CN115044697B - Molecular marker related to accumulation of DON toxin in wheat grains and primer and application thereof - Google Patents

Abstract

The invention discloses a molecular marker related to the accumulation of DON toxin in wheat grains and its application. The molecular marker is based on common wheat genome DNA as a template, and the nucleotide sequences are respectively shown in SEQ ID NO.1 and SEQ ID NO.2. PCR amplification with the primer pair shown, and the results were obtained after electrophoresis on 1% agarose gel. The size of the amplified product was 214bp; the molecular marker amplification time was short and the efficiency was high, and it could be applied to the genotype analysis of wheat populations and genetic mapping of loci for resistance to grain toxin accumulation.

Description

Molecular markers and their primers and applications related to the accumulation of DON toxin in wheat grains

technical field

The invention belongs to the field of wheat genetic breeding and molecular biology, in particular to a molecular marker related to wheat grain toxin accumulation and its application.

Background technique

Wheat scab is an important fungal disease caused by Fusarium graminearum, which seriously affects the yield and quality of wheat. In general epidemic years, head blight can cause 5-10% yield loss, and in pandemic years, some fields may fail to harvest, endangering wheat food security. The mycotoxin deoxynivalenol (DON) secreted by Fusarium graminearum is a cytotoxin, which is listed as a class 3 carcinogen and can cause immunosuppressive or immunostimulatory reactions. The accumulation of DON toxin in wheat grains poses a threat to the health of humans and livestock. Acute poisoning symptoms such as anorexia, vomiting, and diarrhea will occur after eating food contaminated with DON toxin. In severe cases, it may cause circulatory system damage and death. According to the limit requirements for mycotoxins in food in the national food safety standard GB2761-2017, the DON toxin content in grains and their products such as corn (flour, dregs), barley, wheat, oatmeal and wheat flour shall not exceed 1mg/kg.

Wheat head blight resistance can be divided into five types: Ⅰ, resistance to infection; Ⅱ, resistance to expansion; Ⅲ, resistance to grain toxin accumulation; Ⅳ, resistance to kernel infection; Ⅴ, disease tolerance (Mesterházy 1995; Mesterházy et al. 1999). Toxin accumulation resistance specifically refers to the reduction of toxin accumulation caused by the degradation of toxins in wheat grains or the inhibition of toxin production, which has a genetic mechanism different from other types of resistance. Szabó-Hevér et al. detected resistance to grain toxin accumulation loci on chromosomes 3A, 4B, 7A and 7B of wheat "Frontana", explaining 3.1-11.1% of the phenotypic variation (Szabó-Hevér et al., 2014). Through genetic mapping, a stable QTL locus was detected on chromosome 7A, which could explain 16-24% of the phenotypic variation (He et al., 2019). A locus associated with resistance to grain toxin accumulation was detected on the 2AS chromosome of the Norwegian wheat variety "NK93604", which could explain 26.7% of the phenotypic variation, but it was detected in only one environment (Semagn et al., 2007). In addition, in "Wangshuibai" chromosomes 1A, 1BL, 3BS, 5AS, 5DL and 7A (Yu et al.2008), "Ernie" chromosomes 4DS and 6AL (Liu et al., 2013), "Wuhan-1" The 2DS and 5AS chromosomes (Somers et al., 2003), and the 1A, 2A, 2D, 3AS, 5BL, 5A and 6A chromosomes of "SHA3/CBRD" (Lu et al., 2012) have also detected minor QTLs site. Loci associated with toxin-resistant accumulation were also detected in the American and International Wheat and Maize Improvement Center (CIMMYT) populations using genome-wide association analysis. These loci are distributed on chromosomes 3B, 1D, 2B, 3A, and 2BL, explaining that 12% phenotypic variation (Arruda et al., 2016; Wang et al., 2017). The development of markers for the above loci is based on single nucleotide polymorphisms or simple repeat sequence polymorphisms, which are difficult to use directly, or require cumbersome typing steps, and are not suitable for large-scale germplasm screening or molecular marker-assisted selection.

