CN115044697A

CN115044697A - Molecular marker related to accumulation of DON toxin in wheat grains and primer and application thereof

Info

Publication number: CN115044697A
Application number: CN202210615651.6A
Authority: CN
Inventors: 吴磊; 张旭; 何漪; 姜朋; 张鹏; 李畅
Original assignee: Jiangsu Academy of Agricultural Sciences
Current assignee: Jiangsu Academy of Agricultural Sciences
Priority date: 2022-05-31
Filing date: 2022-05-31
Publication date: 2022-09-13
Anticipated expiration: 2042-05-31
Also published as: CN115044697B

Abstract

The invention discloses a molecular marker related to accumulation of wheat grain DON toxin and application thereof, wherein the molecular marker takes common wheat genome DNA as a template, primer pairs with nucleotide sequences respectively shown as SEQ ID NO.1 and SEQ ID NO.2 are subjected to PCR amplification, a result is obtained after electrophoresis on 1% agarose gel, and the size of an amplification product is 214 bp; the molecular marker has short amplification time and high efficiency, and can be applied to genotype analysis of wheat populations and genetic mapping of anti-grain toxin accumulation sites.

Description

Molecular marker related to accumulation of DON toxin in wheat grains and primer and application thereof

Technical Field

The invention belongs to the field of wheat genetic breeding and molecular biology, and particularly relates to a molecular marker related to toxin accumulation of wheat grains and application thereof.

Background

Wheat scab is an important fungal disease caused by Fusarium graminearum (Fusarium graminearum) and seriously affects the yield and quality of wheat. In the general epidemic years, the scab can cause 5 to 10 percent of yield loss, and in the pandemic years, partial field can be collected absolutely, thus endangering the safety of wheat grains. Fusarium graminearum secretes a mycotoxin Deoxynivalenol (DON), a cytotoxin, which is classified as a class 3 carcinogen, and can cause immunosuppression or immunostimulation. Accumulation of DON toxin in wheat grains threatens the health of human beings and livestock, and after eating DON toxin food, acute poisoning symptoms such as anorexia, vomiting, diarrhea and the like can appear, and when the DON toxin food is serious, the DON toxin food can cause damage to the circulation system and death. According to the limit requirements of national food safety standard GB2761-2017 on mycotoxins in food, the content of DON toxin in cereals and products thereof such as corn (flour, residue), barley, wheat, oatmeal and wheat flour is not more than 1 mg/kg.

Wheat scab resistance can be divided into 5 types: i, infection resistance; II, resisting expansion; III, resisting the accumulation of the seed toxin; IV, resisting kernel infection; v, disease tolerance (Mesterh-zy 1995; Mesterh-zy et al 1999). The toxin accumulation resistance refers to the fact that toxin accumulation is reduced due to the fact that toxins are degraded or toxin production is inhibited in wheat grains, and has a genetic mechanism different from other resistance types. Szab Lo-Hev er et al detected anti-grain toxin accumulation sites on the wheat "Frontana" 3A, 4B, 7A and 7B chromosomes, accounting for 3.1-11.1% of phenotypic variation (Szab Lo-Hev Er et al, 2014). By genetic mapping, a stable QTL locus was detected on the 7A chromosome, which could account for 16-24% phenotypic variation (He et al, 2019). Detection of a site of resistance to accumulation of the grain toxin on the 2AS chromosome of norwegian wheat variety "NK 93604" could account for 26.7% of the phenotypic variation, but could be detected in only one environment (Semagn et al, 2007). In addition, micro-effective QTL sites were also detected on the 1A,1BL, 3BS, 5AS, 5DL and 7A chromosomes of "hope for water white" (Yu et AL 2008), the 4DS and 6AL chromosomes of "Ernie" (Liu et AL, 2013), the 2DS and 5AS chromosomes of "Wuhan-1" (Somers et AL, 2003), and the 1A, 2D,3AS,5BL,5A and 6A chromosomes of "SHA 3/CBRD" (Lu et AL, 2012). Sites associated with toxin-resistant accumulation were also detected in the U.S. and international wheat and maize improvement Center (CIMMYT) populations using whole genome association analysis, distributed on the 3B, 1D, 2B, 3A, 2BL chromosomes, accounting for 3-12% of phenotypic variation (Arruda et al, 2016; Wang et al, 2017). The development of the markers of the above sites is based on single nucleotide polymorphism or simple repeat sequence polymorphism, is difficult to directly utilize, or requires cumbersome typing steps, and is not suitable for large-scale germplasm screening or molecular marker-assisted selection.

