CN1246478C - Molecule marker method of wheat Wangshuibai scab resistant major gene locus - Google Patents
Molecule marker method of wheat Wangshuibai scab resistant major gene locus Download PDFInfo
- Publication number
- CN1246478C CN1246478C CN 03131962 CN03131962A CN1246478C CN 1246478 C CN1246478 C CN 1246478C CN 03131962 CN03131962 CN 03131962 CN 03131962 A CN03131962 A CN 03131962A CN 1246478 C CN1246478 C CN 1246478C
- Authority
- CN
- China
- Prior art keywords
- wheat
- wangshuibai
- major gene
- gene loci
- qfhs
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a major gene site and a molecular marker for resisting the invasion of a gibberellic disease of wheat 'wangshuibai' and belongs to the field of molecular genetics. Genetic linkage analysis is carried out to the gene types and the number of affected ears in each line of recombined selfing lines obtained through the hybridization of 'wangshuibai' (female) and 'nanda 2419' (male) which are varieties of wheat to obtain the major gene sites QFhs. nau-2d, QFhs. nau-4a, QFhs. nau-5a, QFhs. nau-5b and QFhs. nau-7b2 for resisting the invasion of the gibberellic disease of 'kangshuibai'. By detecting whether the 'wangshuibai' and derived varieties (series) thereof contain the major gene sites or not, the level of the resistance to the gibberellic disease can be predicted, and the selection efficiency of wheat resisting the gibberellic disease is greatly improved.
Description
One, technical field
The invention provides the molecule marking method that wheat Wangshuibai anti gibberellic disease infects major gene loci, belong to the molecular genetics field, be exclusively used in the seed selection of wheat scab disease-resistant variety and the utilization of germ plasm resource.
Two, technical background
Wheat is the important food crop of China.By the wheat scab that gibberella causes, not only cause the serious underproduction of wheat, reduce grain quality, and the toxin deoxynivalenol that this germ produces also influences people, animal health, caused very big loss to Wheat Production.In China, the harm that suffers head blight above 1/4th wheat belt is arranged, and just once be very popular every 3 ~ 5 years, only head blight generation area in 2002 promptly reaches 30,000,000 mu times.Therefore, research prevents and treats wheat scab and has also just become a urgent task on the current wheat breeding.Cultivating disease-resistant variety is to prevent and treat the safest, effective of wheat scab harm and save one of measure of cost.But traditional breeding way is wasted time and energy, and because the head blight phenotypic evaluation is very difficult, makes the wheat anti gibberellic disease breeding process slow unusually.Identify that by the location disease-resistant major gene loci comes assistant breeding effectively to address this problem.
Genetic research shows that wheat scab is controlled by a few major gene loci mainly, and its disease-resistant major gene loci position on karyomit(e) of different resistant materials is inconsistent, and be divided into anti-infect and resist expand two types.But the polymerization by the disease-resistant major gene loci of difference or introduce new anti-source and can select the good kind of resistance.
At present focusing mostly in Soviet Union wheat No. 3 and derive in the utilization of the research of scab resistance hereditary basis and breeding for disease resistance is, and to the utilization research in other anti-source seldom.Wangshuibai is the distinctive local variety in China Jiangsu, has high and stable scab resistance.Up to the present find the wheat breed stronger as yet, and it carries the resistant gene (Liao Yu ability 1985) that is different from Soviet Union wheat No. 3 than its resistance.
Three, summary of the invention
Technical problem
The objective of the invention is: provide wheat Wangshuibai anti gibberellic disease to infect the molecule marking method of major gene loci.Infect the chain molecule marker of major gene loci by detection and these are anti-, can define the scab resistance that no anti gibberellic disease infects major gene loci and predicts wheat plant, accelerate the selection progress of wheat-resistance to scab.