In addition, the molecular markers related to wheat grain toxin accumulation were used to type the genetic population. On the basis of drawing the genetic map, the locus of grain toxin resistance accumulation in the Chinese wheat variety "Sumai No. An important step in genetic improvement. Commonly used high-throughput typing methods are based on genomic single nucleotide polymorphisms. The design and manufacture of typing chips rely on imports, and the cost of typing is high, making it difficult to form large-scale R&D positioning.

Contents of the invention

In response to the above problems, the present invention obtained a new excellent allelic variation site related to wheat grain toxin accumulation (located at 644438701bp on chromosome 7B, and the reference sequence is Chinese spring v1.0) through genome-wide association analysis and physical position comparison , and designed a polymerase chain reaction-based molecular marker JAASM3424. This molecular marker can be used to analyze the correlation between the genotypes of different wheat varieties at this locus and the accumulation of DON toxin in wheat grains, and to draw genetic maps.

Specifically, the present invention is realized like this:

First of all, this application provides a molecular marker JAASM3424 related to the accumulation of DON toxin in wheat grains. The molecular marker is based on the DNA of wheat variety Anong 8455 as a template, and the nucleotide sequences are respectively such as SEQ ID NO.1 and SEQ ID NO. .2 The sequence shown in 2 is a primer for PCR amplification, and the amplified product is electrophoresed on an agarose gel with a mass percentage of 1%, and a DNA fragment with a size of 214bp is obtained.

The above PCR amplification system: 1 μl of 10×buffer, 0.5 μl of MgCl ₂ solution with a concentration of 25 mM, 0.5 μl of dNTP solution with a concentration of 2.5 mM, 0.5 μl of primer I with a concentration of 10 μM, 0.5 μl of primer II with a concentration of 10 μM, Taq polymerase 0.2 μl of 5U/μl, template DNA 50ng, ddH ₂ O supplemented to 10 μl; the nucleotide sequence of the primer I is shown in SEQ ID NO.1, and the nucleotide sequence of the primer II is shown in SEQ ID NO.1 As shown in ID NO.2;

PCR amplification program: 94°C for 3 minutes; 94°C for 10 seconds, 60°C for 30 seconds, 72°C for 10 seconds, 30 cycles; 72°C for 5 minutes.

Secondly, the present application provides the application of the above-mentioned molecular marker JAASM3424 in screening wheat germplasm with low accumulation of DON toxin. Its specific application steps are as follows: use the sample wheat DNA as a template, and use nucleotide sequences such as SEQ ID NO.1 and SEQ ID NO.2 as primers to carry out PCR amplification, and the amplified products are prepared in agarose with a mass percentage of 1%. Electrophoresis on the gel, if there is a DNA fragment with a size of 214bp in the electrophoresis product, it is determined that the sample contains the molecular marker JAASM3424; The molecular marker JAASM3424 of the wheat variety.

Further, the above-mentioned "wheat" includes but not limited to Wangshuibai, Sumai 3, Ning 7840, Ningmai 8, Xiaoyan 22, Ning 98081, Jimai 20, Wanmai 44, Annong 8455, BORLAUG100 F2014 , GONDO, IOC 813, ITAPUA 45-DON PANI, KLEIN DON ENRIQUE, LAS ROSAS INTA, LAUREANO ALVAREZ, MARINGA, ONCATIVO-INTA, PERGAMINO GABOTO, PRINIA, PROINTAFEDERAL, PROINTAGRANAR, PROINTAOASIS, QUAIU#1, QUELEA, SABUF, SPINEBILL THORNBIRD, VALK, VL 616, WAXBILL, Jinan 17, Laizhou 95021, Lian 9791-4, Mian 2000-1-37, Nannong 9918, Ningfeng 518, Ningmai 10, Ningmai 11, Ningmai 12, Ningmai 15 , Ningmai 17, Ningmai 19, Ningmai 21, Ningmai 22, Ningmai 9, Shannong 9625, Shengkang 1, Shengkang 2, Shengxuan 3, Shengxuan 4 and other domestic and foreign wheat varieties/lines and their Derived varieties/lines; said derived varieties refer to wheat varieties/lines containing the genetic material of the above-mentioned wheat varieties/lines obtained by crossing, backcrossing, natural or artificial mutation.