In addition, the molecular marker related to the accumulation of wheat grain toxins is used for typing the genetic population, and the fine positioning of the grain toxin accumulation resisting site of the Chinese wheat variety Sumai No.3 is an important step of genetic improvement on wheat scab resistance on the basis of drawing a genetic map. The common high-throughput typing method is based on genome single nucleotide polymorphism, the design and manufacture of a typing chip depend on import, the typing cost is high, and large-scale research and development positioning is difficult to form.

Disclosure of Invention

Aiming at the problems, the invention obtains a new excellent allelic variation locus (644438701 bp on 7B chromosome and Chinese spring v1.0 as reference sequence) related to the accumulation of wheat grain toxin by whole genome correlation analysis and physical position comparison, and designs a molecular marker JAASM3424 based on polymerase chain reaction. The molecular marker can analyze the correlation between the genotypes of different wheat varieties at the position and the accumulation of the DON toxin of the wheat grains, and is used for drawing a genetic map.

Specifically, the invention is realized by the following steps:

firstly, the application provides a molecular marker JAASM3424 related to accumulation of wheat grain DON toxin, the molecular marker takes DNA of a wheat variety Annong 8455 as a template, sequences with nucleotide sequences respectively shown as SEQ ID NO.1 and SEQ ID NO. 2as primers to carry out PCR amplification, and after an amplification product is electrophoresed on agarose gel with the mass percentage of 1%, a DNA fragment with the size of 214bp is obtained.

The PCR amplification system: 10 XBuffer 1. mu.l MgCl at 25mM concentration ₂ Mu.l of the solution, 0.5. mu.l of dNTP solution at a concentration of 2.5mM, 0.5. mu.l of primer I at a concentration of 10. mu.M, 0.5. mu.l of primer II at a concentration of 10. mu.M, 0.2. mu.l of Taq polymerase at a concentration of 5U/. mu.lUl, template DNA 50ng, ddH ₂ O is complemented to 10 mu l; the nucleotide sequence of the primer I is shown as SEQ ID NO.1, and the nucleotide sequence of the primer II is shown as SEQ ID NO. 2;

PCR amplification procedure: 3 minutes at 94 ℃; extension at 94 ℃ for 10 seconds, 60 ℃ for 30 seconds, 72 ℃ for 10 seconds, 30 cycles; extension at 72 ℃ for 5 minutes.

Secondly, the application provides the application of the molecular marker JAASM3424 in screening wheat germplasm with low DON toxin accumulation. The specific application steps are as follows: taking wheat DNA of a sample as a template, taking nucleotide sequences such as SEQ ID NO.1 and SEQ ID NO. 2as primers to carry out PCR amplification, carrying out electrophoresis on an agarose gel with the mass percentage of 1% on an amplification product, and judging that the sample contains a molecular marker JAASM3424 if a DNA fragment with the size of 214bp exists in the electrophoresis product; otherwise, the molecular marker JAASM3424 is not contained; the accumulation amount of DON toxin in the wheat variety containing the molecular marker JAASM3424 is considered to be higher than that in the wheat variety not containing the molecular marker JAASM 3424.

Further, the above "wheat" includes, but is not limited to, Wangshuibai, Sumai No.3, Ning 7840, Ningmai No. 8, Xiaoyan 22, Ning98081, Jimai 20, Wanmai 44, Annong 8455, BORLAUG 100F 2014, Gondo, IOC 813, ITAPUA 45-DON PANI, KLEIN DON ENRIQUE, LAS ROSAS INTA, LAUREANO ALVAREZ, MARINGA, ONCATIVO-INTA, PERGABOTO, PRINIA, PROAFEDERAL, PROINTAGRANAR, PROAIAOASIS, QUU #1, QUELEA, SANF, SPINEBILL, THORNBIRD, VAILD, VL 616, WAXBILL, NanoNING 95021, Neiguan 9791-4, Miao-1-37, Nannong 9918, Fengning, FengmINING, 11, 16, 7, 15, 964, 15, or more varieties of unprocessed variety of Miao wheat; the derived variety refers to a wheat variety/strain which is obtained by hybridization, backcross, natural or artificial mutation and contains the genetic material of the wheat variety/strain.