Technical scheme
Wheat Wangshuibai anti gibberellic disease infects the molecule marking method of major gene loci, it is characterized in that:
Use labeled primer Xgwm539,
Left end primer sequence CTGCTCTAAGATTCATGCAACC
Right-hand member primer sequence GAGGCTTGTGCCCTCTGTAG
Amplification wheat anti gibberellic disease kind or breeding material DNA, if can amplify the amplified fragments of 157bp, then indicate the existence that wheat Wangshuibai anti gibberellic disease infects major gene loci Qfhs.nau-2d, wherein this major gene loci is positioned at wheat Wangshuibai 2D karyomit(e), utilize Data desk v.5.0 software record with the incoherent probability P value of scab resistance be 0.005, to the contribution rate 11.4% of scab resistance;
Perhaps use labeled primer Xbarc184,
Left end primer sequence TTCGGTGATATCTTTTCCCCTTGA
Right-hand member primer sequence CCGAGTTGACTGTGTGGGCTTGCTG
Amplification wheat anti gibberellic disease kind or breeding material DNA, if can amplify the amplified fragments of 210bp, then indicate the existence that wheat Wangshuibai anti gibberellic disease infects major gene loci QFhs.nau-4a, wherein this major gene loci is positioned at wheat Wangshuibai 4A karyomit(e), utilize Data desk v.5.0 software record with the incoherent probability P value of scab resistance be 0.0042, to the contribution rate 11.7% of scab resistance;
Perhaps use labeled primer Xbarc056,
Left end primer sequence GCGGGAATTTACGGGAAGTCAAGAA
Right-hand member primer sequence GCGAGTGGTTCAAATTTATGTCTGT
Amplification wheat anti gibberellic disease kind or breeding material DNA, if can amplify the amplified fragments of 120bp, then indicate the existence that wheat Wangshuibai anti gibberellic disease infects major gene loci QFhs.nau-5a, wherein this major gene loci is positioned at wheat Wangshuibai 5A karyomit(e), utilize Data desk v.5.0 software record with the incoherent probability P value of scab resistance less than 0.0001, to the contribution rate 22.3% of scab resistance;
Perhaps use labeled primer Xgwm408,
Left end primer sequence TCGATTTATTTGGGCCACTG
Right-hand member primer sequence GTATAATTCGTTCACAGCACGC
Amplification wheat anti gibberellic disease kind or breeding material DNA, if can amplify the amplified fragments of 188bp, then indicate the existence that wheat Wangshuibai anti gibberellic disease infects major gene loci QFhs.nau-5b, wherein this major gene loci is positioned at wheat Wangshuibai 5B karyomit(e), utilize Data desk v.5.0 software record with the incoherent probability P value of scab resistance be 0.0014, to the contribution rate 13.5% of scab resistance;
Perhaps use labeled primer Xgwm537,
Left end primer sequence ACATAATGCTTCCTGTGCACC
Right-hand member primer sequence GCCACTTTTGTGTCGTTCCT
Amplification wheat anti gibberellic disease kind or breeding material DNA, if can amplify the amplified fragments of 235bp, then indicate the existence that wheat Wangshuibai anti gibberellic disease infects major gene loci QFhs.nau-7b2, wherein this major gene loci is positioned at wheat Wangshuibai 7B karyomit(e), utilize Data desk v.5.0 software record with the incoherent probability P value of scab resistance be 0.0014, to the contribution rate 14.2% of scab resistance.
The process of screening above-mentioned labeled primer is as follows:
(1) wheat breed Wangshuibai (♀) and Nanjing University 2419 (♂) hybridize and obtain hybrid F1, and the F1 selfing produces F2, adopts simple grain transmission method (SSD) to obtain the F6 RIL in generation then;
(2) extract the DNA that each strain of recombinant inbred lines is with the SDS method, adopt simple repeated sequence mark SSR that two parents are carried out the polymorphism screening, PCR carries out on PE9600 amplification instrument, amplified production carries out the electrophoretic separation analysis on 8% (g/ml) polyacrylamide gel, according to the molecular marker screening result, filtering out has polymorphic primer between the parent, has polymorphic primer to analyze in recombinant inbred lines between the parent, the pcr amplification program is the same, obtains colony's genotype data;
(3) according to chain exchange rule, utilize colony's genotype data to make up the genetic map of wheat, used software is Mapmaker 2.0, minimum LOD value is made as 3, obtains linkage map;
(4) blooming stage inoculation head blight pathogenic bacteria carries out scab resistance to each family of RIL and identifies, obtains the disease tassel yield of each family of RIL;
(5) utilize Data desk v.5.0 software carry out linkage analysis to colony's genotype data of each molecule marker with disease tassel yield that the scab resistance of its corresponding each family is identified, One-way ANOVA records and the incoherent probability P value of scab resistance, the molecule marker of P＜0.05 is promptly chain with a major gene loci, anti gibberellic disease infects the position of major gene loci and is determined by the chromosome position of molecule marker: the Xgwm539 mark of finding P=0.005 in Wangshuibai, the Xbarc184 mark of P=0.0042, the Xbarc056 mark of P≤0.0001, the Xgwm408 mark of P=0.0014 and the Xgwm537 mark of P=0.0014 and anti-major gene loci close linkage, the Xgwm539 of infecting, Xbarc184, Xbarc056, Xgwm408 and Xgwm537 are the anti-major gene loci QFhs.nau-2d that infects of labeling wheat Wangshuibai, QFhs.nau-4a, QFhs.nau-5a, QFhs.nau-5b, the labeled primer of QFhs.nau-7b2;
Perhaps the linkage group that major gene loci is arranged is carried out interval mapping analysis with Map Manager QTX software, the peak of curve position is a major gene loci, obtains the anti-labeled primer Xbarc056 that infects major gene loci QFhs.nau-5a of mark Wangshuibai equally.