The above PCR amplification system: 10×buffer 1 μl, MgCl ₂ solution (25 mM concentration) 0.5 μl, dNTP solution (2.5 mM concentration) 0.5 μl, primer SEQ ID NO.1 (10 μM concentration) 0.5 μl, primer SEQ ID NO.2 (10μM) 0.5μl, Taq polymerase (concentration: 5U/μl) 0.2μl, template DNA 50ng, ddH ₂ O make up to 10μl; PCR amplification program: 94°C for 3 minutes; 94°C for 10 seconds, 60°C 30 seconds, 10 seconds extension at 72°C, 30 cycles; 5 minutes extension at 72°C.

Thirdly, the present application provides a pair of primers for predicting the accumulation of DON toxin in wheat grains. The nucleotide sequences of the primers are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively.

Fourth, the present invention also provides the application of the above-mentioned molecular marker JAASM3424 in drawing the genetic map of wheat grain toxin accumulation sites. The specific steps are: using the genetic population DNA of Sumai 3 and Anong 8455 as templates, SEQ ID NO .1 and SEQ ID NO.2 are primers for PCR amplification. After the amplified product is electrophoresed on an agarose gel with a mass percentage of 1%, if there is a DNA fragment with a size of 214bp, the genotype is recorded as "0". ; If there is no above-mentioned amplified fragment, the genotype is recorded as "2". After genotype data were collected, genetic maps were drawn using QTL Icimapping software.

This application anchors the single nucleotide polymorphism variation in the genome and designs site-specific molecular markers based on polymerase chain reaction, which can reduce typing costs, simplify typing steps, and improve the efficiency of molecular marker-assisted selection. efficiency. Compared with the prior art, the molecular marker primer pair in the present invention is obtained through manual comparison, and the position of the end of the primer is artificially adjusted to anchor the variation site to ensure the accuracy of the amplification product. The molecular marker primers in the present invention artificially introduce mismatched bases to ensure the specific amplification of the target sequence. The molecular markers in the present invention will be used for genetic mapping of toxin accumulation sites in wheat grains, laying a foundation for identifying related genes/QTLs and linkage markers. The primers obtained in the present invention have good specificity for the amplification result, short time required for amplification, and accurate interpretation of the genotype result.

Description of drawings

Fig. 1 is the amplification result of software design molecular marker P1 and P2 primer pair in different varieties (lines);

Among them, M: molecular weight standard DL2000, lanes 1-10 are wheat varieties (lines) Ning 894037, Wangshuibai, Sumai 3, Ning 7840, Ningmai 8, Xiaoyan 22, Ning 98081, Jimai 20, Wanmai 44 and Annong 8455.

Fig. 2 is the amplification result of the primer pair of molecular marker JAASM3424 in different varieties (lines);

Among them, M: molecular weight standard DL2000, lanes 1-10 are wheat varieties (lines) Ning 894037, Wangshuibai, Sumai 3, Ning 7840, Ningmai 8, Xiaoyan 22, Ning 98081, Jimai 20, Wanmai 44 and Annong 8455.

Figure 3 is a schematic diagram of the typing results using molecular marker JAASM3424 wheat grain toxin accumulation excellent allelic variation;

Among them, genotype 0 represents the allelic variation "C", and genotype 2 represents the allelic variation "T".

Figure 4 Schematic diagram of the typing results of the molecular marker JAASM3424 in the F _2:7 recombinant inbred line group of Sumai 3×Annong 8455;

Among them, M: molecular weight standard DL2000, lane 1-185 is the number of recombinant inbred line of genetic population, S is Sumai 3, and A is Annong 8455.

Figure 5. Genetic mapping using the molecular marker JAASM3424.

Detailed ways

The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials and reagents used in the following examples can be obtained from commercial sources unless otherwise specified.

Nucleotide sequences involved in the following examples:

SEQ ID NO. 1: GAGAATGATGAAGTGCATACATGAGC;

SEQ ID NO. 2: GAGGAAATTTTTGTCTGCAGTCTGC;

SEQ ID NO. 3: ATAGACTAAACCTCTTGGGAAGC;

SEQ ID NO. 4: TTTTGTTCTAAGTAATGGATGGC;

SEQ ID NO.5: GTATGGCGACTAGGAATACAAAA;

SEQ ID NO. 6: AGAATGCTAAACTTAGGAACGGA.

