CN1246476C - Molecule marker method of wheat Nanda 2419 scab resistant major gene locus - Google Patents

Abstract

The present invention provides a major gene site and a molecular marker for resisting the invasion of a gibberellic disease of wheat 'Nanda 2419' and belongs to the field of molecular genetics. Genetic linkage analysis is carried out to the gene types and the affected ears of each line of recombined selfing lines obtained through the hybridization of 'wangshuibai' (female) and 'nanda 2419' (male) which are varieties of wheat to obtain the major gene sites QFhs. nau-3a and QFhs. nau-4b for resisting the invasion of the gibberellic disease of 'Nanda 2419'. By detecting whether the 'nanda 2419' and derived varieties (series) thereof contain the major gene sites or not, the level of the resistance to the gibberellic disease can be predicted, and the selection efficiency of wheat resisting the gibberellic disease is greatly improved.

Description

Wheat Nanjing University 2419 anti gibberellic diseases infect the molecule marking method of major gene loci

One, technical field

The invention provides the molecule marking method that wheat Nanjing University 2419 anti gibberellic diseases infect major gene loci, belong to the molecular genetics field, be exclusively used in the seed selection of wheat scab disease-resistant variety and the utilization of germ plasm resource.

Two, technical background

Wheat is the important food crop of China.By the wheat scab that gibberella causes, not only cause the serious underproduction of wheat, reduce grain quality, and the toxin deoxynivalenol that this germ produces also influences people, animal health, caused very big loss to Wheat Production.In China, the harm that suffers head blight above 1/4th wheat belt is arranged, and just once be very popular every 3 ~ 5 years, only head blight generation area in 2002 promptly reaches 30,000,000 mu times.Therefore, research prevents and treats wheat scab and has also just become a urgent task on the current Wheat Production.Cultivating disease-resistant variety is to prevent and treat the safest, effective of wheat scab harm and save one of measure of cost.But traditional breeding way is wasted time and energy, and because the head blight phenotypic evaluation is very difficult, makes the wheat anti gibberellic disease breeding process slow unusually.Identify that by the location disease-resistant major gene loci comes assistant breeding effectively to address this problem.

Genetic research shows that wheat scab is controlled by a few major gene loci mainly, and its disease-resistant major gene loci position on karyomit(e) of different resistant materials is inconsistent, and be divided into anti-infect and resist expand two types.But the polymerization by the disease-resistant major gene loci of difference or introduce new anti-source and can select the good kind of resistance.

At present in the utilization of the research of scab resistance hereditary basis and breeding for disease resistance, focus mostly in Soviet Union wheat No. 3 and derive and be.Nanjing University 2419 is choosing systems of Italian wheat breed Mentana, has yielding ability preferably, and economical character is good, is one of backbone parent of China's wheat breeding.And the parent " Funo " of Mentana and Soviet Union three has the common ancestors, so may exist in the Nanjing University 2419 and scab resistance mechanism like the Su Sanxiang.

Three, summary of the invention

Technical problem

The objective of the invention is: provide wheat Nanjing University 2419 anti gibberellic diseases to infect the molecule marking method of major gene loci, by detecting these and the anti-chain molecule marker of major gene loci that infects, can predict the scab resistance of wheat plant, accelerate the selection progress of wheat-resistance to scab.

Technical scheme

Wheat Nanjing University 2419 anti gibberellic diseases infect the molecule marking method of major gene loci, it is characterized in that: use labeled primer Xgwm2,

Left end primer sequence CTGCAAGCCTGTGATCAACT

Right-hand member primer sequence CATTCTCAAATGATCGAACA

Amplification wheat anti gibberellic disease kind or breeding material DNA, if can amplify the amplified fragments of 100bp, then indicate the existence that wheat Nanjing University 2419 anti gibberellic diseases infect major gene loci Qfhs.nau-3a, wherein this major gene loci is positioned at the 3A karyomit(e) of wheat Nanjing University 2419, utilize Data desk v.5.0 software record with the incoherent probability P value of scab resistance be 0.0064, to the contribution rate 9.9% of scab resistance; Perhaps use labeled primer Xgwm107,

Left end primer sequence ATTAATACCTGAGGGAGGTGC

Right-hand member primer sequence GGTCTCAGGAGCAAGAACAC

Amplification wheat anti gibberellic disease kind or breeding material DNA, if can amplify the amplified fragments of 188bp, then indicate the existence that wheat Nanjing University 2419 anti gibberellic diseases infect major gene loci Qfhs.nau-4b, wherein this major gene loci is positioned at the 4B karyomit(e) of wheat Nanjing University 2419, utilize Data desk v.5.0 software record with the incoherent probability P value of scab resistance be 0.0249, to the contribution rate 7.9% of scab resistance.