Beneficial effect
Wheat Wangshuibai anti gibberellic disease provided by the present invention infects the molecule marking method of major gene loci, has the following advantages:
(1) obtains to have located 5 major gene locis that anti gibberellic disease infects in the wheat breed Wangshuibai in the world first by molecule marker of the present invention, their scab resistances of common soluble 79.8%.The wheat cdna group is huge, is 40 times of rice genome size, and the accurate location work of wheat anti gibberellic disease major gene loci is occupy the same domain prostatitis;
(2) by the localized major gene loci locality specific of molecule marker mark of the present invention, it is convenient to identify.Infect the chain molecule marker of major gene loci by detecting these with anti-, can define no anti gibberellic disease and infect major gene loci, and predict the scab resistance of wheat plant, and then rapid screening disease-resistant variety or strain are used for wheat breeding.Major gene loci easy to detect fast, not affected by environment;
(3) the assistant breeding select target is clear and definite, saves cost.In traditional breeding way, at first to collect parent and Cultivar and carry out a series of hybridization, and will carry out individual plant to scab resistance and select with disease-resistant gene.Wheat scab is carried out phenotypic evaluation will wait until blooming stage, be subjected to bigger environmental influence, the result reliability of phenotypic evaluation is low.Therefore breeding for disease resistance is not only time-consuming, and difficulty is big, the cost height.By detecting the anti gibberellic disease major gene loci, can just identify the individual plant of high anti gibberellic disease in seedling stage, eliminate other plant, not only save production cost but also improve the efficiency of selection of wheat-resistance to scab greatly.
Four, description of drawings
Fig. 1 is the interval distribution plan of Wangshuibai linkage chromosome map and major gene loci
The left side is the chromosomal inheritance linkage map, and the map distance between mark marks with data; The graphic representation on the right is the interval graph of major gene loci, and two straight lines are respectively the expected value and remarkable value that has major gene loci, exceed the second straight line and promptly show major gene loci of existence.
Five, embodiment
Studies show that wheat scab resistance is controlled by the minority major gene loci mainly.U.S. Anderson laboratory finds that the scab resistance of No. 3/Stoa of four major gene locis and Soviet Union wheat colony is significantly relevant, lays respectively at 2AL, 3BS, 4BS and 6BS and goes up (Anderson, 1998; Waldron, 1999; Anderson, 2000,2001).People such as U.S. Bai obtain two the scab resistance sites relevant with the RAPD mark, and Zhou integrated use SSR, AFLP in 2002 and aneuploid technology are positioned at this major gene loci that to lack be that 3BS-8 does not hold a last length to be about the chromosomal region of 8cM.Japan Ban infers that the resistance main effect gene locus of Soviet Union wheat 3 may be positioned on the 5AL.Austrian Buerstmayr (2000,2001) finds that three genome areas and the anti-extendability significant correlation of head blight are arranged, and is positioned on 3BS, 5A, the 1B.Find by the present invention, on 2D, 4A, 5A, 5B and the 7B karyomit(e) of Wangshuibai, have 5 anti-major gene locis that infect respectively.These major gene locis can be used to instruct the seed selection work of anti gibberellic disease kind, but screen with chain with it molecule marker enantiopathy kind, make different disease-resistant major gene loci rapid polymerizations in same plant, thereby improve breeding efficiency greatly.