The source of material that embodiment relates to:

The wheat varieties (lines) such as Sumai No. 3 involved in the following examples: are conventional varieties (lines), preserved by the wheat genetics and breeding team of the Institute of Grain Crops, Jiangsu Academy of Agricultural Sciences;

Gibberella: Fusarium asiatica Fa0609, preserved by the wheat genetics and breeding team of the Institute of Food Crops, Jiangsu Academy of Agricultural Sciences.

Example 1 Verification of molecular marker JAASM3424 in different wheat varieties (lines)

The DNA templates amplified by PCR in this example come from the following wheat varieties (lines): Ning 894037, Wangshuibai, Sumai No. 3, Ning 7840, Ning Mai No. 8, and their excellent allelic variation is the base "T", And the content of DON toxin in the grain is low, respectively: 1.76mg/kg, 2.29mg/kg, 2.38mg/kg, 2.63mg/kg and 2.85mg/kg; Xiaoyan 22, Ning 98081, Jimai 20, Wanmai 44 , Annong 8455, its excellent allelic variation is the base "C", and the grain DON toxin content is higher, respectively: 25.80mg/kg, 2.83mg/kg, 28.7mg/kg, 29.3mg/kg and 29.8mg /kg. The above-mentioned wheat varieties were all planted in the scab identification nursery of the Wheat Genetics Team of the Institute of Food Crops, Jiangsu Academy of Agricultural Sciences (118.88°E, 32.03°N). After being inoculated with Fusarium rubella Fa0609 (concentration: 10 ⁵ conidia/μl) at the flowering stage, 10 diseased ears were harvested to measure the DON toxin content in the grain. The content of DON toxin in grain was detected by enzyme-linked immunosorbent reaction rapid detection kit (Beijing Huaan Maike, HEM1896-2). The genomic DNA of young leaves was extracted by CTAB method (Murray and Thompson, 1980), and the genomic DNA was quantified by a micro-spectrophotometer Nanodrop.

When using the software Primer Premier5.0 to design molecular marker primers for genomic sequences containing variant sites (644438701bp on chromosome 7B, the reference sequence is Chinese spring v1.0), the parameters are: amplification size 200-300bp, annealing temperature 55- 65°C, other parameters are the default, no artificial modification is performed, and the two pairs of primers with the highest scores are selected for the test. The primer pair P1 (its nucleotide sequence is shown in SEQ ID NO.3 and SEQ ID NO.4) and P2 ((its nucleotide sequence is shown in SEQ ID NO.5 and SEQ ID NO.6) using software design Show) carry out PCR amplification with above-mentioned wheat variety (line) as template:

The PCR reaction system is 10 μl: 10×buffer 1 μl, MgCl ₂ solution (25 mM concentration) 0.5 μl, dNTP solution (2.5 mM concentration) 0.5 μl, primer SEQ ID NO.1 (10 μM concentration) 0.5 μl, primer SEQ ID NO.2 (10μM) 0.5μl, Taq polymerase (concentration: 5U/μl) 0.2μl, template DNA 50ng, ddH ₂ O make up to 10μl;

PCR amplification program: 94°C for 3 minutes; 94°C for 10 seconds, 60°C for 30 seconds, 72°C for 10 seconds, 30 cycles; 72°C for 5 minutes.

The amplified products were detected by 1.0% agarose gel electrophoresis. The electrophoresis results are shown in Figure 1. P1 and P2 are the amplification results of the software-designed primer pairs P1 and P2 respectively. It can be seen that these two primer pairs cannot detect the excellent allelic variation. For effective amplification, non-specific amplification occurs in all templates, and the specificity and effectiveness of amplification need to be improved.