The process of screening above-mentioned labeled primer is as follows:

(1) wheat breed Wangshuibai (♀) and Nanjing University 2419 (♂) hybridize and obtain hybrid F1, and the F1 selfing produces F2, adopts simple grain transmission method (SSD) to obtain the F6 RIL in generation then;

(2) extract the DNA that each strain of recombinant inbred lines is with the SDS method, adopt simple repeated sequence mark SSR that two parents are carried out the polymorphism screening, PCR carries out on PE9600 amplification instrument, amplified production carries out the electrophoretic separation analysis on 8% (g/ml) polyacrylamide gel, according to the molecular marker screening result, filtering out has polymorphic primer between the parent, has polymorphic primer to analyze in recombinant inbred lines between the parent, the pcr amplification program is the same, obtains colony's genotype data;

(3) according to chain exchange rule, utilize colony's genotype data to make up the genetic map of wheat, used software is Mapmaker 2.0, minimum LOD value is made as 3, obtains linkage map;

(4) blooming stage inoculation head blight pathogenic bacteria carries out scab resistance to each family of RIL and identifies, obtains the disease tassel yield of each family of RIL;

(5) utilize Data desk v.5.0 software carry out linkage analysis to colony's genotype data of each molecule marker with disease tassel yield that the scab resistance of its corresponding each family is identified, One-way ANOVA records and the incoherent probability P value of scab resistance, the molecule marker of P＜0.05 is promptly chain with a major gene loci, anti gibberellic disease infects the position of major gene loci and determined by the chromosome position of molecule marker: find the Xgwm2 mark of P=0.0064 and the Xgwm107 mark and the anti-major gene loci close linkage that infects of P=0.0249 in Nanjing University 2419, Xgwm2 and Xgwm107 are the mark Nanjing University 2419 anti-labeled primers that infect major gene loci QFhs.nau-3a and QFhs.nau-4b.

Beneficial effect wheat provided by the present invention Nanjing University 2419 anti gibberellic diseases infect the molecule marking method of major gene loci, have the following advantages:

(1) obtains to have located 2 major gene locis that anti gibberellic disease infects in the wheat breed Nanjing University 2419 in the world first by molecule marker of the present invention, their scab resistances of common soluble 15.8%.The wheat cdna group is huge, is 40 times of rice genome size, and the accurate location work of wheat anti gibberellic disease major gene loci is occupy the same domain prostatitis;

(2) the localized major gene loci locality specific of molecule marker mark of the present invention, it is convenient to identify.By detecting and these anti-chain molecule markers of major gene loci that infects, promptly can predict the scab resistance of wheat plant, the genotype detection that is used for wheat breed or strain, judging whether this kind or strain have scab resistance, and then rapid screening disease-resistant variety or strain are used for wheat breeding.Major gene loci easy to detect fast, not affected by environment;

(3) the assistant breeding select target is clear and definite, saves cost.In traditional breeding way, at first to collect parent and Cultivar and carry out a series of hybridization, and will carry out individual plant to scab resistance and select with disease-resistant gene.Wheat scab is carried out phenotypic evaluation will wait until blooming stage, be subjected to bigger environmental influence, the result reliability of phenotypic evaluation is low.Therefore breeding for disease resistance is not only time-consuming, and difficulty is big, the cost height.By detecting the anti gibberellic disease major gene loci, can just identify the individual plant of high anti gibberellic disease in seedling stage, eliminate other plant, not only save production cost but also improve the efficiency of selection of wheat-resistance to scab greatly.