The PCR amplification system: 10 XBuffer 1. mu.l, MgCl ₂ 0.5. mu.l of a solution (concentration: 25mM), 0.5. mu.l of a dNTP solution (concentration: 2.5mM), 0.5. mu.l of a primer SEQ ID NO.1 (concentration: 10. mu.M), and a primer SEQ ID NO.2 (10. mu.M) 0.5. mu.l, Taq polymerase (concentration 5U/. mu.l) 0.2. mu.l, template DNA 50ng, ddH ₂ O is complemented to 10 mu l; PCR amplification procedure: 3 minutes at 94 ℃; extension at 94 ℃ for 10 seconds, 60 ℃ for 30 seconds, 72 ℃ for 10 seconds, 30 cycles; extension at 72 ℃ for 5 minutes.

Thirdly, the application provides a pair of primer pairs for predicting the accumulation amount of the DON toxin in the wheat grains, and the nucleotide sequences of the primer pairs are respectively shown as SEQ ID NO.1 and SEQ ID NO. 2.

The invention also provides application of the molecular marker JAASM3424 in drawing a genetic map of a wheat grain toxin accumulation site, which comprises the following specific steps: taking the DNA of the genetic groups of Sumai No.3 and Annong 8455 as a template, taking SEQ ID NO.1 and SEQ ID NO. 2as primers to carry out PCR amplification, and after an amplification product is electrophoresed on agarose gel with the mass percentage of 1%, if a DNA fragment with the size of 214bp exists, the genotype is marked as '0'; if the amplified fragment is not present, the genotype is designated as "2". After genotype data is collected, a QTL Iimitping software is adopted to draw a genetic map.

The molecular marker based on the polymerase chain reaction with site specificity is designed by anchoring single nucleotide polymorphism variation in genome, so that the typing cost can be reduced, the typing steps can be simplified, and the efficiency of molecular marker-assisted selection can be improved. Compared with the prior art, the molecular marker primer pair is obtained by manual comparison, and the accuracy of an amplification product is ensured by manually adjusting the terminal position of the primer to anchor a mutation site. The molecular marker primer of the invention artificially introduces mismatched bases, thereby ensuring the specific amplification of a target sequence. The molecular marker provided by the invention is used for genetic mapping of the toxin accumulation locus of wheat grains, and lays a foundation for identifying related genes/QTLs and linked markers. The primer pair obtained in the invention has good specificity of amplification result, short time required by amplification and accurate interpretation of genotype result.

Drawings

FIG. 1 shows the amplification results of primer pairs of the software designed molecular markers P1 and P2 in different varieties (lines);

wherein, M: lanes DL2000 molecular weight standard, 1-10 are respectively Ning 894037, Wanshui, Sumai No.3, Ning 7840, Ningmai No. 8, Xiaoyan 22, Ning98081, Jimai 20, Wanmai 44 and Annong 8455.

FIG. 2 shows the amplification results of primer pairs of molecular marker JAASM3424 in different varieties (lines);

wherein, M: lanes DL2000,1-10 are respectively wheat variety (series) Ning 894037, Wanshuibai, Sumai No.3, Ning 7840, Ningmai No. 8, Xiaoyan 22, Ning 98081, Jimai 20, Wanmai 44 and Annong 8455.

FIG. 3 is a schematic diagram showing the typing results of excellent allelic variation accumulated by using a molecular marker JAASM3424 wheat grain toxin;

among them, genotype 0 represents allelic variation "C", and genotype 2 represents allelic variation "T".

FIG. 4 shows molecular marker JAASM 3424F in Sumai No.3 × Annon 8455 _2:7 Schematic diagram of typing results in the recombinant inbred line group;

wherein, M: molecular weight standard DL2000, lanes 1-185 are the genetic population recombinant inbred line numbers, S is Sumai No.3, A is Annong 8455.