On this basis, the applicant artificially adjusted the anchor position of the end of the primer pair and adjusted the base type of the end on the basis of manual comparison of the variation site (644438701bp on chromosome 7B, the reference sequence is Chinese Spring v1.0) , and artificially mutated the third base at the end of the primer at the anchor position, changing from "C" to "A", improving the specificity of amplification, and obtaining the molecular marker JAASM3424 primer pair (SEQ ID NO.1 and SEQ ID.2) . With the above-mentioned variety (line) genomic DNA as a template, PCR amplification of SEQ ID NO.1 and SEQ ID NO.2 is carried out by using the primers of molecular marker JAASM3424:

The above PCR reaction system is a 10 μl system: 10×buffer 1 μl, MgCl ₂ solution (concentration: 25 mM) 0.5 μl, dNTP solution (concentration: 2.5 mM) 0.5 μl, primer SEQ ID NO.1 (concentration: 10 μM) 0.5 μl, primer 0.5 μl of SEQ ID NO.2 (10 μM), 0.2 μl of Taq polymerase at a concentration of 5 U/μl, 50 ng of template DNA, and make up to 10 μl with ddH ₂ O;

PCR amplification program: 94°C for 3 minutes; 94°C for 10 seconds, 60°C for 30 seconds, 72°C for 10 seconds, 30 cycles; 72°C for 5 minutes.

The amplified products were detected by 1.0% agarose gel electrophoresis, and the gel imaging system recorded the results. The detection results are shown in Figure 2. The molecular marker JAASM3424 can be used for low grain toxin accumulation wheat (lanes 1-5: Ning 894037, Wangshuibai, Sumai 3, Ning 7840 and Ningmai 8) and high grain toxin accumulation wheat. (Lane 6-10: Xiaoyan 22, Ning 98081, Jimai 20, Wanmai 44 and Annong 8455) were effectively distinguished, with high amplification efficiency and good specificity.

Example 2 Screening of Wheat Germplasm with Low Grain Toxin Accumulation Using Molecular Marker JAASM3424

The tested wheat population included 44 wheat varieties (lines), including 22 foreign wheats and 22 Chinese wheats (Table 1). The above-mentioned wheat varieties were all planted in the scab identification nursery of the Wheat Genetics Team of the Institute of Food Crops, Jiangsu Academy of Agricultural Sciences (118.88°E, 32.03°N). After being inoculated with Fusarium rubella Fa0609 (concentration: 10 ⁵ conidia/μl) at the flowering stage, 10 diseased ears were harvested, and the content of DON toxin in the grain was measured. With the detection method of the molecular marker JAASM3424 established in Example 1, the above-mentioned wheat variety (line) is detected, if there is a DNA fragment with a size of 214bp, the genotype is recorded as "0", and the germplasm is judged to be high DON toxin accumulation (interpreted as "high" in Table 1); if there is no above-mentioned amplified fragment, the genotype is recorded as "2", and it is judged that the germplasm is a germplasm with low DON toxin accumulation (interpreted as "low" in Table 1). "). The method for detecting DON toxin content in germplasm grains is the same as that in Example 1.

Table 1 Molecular marker JAASM3424 screening wheat germplasm with low grain toxin accumulation

The test results are shown in Table 1 above. According to the genotype results, the grain DON toxin content can be predicted. The molecular marker JAASM3424 can analyze the genotype of the wheat population and type the excellent allelic variation of wheat grain toxin accumulation, genotype 0 and genotype There was a significant difference (p<0.05) in the grain DON toxin content of type 2 germplasms (Fig. 3).

Example 3 Drawing Genetic Maps Using Molecular Marker JAASM3424

The tested wheat populations consisted of 185 F _2:7 recombinant inbred lines of Sumai 3×Annong 8455, the parent materials Sumai 3 and Annong 8455. With the detection method of the molecular marker JAASM3424 established in Example 1, the above-mentioned wheat material is subjected to genotype analysis, if there is a DNA fragment with a size of 214bp, then the genotype is recorded as "0"; if there is no above-mentioned amplified fragment, then The genotype was noted as "2". The genotype of parent Sumai 3 is "2", and the genotype of Anong 8455 is "0". The genotype results of the recombinant inbred line population are shown in Figure 4. The typing results were accurate and easy to interpret, which indicated that the molecular marker JAASM3424 primer pair had high amplification efficiency and good specificity.