Four, embodiment

Of the present invention being described in detail as follows:

Studies show that wheat scab resistance is controlled by the minority major gene loci mainly.U.S. Anderson laboratory finds that the scab resistance of No. 3/Stoa of four major gene locis and Soviet Union wheat colony is significantly relevant, lays respectively at 2A1,3BS, 4BS and 6BS and goes up (Anderson, 1998; Waldron, 1999; Anderson, 2000,2001).People such as U.S. Bai obtain two the scab resistance sites relevant with the RAPD mark, and Zhou integrated use SSR, AFLP in 2002 and aneuploid technology are positioned at this major gene loci that to lack be that 3BS-8 does not hold a last length to be about the chromosomal region of 8cM.Japan Ban infers that the resistance main effect gene locus of Soviet Union wheat 3 may be positioned on the 5AL.Austrian Buerstmayr (2000,2001) finds that three genome areas and the anti-extendability significant correlation of head blight are arranged, and is positioned on 3BS, 5A, the 1B.The molecule marker that infects major gene loci by wheat of the present invention Nanjing University 2419 anti gibberellic diseases obtains to have located 2 anti-major gene locis that infect that exist in the 3A of wheat breed Nanjing University 2419 and the 4B karyomit(e) in the world first, these major gene locis can be used to instruct the seed selection work of anti gibberellic disease kind, screen with chain with it molecule marker enantiopathy kind, make different disease-resistant major gene loci rapid polymerizations in same plant, thereby improve breeding efficiency greatly.

Materials and methods:

(1) structure and the phenotypic evaluation of Nanjing University's 2419 RILs:

(1) choosing to China's Jiangsu local variety Wangshuibai (♀) and Italian wheat breed Mentana is that acquisition F1 is hybridized in Nanjing University 2419 (♂), the F1 selfing produces F2,136 optional plantations of F2 individual plant, the method that adopts simple grain to pass is bred F6 generation, obtain RIL, comprise 136 familys;

(2) RIL is planted in the academy of agricultural sciences, Jiangsu Province, allows its natural occurrence.Blooming back 20 days, and measuring state of an illness indexs such as disease tassel yield.Disease tassel yield=sick spike number/total spike number * 100%

(2) molecular marker analysis of recombinant inbred lines

(1) extracting each strain of recombinant inbred lines with the SDS method is DNA;

(2) at first Wangshuibai and 2419 parents' of Nanjing University dna polymorphism is carried out initial analysis with 976 pairs of SSR primers.The PCR reaction volume is 25 microlitres, 10 * buffer, 2.5 microlitres wherein, 25mM MgCl ₂1.5 microlitre, 2.5mM dNTPs 2 microlitres, Taq enzyme (5 units/microlitre) 0.2 microlitre, template DNA 20 nanograms add water to 25 microlitres.After the SSR reaction system is 94 ℃ of pre-sex change 3min of DNA, 94 ℃ of sex change 1min, 60 ℃ of annealing 1min, 72 ℃ are extended exhibition 2min, circulate 35 times, and last 72 ℃ are extended 10min.In the enterprising performing PCR amplification of PE 9600 amplification instrument, amplified production carries out electrophoretic separation on 8% non-denaturing polyacrylamide gel (containing 7.6 gram acrylamides and 0.4 gram methylene diacrylamide in the 100ml polyacrylamide solution), on ultraviolet transilluminator, take a picture then, the record result, there is polymorphic primer in recombinant inbred lines, to analyze between the parent, the pcr amplification program is the same, obtains colony's genotype data;

(3) according to chain exchange rule, utilize colony's genotype data to make up the genetic map of wheat, used software is Mapmaker 2.0, minimum LOD value is made as 3, obtains linkage map;

(4) utilize Data desk v.5.0 software disease tassel yield that the colony's genotype data of each molecule marker and the scab resistance of its corresponding each family are identified carry out linkage analysis, the location major gene loci.

(3) result and analysis:

Molecular marker screening is the result show, has 383 pairs of SSR primers variant between parents.Utilize Datadesk v.5.0 software disease tassel yield that the colony's genotype data of each molecule marker and the scab resistance of its corresponding each family are identified carry out linkage analysis, One-way ANOVA records and the incoherent probability P value of scab resistance and the site contribution rate R to scab resistance ²(table 2), the molecule marker of P＜0.05 are promptly chain with a major gene loci.The genotype of gained molecule marker in colony is by the genotype classification of parent's Wangshuibai and Nanjing University 2419, if the 2419 identical strains of genotype and Nanjing University are that phenotype is anti-, then the localized disease-resistant major gene loci of this mark is from Nanjing University 2419: find that in Nanjing University 2419 the Xgwm2 mark of P=0.0064 and the Xgwm107 mark of P=0.0249 infect the major gene loci close linkage with anti-, promptly obtain Nanjing University's 2419 anti-molecule markers that infect major gene loci QFhs.nau-3a and QFhs.nau-4b.

Predict the wheat plant resistance by above-mentioned molecular markers for identification major gene loci, expectation can improve the breeding process of China's disease-resistant wheat kind rapidly.