FIG. 5 genetic map was prepared using JAASM3424 as a molecular marker.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The following examples relate to nucleotide sequences:

SEQ ID NO.1：GAGAATGATGAAGTGCATACATGAGC；

SEQ ID NO.2：GAGGAAATTTTTGTCTGCAGTCTGC；

SEQ ID NO.3：ATAGACTAAACCTCTTGGGAAGC；

SEQ ID NO.4：TTTTGTTCTAAGTAATGGATGGC；

SEQ ID NO.5：GTATGGCGACTAGGAATACAAAA；

SEQ ID NO.6：AGAATGCTAAACTTAGGAACGGA。

examples relate to material sources:

wheat varieties (lines) such as Sumai No.3 and the like related to the following examples: is a conventional variety (line) and is preserved by a wheat genetic breeding team of the food crop research institute of the academy of agricultural sciences of Jiangsu province;

gibberella: is Asian fusarium Fa0609, and is preserved by wheat genetic breeding team of food crop research institute of agricultural academy of sciences of Jiangsu province.

Example 1 validation of molecular marker JAASM3424 in different wheat varieties (lines)

The DNA template for PCR amplification in this example was from the following wheat varieties (lines): nin 894037, wangshuibai, sumai No.3, nin 7840 and ninmai No. 8, wherein the excellent allelic variation is base "T", and the content of the DON toxin in grains is lower, which are respectively: 1.76mg/kg, 2.29mg/kg, 2.38mg/kg, 2.63mg/kg and 2.85 mg/kg; excellent allelic variation of the Xiaoyan 22, Ning 98081, Jimai 20, Wanmai 44 and Annong 8455 is basic group 'C', and the DON toxin content of grains is higher and respectively: 25.80mg/kg, 2.83mg/kg, 28.7mg/kg, 29.3mg/kg and 29.8 mg/kg. The wheat varieties are all planted in a gibberellic disease identification garden (118.88 degrees from east longitude and 32.03 degrees from north latitude) of a wheat genetic team of the institute of food crops of Jiangsu agricultural academy, and are sowed in due time, the row length is 1 meter, and the sowing amount is 40 grains. Inoculating Fusarium graminearum Fa0609 (with concentration of 10) in flowering phase ⁵ Conidia/. mu.l), 10 diseased ears were harvested to measure the grain DON toxin content. The content of the DON toxin in the grains is detected by adopting an enzyme-linked immunosorbent rapid detection kit (HEM 1896-2 in Beijing Hua' an Macacae). Genomic DNA of young leaves was extracted by CTAB method (Murray and Thompson,1980) and quantified by a microspectrophotometer Nanodrop.

When the software Primer premier5.0 is used for carrying out molecular marker Primer design on a genome sequence containing a variation site (644438701 bp on a 7B chromosome, and a reference sequence is Chinese spring v1.0), the parameters are as follows: the amplification size is 200-300bp, the annealing temperature is 55-65 ℃, other parameters are defaults, manual modification is not carried out, and two pairs of primers with the highest score are selected for testing. The primer pair P1 (the nucleotide sequence of which is shown as SEQ ID NO.3 and SEQ ID NO. 4) and P2 (the nucleotide sequence of which is shown as SEQ ID NO.5 and SEQ ID NO. 6) designed by software are used for PCR amplification by taking the wheat variety (line) as a template:

the PCR reaction system was 10. mu.l: 10 XBuffer 1. mu.l, MgCl ₂ 0.5. mu.l of a solution (concentration: 25mM), 0.5. mu.l of a dNTP solution (concentration: 2.5mM), 0.5. mu.l of a primer SEQ ID NO.1 (concentration: 10. mu.M), 0.5. mu.l of a primer SEQ ID NO.2 (concentration: 10. mu.M), 0.2. mu.l of a Taq polymerase (concentration: 5U/. mu.l), 50ng of a template DNA, ddH ₂ O is complemented to 10 mu l;

The amplification product is detected by 1.0% agarose gel electrophoresis, the electrophoresis result is shown in figure 1, P1 and P2 are the amplification results of a software design primer pair P1 and P2 respectively, it can be seen that the two primer pairs cannot effectively amplify excellent allelic variation, all templates are subjected to non-specific amplification, and the specificity and the effectiveness of amplification need to be improved.

