105274198A (en) * | 2015-05-26 | 2016-01-27 | 江苏省农业科学院 | Method for sequencing and development of Asplenium nidus L. EST-SSR primers based on transcriptome |
| JPWO2015190591A1 (en) * | 2014-06-13 | 2017-04-20 | 東レ株式会社 | Breast cancer detection kit or device and detection method |
| CN107619882A (en) * | 2017-11-21 | 2018-01-23 | 山东农业大学 | A kind of wild emmer mildew-resistance gene molecular labeling and its application |
| CN109152345A (en) * | 2016-02-22 | 2019-01-04 | 贝霍种子有限公司 | Powdery mildew resistance gene in carrot |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1884296A (en) * | 2006-07-10 | 2006-12-27 | 南京农业大学 | Marker primer linked with wheat powdery mildew resistant gene Pm6 and its usage method |
-
2010
- 2010-12-03 CN CN 201010572276 patent/CN101988064A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1884296A (en) * | 2006-07-10 | 2006-12-27 | 南京农业大学 | Marker primer linked with wheat powdery mildew resistant gene Pm6 and its usage method |
Non-Patent Citations (1)
| Title |
|---|
| 《植物遗传资源学报》 20061231 苏亚蕊等 黄淮麦区以1B/ 1R类品种为抗源主要育成小麦品种的遗传多样性分析 332-323页 1-4 第7卷, 第3期 2 * |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102433327A (en) * | 2011-08-22 | 2012-05-02 | 江苏省农业科学院 | Molecular marker closely linked with powdery-mildew-resistant gene of wheat Tabasco |
| CN102559911A (en) * | 2012-02-16 | 2012-07-11 | 中国农业大学 | Method for assisting in identifying powdery mildew resistant plants and special primers for method |
| JP2020141681A (en) * | 2014-06-13 | 2020-09-10 | 東レ株式会社 | Kit or device for detecting breast cancer, and breast cancer detection method |
| JPWO2015190591A1 (en) * | 2014-06-13 | 2017-04-20 | 東レ株式会社 | Breast cancer detection kit or device and detection method |
| JP7058399B2 (en) | 2014-06-13 | 2022-04-22 | 東レ株式会社 | Breast Cancer Detection Kit or Device and Detection Method |
| JP2022109911A (en) * | 2014-06-13 | 2022-07-28 | 東レ株式会社 | Breast cancer detection kit or device and detection method |
| US11479822B2 (en) | 2014-06-13 | 2022-10-25 | Toray Industries, Inc. | Breast cancer detection kit or device, and detection method |
| JP7405380B2 (en) | 2014-06-13 | 2023-12-26 | 東レ株式会社 | Breast cancer detection kit or device and detection method |
| US11859255B2 (en) | 2014-06-13 | 2024-01-02 | Toray Industries, Inc. | Breast cancer detection kit or device, and detection method |
| CN105274198A (en) * | 2015-05-26 | 2016-01-27 | 江苏省农业科学院 | Method for sequencing and development of Asplenium nidus L. EST-SSR primers based on transcriptome |
| CN109152345A (en) * | 2016-02-22 | 2019-01-04 | 贝霍种子有限公司 | Powdery mildew resistance gene in carrot |
| CN109152345B (en) * | 2016-02-22 | 2021-11-09 | 贝霍种子有限公司 | Powdery mildew resistance gene in carrot |
| CN107619882A (en) * | 2017-11-21 | 2018-01-23 | 山东农业大学 | A kind of wild emmer mildew-resistance gene molecular labeling and its application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106929574B (en) | SNP molecular marker of upland cotton No. 4 chromosome related to fiber strength | |
| CN106868131B (en) | SNP molecular marker of upland cotton No. 6 chromosome related to fiber strength | |
| Zhang et al. | A diallel analysis of heterosis in elite hybrid rice based on RFLPs and microsatellites | |
| CN107043813B (en) | SNP molecular marker of upland cotton No. 25 chromosome related to fiber strength | |
| CN101988064A (en) | Marker primer interlocked with wheat powdery mildew resistance gene PmHNK54 and application thereof | |
| Ganapathy et al. | Genetic diversity revealed utility of SSR markers in classifying parental lines and elite genotypes of sorghum ('Sorghum bicolor'L. Moench) | |
| CN113774161B (en) | KASP molecular marker of peanut pod and kernel size major QTL and application thereof | |
| CN110923352B (en) | KASP marker of wheat powdery mildew resistance gene PmDTM and application thereof | |
| CN106834439A (en) | A kind of related molecular labeling of Growth of Litopenaeus vannamei and its application | |
| CN102140506B (en) | Molecular marker linked with gummy stem blight resistance gene Gsb-2 and application thereof | |
| CN114774570B (en) | Molecular marker closely linked with wheat stem rot resistance QTL and application | |
| Li et al. | Genetics of resistance to yellow rust in PBW343× Kenya Kudu recombinant inbred line population and mapping of a new resistance gene YrKK | |
| CN108411024B (en) | Molecular marker SNP6 coseparating with powdery mildew resistance gene of cucumber-sour cucumber introgression line | |
| CN109735650B (en) | Four single nucleotide polymorphism-based molecular markers for resisting gummy stem blight of melon and application thereof | |
| CN109797238B (en) | Two molecular markers developed based on gummy stem blight resistance identification and application thereof | |
| CN104789655A (en) | Molecular marker and application of rice blast-resistant gene Pik | |
| Wang et al. | Phenotypic and genetic diversity of the culinary-medicinal winter mushroom Flammulina velutipes (Agaricomycetes) in China | |
| CN101942521B (en) | Molecular marker detection method of rice blast bacterium non-toxic genes Avr-Pit and primers thereof | |
| CN109468410A (en) | The gene molecule marker and its application that a kind of and capsicum genic male sterile gene msc-2 is isolated | |
| CN102766691B (en) | Molecular markers for avirulence gene Avr-Pit of Pyricularia grisea | |
| Wang et al. | Genetic analysis and molecular mapping of leaf rust resistance genes in the wheat line 5R618 | |
| CN108060247B (en) | Haplotype related to upland cotton No. 8 chromosome fiber strength | |
| CN101532054B (en) | Molecular marker for assisting selection of disease resistance gene PmHNK of wheat powdery mildew and use thereof | |
| CN110423747B (en) | Cymbidium SSR primer and application thereof in population genetic diversity analysis | |
| CN110257553A (en) | A kind of KASP molecule labelling method for identifying resistance gene of rice blast Pigm |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20110323 |