Materials and methods:
(1) structure of Wangshuibai RIL and phenotypic evaluation:
(1) choosing to China's Jiangsu local variety Wangshuibai (♀) and Italian wheat breed Mentana is that acquisition F1 is hybridized in Nanjing University 2419 (♂), the F1 selfing produces F2,136 optional seed plantations of F2 individual plant, the method that adopts simple grain to pass is bred F6 generation, obtain RIL, comprise 136 familys;
(2) RIL is planted in the academy of agricultural sciences, Jiangsu Province, allows its natural occurrence, blooms and identifies its disease tassel yield in back 20 days.Disease tassel yield=sick spike number/total spike number * 100%
(2) molecular marker analysis of recombinant inbred lines
(1) extracting each strain of recombinant inbred lines with the SDS method is DNA.
(2) at first Wangshuibai and 2419 parents' of Nanjing University dna polymorphism is carried out initial analysis with 976 pairs of SSR primers.The PCR reaction volume is 25 microlitres, 10 * buffer, 2.5 microlitres wherein, 25mM MgCl
21.5 microlitre, 2.5mM dNTPs 2 microlitres, Taq enzyme (5 units/microlitre) 0.2 microlitre, template DNA 20 nanograms add water to 25 microlitres.After the SSR reaction system is 94 ℃ of pre-sex change 3min of DNA, 94 ℃ of sex change 1min, 60 ℃ of annealing 1min, 72 ℃ are extended exhibition 2min, circulate 35 times, and last 72 ℃ are extended 10min.In the enterprising performing PCR amplification of PE 9600 amplification instrument, amplified production carries out electrophoretic separation on 8% non-denaturing polyacrylamide gel (containing 7.6 gram acrylamides and 0.4 gram methylene diacrylamide in the 100ml polyacrylamide solution), on ultraviolet transilluminator, take a picture then, the record result, there is polymorphic primer in recombinant inbred lines, to analyze between the parent, obtains colony's genotype data;
(3) according to chain exchange rule, utilize colony's genotype data to make up the genetic map of wheat, used software is Mapmaker 2.0, minimum LOD value is made as 3, obtains linkage map;
(4) v.5.0 software and Map Manager QTX software carry out linkage analysis, gene location to colony's genotype data of each molecule marker with disease tassel yield that the scab resistance of its corresponding each family is identified to utilize Data desk.
(3) result and analysis:
Molecular marker screening is the result show, has 383 pairs of SSR primers variant between parents.Utilize Data deskv.5.0 software to carry out linkage analysis to colony's genotype data of each molecule marker with disease tassel yield that the scab resistance of its corresponding each family is identified, One-way ANOVA records and the incoherent probability P value of scab resistance and the site contribution rate R to scab resistance
2(table 2), the molecule marker of P＜0.05 are promptly chain with a major gene loci.The genotype of gained molecule marker in colony is by the genotype classification of parent's Wangshuibai and Nanjing University 2419, if the strain that genotype is identical with Wangshuibai is a phenotype is anti-, then the localized disease-resistant gene of this mark is from Wangshuibai: the Xgwm539 mark of finding P=0.005 in Wangshuibai, the Xbarc184 mark of P=0.0042, the Xbarc056 mark of P≤0.0001, the Xgwm408 mark of P=0.0014 and the Xgwm537 mark of P=0.0014 and the anti-major gene loci close linkage that infects, by the anti-major gene loci QFhs.nau-2d that infects of Xgwm539 mark location Wangshuibai, this major gene loci is positioned at 2D karyomit(e), R
2=11.4%, infect major gene loci QFhs.nau-4a by Xbarc184 mark location Wangshuibai is anti-, this major gene loci is positioned at 4A karyomit(e), R
2=11.7%, infect major gene loci QFhs.nau-5a by Xbarc056 mark location Wangshuibai is anti-, this major gene loci is positioned at 5A karyomit(e), R
2=22.3%, infect major gene loci QFhs.nau-5b by Xgwm408 mark location Wangshuibai is anti-, this major gene loci is positioned at 5B karyomit(e), R
2=13.5%, infect major gene loci QFhs.nau-7b2 by Xgwm537 mark location Wangshuibai is anti-, this major gene loci is positioned at 7B karyomit(e), R
2=14.2%.Perhaps the linkage group that major gene loci is arranged is carried out interval mapping analysis with Map Manager QTX software, the peak of curve position is a major gene loci.Show equally by the anti-major gene loci QFhs.nau-5a that infects of Xbarc056 mark location Wangshuibai.