On the basis, the applicant artificially adjusts the anchoring position and the end base type of a primer pair on the basis of artificially comparing variation sites (644438701 bp on a 7B chromosome, and the reference sequence is Chinese spring v1.0), artificially mutates the 3 rd base at the end of the primer at the anchoring position from 'C' to 'A', improves the amplification specificity and obtains a molecular marker JAASM3424 primer pair (SEQ ID NO.1 and SEQ ID NO. 2). The genomic DNA of the variety (strain) is taken as a template, and primers marked by JAASM3424 are used for carrying out PCR amplification on SEQ ID NO.1 and SEQ ID NO. 2:

the PCR reaction system is a 10. mu.l system: 10 XBuffer 1. mu.l, MgCl ₂ 0.5. mu.l of a solution (concentration: 25mM), 0.5. mu.l of a dNTP solution (concentration: 2.5mM), 0.5. mu.l of a primer SEQ ID NO.1 (concentration: 10. mu.M), 0.5. mu.l of a primer SEQ ID NO.2 (concentration: 10. mu.M), 0.2. mu.l of a Taq polymerase (concentration: 5U/. mu.l), 50ng of a template DNA, ddH ₂ O is complemented to 10 mu l;

The amplification products were detected by electrophoresis on a 1.0% agarose gel and the results recorded by a gel imaging system. The detection result is shown in figure 2, the molecular marker JAASM3424 can effectively distinguish allelic variation of wheat with low grain toxin accumulation (lanes 1-5: Ning 894037, Wanshui, Sumai No.3, Ning 7840 and Ning mai No. 8) and wheat with high grain toxin accumulation (lanes 6-10: Xiaoyan 22, Ning 98081, Jimai 20, Wanmai 44 and Annong 8455), and has high amplification efficiency and good specificity.

Example 2 screening of wheat germplasm with low accumulation of grain toxins by molecular marker JAASM3424

The test wheat population comprised 44 parts of wheat variety (line) containing 22 parts of foreign wheat and 22 parts of Chinese wheat (table 1). The wheat varieties are all planted in a gibberellic disease identification garden (118.88 degrees from east longitude and 32.03 degrees from north latitude) of a wheat genetic team of the institute of food crops of Jiangsu agricultural academy, and are sowed in due time, the row length is 1 meter, and the sowing amount is 40 grains. Inoculating Fusarium graminearum Fa0609 (with concentration of 10) in flowering phase ⁵ Conidia/. mu.l), 10 diseased ears are harvested, and the DON toxin content of the grains is measured. The above wheat variety (line) was examined by the method of detecting molecular marker JAASM3424 established in example 1, and if a DNA fragment of 214bp in size was present, the genotype was marked as "0", and the germplasm was judged to be one with high DON toxin accumulation (read as "high" in table 1); if the amplified fragment is not present, the genotype is represented as "2", and the germplasm is judged to be a germplasm with low DON toxin accumulation (identified as "low" in Table 1). The method for detecting the content of the DON toxin in the germplasm grains is the same as that in example 1.

TABLE 1 molecular marker JAASM3424 screening of wheat germplasm with low accumulation of grain toxins

The detection results are shown in the table 1, the content of the DON toxin in the grains is predicted according to the genotype results, the genotype of a wheat population can be analyzed by the molecular marker JAASM3424, the excellent allelic variation accumulated by the toxin in the wheat grains is classified, and the content difference of the DON toxin in the grains of genotype 0 and genotype 2 is obvious (p is less than 0.05) (figure 3).