The sequence of table 1. labeled primer and amplified fragments size

Mark	The left end primer sequence	The right-hand member primer sequence	Clip size (bp)
				Xgwm2 Xgwm107	CTGCAAGCCTGTGATCAACT ATTAATACCTGAGGGAGGTGC	CATTCTCAAATGATCGAACA GGTCTCAGGAGCAAGAACAC	100 188

The table 2. Nanjing University 2419 anti-One-way ANOVAs that infect major gene loci

Major gene loci	Mark	Disease tassel yield
				P	R 2(％)
		QFhs.nau-3a	Xgwm2			0.0064	9.9
QFhs.nau-4b	Xgwm107			0.0249	7.9

P: expression and the incoherent probability of scab resistance, P＜0.05 shows this mark and scab resistance close linkage

R ²: the site is to the contribution rate of scab resistance, value is big more show relevant more with scab resistance

Claims (2)

1, wheat Nanjing University 2419 anti gibberellic diseases infect the molecule marking method of major gene loci, it is characterized in that:

Use labeled primer Xgwm2,

Left end primer sequence CTGCAAGCCTGTGATCAACT

Right-hand member primer sequence CATTCTCAAATGATCGAACA

Amplification wheat anti gibberellic disease kind or breeding material DNA, if can amplify the amplified fragments of 100bp, then indicate the existence that wheat Nanjing University 2419 anti gibberellic diseases infect major gene loci Qfhs.nau-3a, wherein this major gene loci is positioned at the 3A karyomit(e) of wheat, utilize Data desk v.5.0 software record with the incoherent probability P value of scab resistance be 0.0064, to the contribution rate 9.9% of scab resistance;

Perhaps use labeled primer Xgwm107,

Left end primer sequence ATTAATACCTGAGGGAGGTGC

Right-hand member primer sequence GGTCTCAGGAGCAAGAACAC

Amplification wheat anti gibberellic disease kind or breeding material DNA, if can amplify the amplified fragments of 188bp, then indicate the existence that wheat Nanjing University 2419 anti gibberellic diseases infect major gene loci Qfhs.nau-4b, wherein this major gene loci is positioned at the 4B karyomit(e) of wheat Nanjing University 2419, utilize Data desk v.5.0 software record with the incoherent probability P value of scab resistance be 0.0249, to the contribution rate 7.9% of scab resistance.

2, wheat according to claim 1 Nanjing University 2419 anti gibberellic diseases infect the molecule marking method of major gene loci, it is characterized in that the process of screening above-mentioned labeled primer is as follows:

(1) the wheat breed Wangshuibai obtains hybrid F1 as maternal hybridization with male parent Nanjing University 2419, and the F1 selfing produces F2, adopts simple grain transmission method (SSD) to obtain the F6 RIL in generation then;

(2) extract the DNA that each strain of recombinant inbred lines is with the SDS method, adopt simple repeated sequence mark SSR that two parents are carried out the polymorphism screening, PCR carries out on PE9600 amplification instrument, amplified production carries out the electrophoretic separation analysis on the 8%g/ml polyacrylamide gel, according to the molecular marker screening result, filtering out has polymorphic primer between the parent, has polymorphic primer to analyze in recombinant inbred lines between the parent, the pcr amplification program is the same, obtains colony's genotype data;

(3) according to chain exchange rule, utilize colony's genotype data to make up the genetic map of wheat, used software is Mapmaker 2.0, minimum LOD value is made as 3, obtains linkage map;

(4) blooming stage inoculation head blight pathogenic bacteria carries out scab resistance to each family of RIL and identifies, obtains the disease tassel yield of each family of RIL;

(5) utilize Data desk v.5.0 software carry out linkage analysis to colony's genotype data of each molecule marker with disease tassel yield that the scab resistance of its corresponding each family is identified, One-way ANOVA records and the incoherent probability P value of scab resistance, the molecule marker of P＜0.05 is promptly chain with a major gene loci, anti gibberellic disease infects the position of major gene loci and determined by the chromosome position of molecule marker: find the Xgwm2 mark of P=0.0064 and the Xgwm107 mark and the anti-major gene loci close linkage that infects of P=0.0249 in Nanjing University 2419, Xgwm2 and Xgwm107 are the mark Nanjing University 2419 anti-labeled primers that infect major gene loci QFhs.nau-3a and QFhs.nau-4b.