Predict the wheat plant resistance by above-mentioned molecular markers for identification major gene loci, expectation can improve the breeding process of China's disease-resistant wheat kind rapidly.
The sequence of table 1. labeled primer and amplified fragments size
| Mark left end primer sequence | The right-hand member primer sequence | Clip size (bp) |
| Xgwm539CTGCTCTAAGATTCATGCAACC Xbarc184TTCGGTGATATCTTTTCCCCTTGA Xbarc056GCGGGAATTTACGGGAAGTCAAGAA Xgwm408TCGATTTATTTGGGCCACTG Xgwm537ACATAATGCTTCCTGTGCACC | GAGGCTTGTGCCCTCTGTAG CCGAGTTGACTGTGTGGGCTTGCTG GCGAGTGGTTCAAATTTATGTCTGT GTATAATTCGTTCACAGCACGC GCCACTTTTGTGTCGTTCCT | 157 210 120 188 235 |
The anti-One-way ANOVA that infects major gene loci of table 2. Wangshuibai
| Major gene loci | Mark | Disease tassel yield | |
| P | R 2(％) | ||
| QFhs.nau-2d | Xgwm539 | 0.005 | 11.4 |
| QFhs.nau-4a | Xbarc184 | 0.0042 | 11.7 |
| QFhs.nau-5a | Xbarc056 | ≤0.0001 | 22.3 |
| QFhs.nau-5b | Xgwm408 | 0.0014 | 13.5 |
| QFhs.nau-7b2 | Xgwm537 | 0.0014 | 14.2 |
P: expression and the incoherent probability of scab resistance, P＜0.05 shows this mark and scab resistance close linkage
R
2: the site is to the contribution rate of scab resistance, value is big more show relevant more with scab resistance
Claims (2)
1, wheat Wangshuibai anti gibberellic disease infects the molecule marking method of major gene loci, it is characterized in that:
Use labeled primer Xgwm539,
Left end primer sequence CTGCTCTAAGATTCATGCAACC
Right-hand member primer sequence GAGGCTTGTGCCCTCTGTAG
Amplification wheat anti gibberellic disease kind or breeding material DNA, if can amplify the amplified fragments of 157bp, then indicate the existence that wheat Wangshuibai anti gibberellic disease infects major gene loci Qfhs.nau-2d, wherein this major gene loci is positioned at wheat Wangshuibai 2D karyomit(e), utilize Data desk v.5.0 software record with the incoherent probability P value of scab resistance be 0.005, to the contribution rate 11.4% of scab resistance;
Perhaps use labeled primer Xbarc184,
Left end primer sequence TTCGGTGATATCTTTTCCCCTTGA
Right-hand member primer sequence CCGAGTTGACTGTGTGGGCTTGCTG
Amplification wheat anti gibberellic disease kind or breeding material DNA, if can amplify the amplified fragments of 210bp, then indicate the existence that wheat Wangshuibai anti gibberellic disease infects major gene loci QFhs.nau-4a, wherein this major gene loci is positioned at wheat Wangshuibai 4A karyomit(e), utilize Data desk v.5.0 software record with the incoherent probability P value of scab resistance be 0.0042, to the contribution rate 11.7% of scab resistance;
Perhaps use labeled primer Xbarc056,
Left end primer sequence GCGGGAATTTACGGGAAGTCAAGAA
Right-hand member primer sequence GCGAGTGGTTCAAATTTATGTCTGT
Amplification wheat anti gibberellic disease kind or breeding material DNA, if can amplify the amplified fragments of 120bp, then indicate the existence that wheat Wangshuibai anti gibberellic disease infects major gene loci QFhs.nau-5a, wherein this major gene loci is positioned at wheat Wangshuibai 5A karyomit(e), utilize Data desk v.5.0 software record with the incoherent probability P value of scab resistance less than 0.0001, to the contribution rate 22.3% of scab resistance;
Perhaps use labeled primer Xgwm408,
Left end primer sequence TCGATTTATTTGGGCCACTG
Right-hand member primer sequence GTATAATTCGTTCACAGCACGC
Amplification wheat anti gibberellic disease kind or breeding material DNA, if can amplify the amplified fragments of 188bp, then indicate the existence that wheat Wangshuibai anti gibberellic disease infects major gene loci QFhs.nau-5b, wherein this major gene loci is positioned at wheat Wangshuibai 5B karyomit(e), utilize Data desk v.5.0 software record with the incoherent probability P value of scab resistance be 0.0014, to the contribution rate 13.5% of scab resistance;
Perhaps use labeled primer Xgwm537,
Left end primer sequence ACATAATGCTTCCTGTGCACC
Right-hand member primer sequence GCCACTTTTGTGTCGTTCCT
Amplification wheat anti gibberellic disease kind or breeding material DNA, if can amplify the amplified fragments of 235bp, then indicate the existence that wheat Wangshuibai anti gibberellic disease infects major gene loci QFhs.nau-7b2, wherein this major gene loci is positioned at wheat Wangshuibai 7B karyomit(e), utilize Data desk v.5.0 software record with the incoherent probability P value of scab resistance be 0.0014, to the contribution rate 14.2% of scab resistance.