Example 3 genetic mapping Using the molecular marker JAASM3424

The tested wheat group is Sumai No.3 XAnnong 8455F _2:7 185 portions of the recombinant inbred line population, the parent material Sumai No.3 and Annong 8455. The wheat material was genotyped by the detection method of molecular marker JAASM3424 established in example 1, and if there was a DNA fragment of 214bp, the genotype was marked as "0"; if the amplified fragment is not present, the genotype is designated as "2". The genotype of the parent Sumai No.3 is "2", the genotype of Annong 8455 is "0", and the typing results of the recombinant inbred line population are shown in FIG. 4. The typing result is accurate and easy to interpret, which shows that the molecular marker JAASM3424 primer pair has high amplification efficiency and good specificity.

Genetic mapping is carried out on the recombinant inbred line population by using the parting result of JAASM3424, the drawing software is QTL Iimitping, the parameters are defaults, and the genetic map is shown in figure 5. The genetic map of the excellent allelic variation region has a total length of 1.64cM and a physical distance of 6.42 Mb. After the marker sequence is compared with the wheat genome sequence, the position of the marker JAASM3424 in the genetic map corresponds to the position of the marker JAASM3424 in the physical map, which shows that the genetic map drawing is feasible by using the typing result of the marker JAASM3424, and lays a foundation for further fine mapping, identification of related genes/QTL and analysis of a mechanism of low-grain toxin accumulation of wheat.

Sequence listing

<110> agricultural science and academy of Jiangsu province

<120> molecular marker related to accumulation of DON toxin in wheat grains, and primer and application thereof

<130> ywx0-01-20220531-01-NO0020

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gagaatgatg aagtgcatac atgagc 26

<210> 2

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gaggaaattt ttgtctgcag tctgc 25

<210> 3

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atagactaaa cctcttggga agc 23

<210> 4

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ttttgttcta agtaatggat ggc 23

<210> 5

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gtatggcgac taggaataca aaa 23

<210> 6

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

agaatgctaa acttaggaac gga 23

Claims

1. A molecular marker related to accumulation of DON toxin in wheat grains is obtained by the following method: DNA of Annong 8455 is taken as a template, sequences with nucleotide sequences respectively shown as SEQ ID NO.1 and SEQ ID NO.2 are taken as primers to carry out PCR amplification and electrophoresis, and the obtained DNA fragment with the size of 214bp is obtained.

2. The use of the molecular marker of claim 1 for screening wheat germplasm with low accumulation of DON toxins, wherein the accumulation of DON toxins in a wheat variety containing said molecular marker is higher than in a wheat variety not containing said molecular marker.

3. The use of the molecular marker of claim 1 for mapping the accumulation site of toxin in wheat grain.

4. The application of claim 2, wherein the application is that the sample wheat DNA is used as a template, the nucleotide sequences of the sample wheat DNA are respectively shown as SEQ ID No.1 and SEQ ID No.2, the sample is subjected to PCR amplification and then is subjected to electrophoresis, and if a DNA fragment with the size of 214bp exists in an electrophoresis product, the sample is judged to contain a molecular marker JAASM 3424; otherwise, the gene does not contain the molecular marker JAASM 3424; judging that the accumulation amount of the DON toxin of the wheat variety containing the molecular marker JAASM3424 is higher than that of the wheat variety not containing the molecular marker JAASM 3424.

5. The use according to claim 4, wherein the PCR amplification is:

PCR amplification System: 10 Xbuffer 1 μ l MgCl at 25mM concentration ₂ 0.5 mul of solution, 0.5 mul of dNTP solution with the concentration of 2.5mM, 0.5 mul of primer I with the concentration of 10 muM, 0.5 mul of primer II with the concentration of 10 muM, 0.2 mul of Taq polymerase with the concentration of 5U/mul, 50ng of template DNA, and ddH ₂ Complementing the nucleotide sequence of the primer I to 10 mu l, wherein the nucleotide sequence of the primer I is shown as SEQ ID NO.1, and the nucleotide sequence of the primer II is shown as SEQ ID NO. 2;

PCR amplification procedure: (vii) 3 min 94; (ii) 10 sec at 94, 30 sec at 60, 10 sec at 72, extending for 30 cycles; 72C for 5 min.

6. A pair of primer pairs for predicting the accumulation amount of the DON toxin in the wheat grains, wherein the nucleotide sequences of the primer pairs are respectively shown as SEQ ID NO.1 and SEQ ID NO. 2.