The genetic mapping of the recombinant inbred line population was carried out using the typing results of JAASM3424. The drawing software was QTLIcimapping, and the parameters were default. The genetic map is shown in Figure 5. The total length of the genetic map of the excellent allelic variation region is 1.64cM, and the total length of the physical distance is 6.42Mb. After comparing the marker sequence with the wheat genome sequence, the position of the marker JAASM3424 in the genetic map corresponds to its position in the physical map, which indicates that it is feasible to use the typing results of the marker JAASM3424 to draw a genetic map, and it is necessary for further fine mapping and identification The associated genes/QTLs and the mechanism for dissecting the low grain toxin accumulation in wheat laid the foundation.

sequence listing

<110> Jiangsu Academy of Agricultural Sciences

<120> Molecular markers, primers and applications related to DON toxin accumulation in wheat grain

<130> ywx0-01-20220531-01-NO0020

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 26

<212>DNA

<213> Artificial Sequence

<400> 1

gagaatgatg aagtgcatac atgagc 26

<210> 2

<211> 25

<212>DNA

<213> Artificial Sequence

<400> 2

gaggaaattt ttgtctgcag tctgc 25

<210> 3

<211> 23

<212>DNA

<213> Artificial Sequence

<400> 3

atagactaaa cctcttggga agc 23

<210> 4

<211> 23

<212>DNA

<213> Artificial Sequence

<400> 4

ttttgttcta agtaatggat ggc 23

<210> 5

<211> 23

<212>DNA

<213> Artificial Sequence

<400> 5

gtatggcgac taggaataca aaa 23

<210> 6

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 6

agaatgctaa acttaggaac gga 23

Claims (5)

1. A molecular marker associated with wheat grain DON toxin accumulation, characterized in that, said molecular marker is obtained by the following method: using the DNA of Annong 8455 as a template, with nucleotide sequences such as SEQ ID NO. 1 and the primers shown in SEQ ID NO.2 carry out electrophoresis after PCR amplification, and the obtained size is a DNA fragment of 214bp. 2. A method for screening wheat germplasm with low DON toxin accumulation, characterized in that, the specific steps are as follows: using the sample wheat DNA as a template, with nucleotide sequences such as SEQ ID NO.1 and SEQ ID NO.2 respectively The indicated primers are electrophoresed after PCR amplification. If there is a DNA fragment with a size of 214bp in the electrophoresis product, it is determined that the sample contains the molecular marker JAASM3424; The accumulation was higher than that of wheat varieties without the molecular marker JAASM3424. 3. A method for drawing the genetic map of wheat grain toxin accumulation sites, characterized in that, the specific steps are as follows: take the genetic population DNA of Sumai No. 3 and Annong 8455 as a template, and use the nucleotide sequences such as SEQ ID The primers shown in NO.1 and SEQ ID NO.2 were amplified by PCR. After the amplified product was electrophoresed on an agarose gel with a mass percentage of 1%, if there was a DNA fragment with a size of 214bp, the genotype was recorded as " 0"; if there is no above-mentioned amplified fragment, the genotype is recorded as "2"; after collecting genotype data, draw a genetic map. 4. The method according to claim 2, wherein said PCR amplification refers to: PCR amplification system: 10 × buffer 1 μl, a concentration of _25mM MgCl solution 0.5 μl, a concentration of 2.5mM dNTP solution 0.5 µl, 0.5 µl of primer I with a concentration of 10 µM, 0.5 µl of primer II with a concentration of 10 µM, 0.2 µl of Taq polymerase with a concentration of 5U/µl, 50 ng of template DNA, and ddH ₂ O to make up to 10 µl; The nucleotide sequence of I is shown in SEQ ID NO.1, and the nucleotide sequence of the primer II is shown in SEQ ID NO.2; PCR amplification program: 94°C for 3 minutes; 94°C for 10 seconds, 60°C for 30 seconds, 72°C for 10 seconds, 30 cycles; 72°C for 5 minutes. 5. A pair of primers for predicting the accumulation of DON toxin in wheat grains, the nucleotide sequences of the primers are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively.

Images