2, wheat Wangshuibai anti gibberellic disease according to claim 1 infects the molecule marking method of major gene loci, it is characterized in that the process of screening above-mentioned labeled primer is as follows:
(1) the wheat breed Wangshuibai obtains hybrid F1 as maternal hybridization with male parent Nanjing University 2419, and the F1 selfing produces F2, adopts simple grain transmission method (SSD) to obtain the F6 RIL in generation then;
(2) extract the DNA that each strain of recombinant inbred lines is with the SDS method, adopt simple repeated sequence mark SSR that two parents are carried out the polymorphism screening, PCR carries out on PE9600 amplification instrument, amplified production carries out the electrophoretic separation analysis on the 8%g/ml polyacrylamide gel, according to the molecular marker screening result, filtering out has polymorphic primer between the parent, has polymorphic primer to analyze in recombinant inbred lines between the parent, the pcr amplification program is the same, obtains colony's genotype data;
(3) according to chain exchange rule, utilize colony's genotype data to make up the genetic map of wheat, used software is Mapmaker 2.0, minimum LOD value is made as 3, obtains linkage map;
(4) blooming stage inoculation head blight pathogenic bacteria carries out scab resistance to each family of RIL and identifies, obtains the disease tassel yield of each family of RIL;
(5) utilize Data desk v.5.0 software carry out linkage analysis to colony's genotype data of each molecule marker with disease tassel yield that the scab resistance of its corresponding each family is identified, One-way ANOVA records and the incoherent probability P value of scab resistance, the molecule marker of P＜0.05 is promptly chain with a major gene loci, anti gibberellic disease infects the position of major gene loci and is determined by the chromosome position of molecule marker: the Xgwm539 mark of finding P=0.005 in Wangshuibai, the Xbarc184 mark of P=0.0042, the Xbarc056 mark of P≤0.0001, the Xgwm408 mark of P=0.0014 and the Xgwm537 mark of P=0.0014 and anti-major gene loci close linkage, the Xgwm539 of infecting, Xbarc184, Xbarc056, Xgwm408 and Xgwm537 are the anti-major gene loci QFhs.nau-2d that infects of labeling wheat Wangshuibai, QFhs.nau-4a, QFhs.nau-5a, QFhs.nau-5b, the labeled primer of QFhs.nau-7b2;
Perhaps the linkage group that major gene loci is arranged is carried out interval mapping analysis with Map Manager QTX software, the peak of curve position is a major gene loci, obtains the anti-labeled primer Xbarc056 that infects major gene loci QFhs.nau-5a of mark Wangshuibai equally.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 03131962 CN1246478C (en) | 2003-06-23 | 2003-06-23 | Molecule marker method of wheat Wangshuibai scab resistant major gene locus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 03131962 CN1246478C (en) | 2003-06-23 | 2003-06-23 | Molecule marker method of wheat Wangshuibai scab resistant major gene locus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1462808A CN1462808A (en) | 2003-12-24 |
| CN1246478C true CN1246478C (en) | 2006-03-22 |
Family
ID=29748490
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 03131962 Expired - Fee Related CN1246478C (en) | 2003-06-23 | 2003-06-23 | Molecule marker method of wheat Wangshuibai scab resistant major gene locus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1246478C (en) |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100336905C (en) * | 2004-05-08 | 2007-09-12 | 南京农业大学 | Wheat fertility recovery gene molecular mark and its obtaining method |
| CN102586291B (en) * | 2011-12-20 | 2013-05-29 | 南京农业大学 | Receptor protein kinase gene and expression vector and application thereof |
| CN103146699B (en) * | 2012-03-27 | 2014-07-02 | 南京农业大学 | Molecular marker MAG7237 of wheat fusarium head blight infection resistant gene Fhb4 and application of molecular marker MAG7237 |
| CN103834647B (en) * | 2014-03-17 | 2016-03-30 | 中国农业科学院作物科学研究所 | Wheat Dwarfing gene Rht dC20closely linked SSR marker Xgwm537 and uses thereof |
| CN104911266A (en) * | 2015-06-10 | 2015-09-16 | 姜朋 | Wheat grain and flour low-protein-content related molecular marker |
| CN105176985B (en) * | 2015-09-28 | 2019-01-15 | 郑州大学 | The SSR molecular marker primer and purposes and screening technique of distant hybridization wheat |
| CN113179947B (en) * | 2021-05-10 | 2022-07-29 | 江苏里下河地区农业科学研究所 | Breeding method of high-yield disease-resistant strong gluten wheat in middle and lower Yangtze river regions |
| CN115044697B (en) * | 2022-05-31 | 2023-03-21 | 江苏省农业科学院 | Molecular marker related to accumulation of DON toxin in wheat grains and primer and application thereof |
-
2003
- 2003-06-23 CN CN 03131962 patent/CN1246478C/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN1462808A (en) | 2003-12-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Nassiry et al. | Analysis and frequency of bovine lymphocyte antigen (BoLA-DRB3) alleles in Iranian Holstein cattle | |
| CN108165656B (en) | Wheat molecular marker and application thereof in identification of wheat powdery mildew resistance | |
| CN112080582B (en) | KASP molecular marker closely linked with major QTL locus of wheat spike length and application thereof | |
| CN108504752B (en) | Molecular marker associated with sow breeding traits and application | |
| CN105200160B (en) | A kind of relevant SNP marker of dissolved oxygen tolerance low to litopenaeus vannamei and its screening and application | |
| Lu et al. | Identification of high-efficiency SSR markers for assessing watermelon genetic purity | |
| CN1246478C (en) | Molecule marker method of wheat Wangshuibai scab resistant major gene locus | |
| CN102140506B (en) | Molecular marker linked with gummy stem blight resistance gene Gsb-2 and application thereof | |
| CN106048042A (en) | Single nucleotide polymorphism marker site, primers and reagent kit for identifying peach fruit flesh color characteristic and application | |
| CN1246479C (en) | Molecule marker method of wheat Wangshuibai scab resistant major gene locus | |
| CN112899376B (en) | Method for detecting economic traits of Tibetan chicken by FOXO1 gene SNP marker and application thereof | |
| CN105238866B (en) | One SNP site related to upland cotton Early mature apricot and its application | |
| Tabassum et al. | Analysis of genetic diversity in eleven tomato (Lycopersicon esculentum Mill.) varieties using RAPD markers | |
| CN101403006A (en) | Screening method for species group with heterosis of germany mirror carp | |
| CN1858256A (en) | Method for screening stripe rust resisting wheat and its special primer | |
| CN1246476C (en) | Molecule marker method of wheat Nanda 2419 scab resistant major gene locus | |
| CN112430673A (en) | Reagent for detecting SNP locus genotype related to resistance of grouper nervous necrosis virus | |
| de Oliveira et al. | Dominant versus codominant marker aiming to characterize Capsicum spp. | |
| CN112375827A (en) | SNP marker related to growth of macrobrachium rosenbergii as well as typing method and application thereof | |
| CN1246477C (en) | Molecule marker method of wheat Nanda 2419 scab resistant major gene locus | |
| Talebi et al. | Molecular characterization of'Carthamus tinctorius' and'C. oxyacanthus' germplasm using sequence related amplified polymorphism (SRAP) markers | |
| CN114231639B (en) | Method for identifying or assisting in identifying area of porcine eye muscle and application thereof | |
| Chen et al. | RAPD variation and genetic distances among Tibetan, Inner Mongolia and Liaoning Cashmere goats | |
| Mohindra et al. | Genetic identification of three species of the genus Clarias using allozyme and mitochondrial DNA markers | |
| CN103146699A (en) | Molecular marker MAG7237 of wheat fusarium head blight infection resistant gene Fhb4 and application of molecular marker MAG7237 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |