CN111996283B - Molecular marker closely linked with wheat powdery mildew resistance gene PmLS5082 and application thereof - Google Patents
Molecular marker closely linked with wheat powdery mildew resistance gene PmLS5082 and application thereof Download PDFInfo
- Publication number
- CN111996283B CN111996283B CN202010998856.8A CN202010998856A CN111996283B CN 111996283 B CN111996283 B CN 111996283B CN 202010998856 A CN202010998856 A CN 202010998856A CN 111996283 B CN111996283 B CN 111996283B
- Authority
- CN
- China
- Prior art keywords
- wheat
- pmls5082
- ytu19
- powdery mildew
- molecular marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a powdery mildew resistance gene of wheatPmLS5082Closely linked molecular marker YTU19 and its application-005; an upstream primer of the molecular marker YTU19-005 is YTU19-005-F, and the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 1; the downstream primer of the molecular marker YTU19-005 is YTU19-005-R, and the nucleotide sequence is shown as SEQ ID N: 2; PCR amplification, electrophoresis and separation are carried out on the wheat genome DNA by the upstream primer and the downstream primer of the molecular marker YTU19-005 to obtain an amplification product with the molecular weight of 210bp, namely the wheat powdery mildew resistance genePmLS5082Closely linked molecular markers. Genes developed by the present inventionPmLS5082Closely linked molecular marker YTU19-005 for genePmLS5082The fine positioning, map-based cloning and molecular marker-assisted selective breeding can accelerate the genePmLS5082Increase the cloning efficiency of the genePmLS5082The transformation efficiency under different genetic backgrounds accelerates the cultivation of new wheat powdery mildew resistant varieties and has positive promotion effect on the prevention and control of the wheat powdery mildew.
Description
Technical Field
The invention relates to the field of wheat molecular biotechnology and breeding application, in particular to a powdery mildew resistance gene of wheatPmLS5082Closely linked molecular markers and uses thereof.
Background
Wheat powdery mildew seriously jeopardizes wheat production and, in general, can cause 10-15% yield loss and, to some extent, quality degradation (Jia et al, Characterization of the power mill resistance gene in the electrode at least great concern 23 and is applied in marker-associated selection. Frontiers in Genetics, 2020, 11: 241). Main measure for preventing and controlling wheat powdery mildewThere are field agricultural measures, chemical agent spraying and disease resistant varieties, among which the disease resistant variety is the most effective and meets the current economic and social development (Xu et al. Molecular marking of a new broad-spectrum porous mineral alloy)Pm2cin Chinese leather dry laboratory Niaomiai, therapeutic and Applied Genetics, 2015, 128: 2077-. However, powdery mildew resistance in wheat varieties in China is not optimistic, and most powdery mildew resistance genes in Disease-resistant wheat varieties are microspecial specific resistance and easily lose resistance along with the evolution of pathogenic flora (Ma et al. Characterization of a powdery mildew resistance gene in a white breaking line 10V-2 and its application in marker-assisted selection. Plant Disease, 2018, 102: 925) so that more powdery mildew resistance genes need to be developed for Disease-resistant breeding.
To date, more than 70 formally named wheat anti-powdery mildew genes (Li et al. A sport wheat while-Aegipanps longissiman transformation) have been found at 53 sitesPm66A control resistance to powder family, the genetic and Applied Genetics, 2020, 133: 1149-. However, the two problems often face to the discovered disease-resistant genes, one is that many disease-resistant genes gradually lose resistance to powdery mildew due to variety-flora interaction in the promotion process, and the other is that some resistant genes can not be directly and efficiently utilized, because many disease-resistant genes carry unfavorable factors of pleiotropic effect, genetic linkage redundancy and the like, which influence the efficient utilization of the disease-resistant genes in production (An et al Development and molecular genetic identification of a new while-layer 4R genetic modification with restriction enzyme to pore diameter, strand run and shell layer spot thermal and genetic applications, 2018, 132:257 and 272). Therefore, the discovery and utilization of broad-spectrum powdery mildew resistance genes in germplasm resources with excellent comprehensive characters have practical significance.
After the discovery of excellent genes, how to apply the genes to wheat breeding quickly and efficiently is another key problem at present. In the past decades, wheat genetic breeding mainly utilizes traditional breeding modes and breedersThe experience of (2) is often blind and cannot be kept steadily increasing. With the development of wheat genomics and the utilization of biotechnology, molecular breeding technology is gradually applied to wheat genetic breeding. Compared with traditional breeding, the molecular breeding target is clear, adverse genes can be removed in fewer backcross generations, and the breeding process is accelerated (stem et al, Development of robust molecular markers for marker-assisted selection of leaf test resistance gene)Lr23Molecular Breeding, 2017, 37: 21). Particularly, with the development of high-throughput sequencing technology, technologies such as wheat high-throughput snp (Single nucleotide polymorphism) chip and BSR-Seq (bulk seed RNA-Seq) are beginning to be applied to the batch development of wheat Molecular markers and the construction of genetic maps, which greatly accelerates the application process of Molecular breeding in wheat genetic breeding (human et al, Single nucleotide polymorphism using Kompetitive Allele Specific PCR (KASP): overview of the technology and its application in Molecular breeding, 2016, 33: 1-14).
The wheat LS5082 is a breeding strain bred by Shandong agriculture university, and has good comprehensive characters such as agriculture, yield and the like. Genetic analysis and molecular marker detection of powdery mildew resistance of wheat LS5082 in seedling stage show that the resistance of wheat to powdery mildew with different toxicity in seedling stage is controlled by a single dominant gene, so that the molecular marker closely linked with the gene is developed, and the molecular marker is further applied to efficient and accurate detection and tracking of powdery mildew resistance genes, and has very important value and significance for wheat powdery mildew resistance breeding.
Disclosure of Invention
The invention aims to provide a powdery mildew resistance gene for wheatPmLS5082Closely linked molecular marker and application thereof to wheat powdery mildew resistance gene by utilizing molecular markerPmLS5082Positioning and detecting to efficiently and accurately detect the powdery mildew resistance gene of wheatPmLS5082And provides a convenient tool for fine positioning and map-based cloning, and purposefully selects the parent strain in the wheat breeding process, so as to breed the wheat with excellent powdery mildew resistanceThe variety or strain provides a guide basis for breeding new wheat varieties with powdery mildew resistance.
The invention is realized by the following method: wheat powdery mildew resistance genePmLS5082A closely linked molecular marker, which is YTU 19-005; an upstream primer of the molecular marker YTU19-005 is YTU19-005-F, and the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 1; the downstream primer of the molecular marker YTU19-005 is YTU19-005-R, and the nucleotide sequence is shown as SEQ ID N: 2; PCR amplification, electrophoresis and separation are carried out on the wheat genome DNA by the upstream primer and the downstream primer of the molecular marker YTU19-005 to obtain an amplification product with the molecular weight of 210bp, namely the wheat powdery mildew resistance genePmLS5082Closely linked molecular markers.
The PCR amplification system is 20 mu L, and comprises 2.0 mu L of wheat genome DNA 30-50 ng/mu L, 2.0 mu L of 10 XPCR buffer, 0.4 mu L of 10mM dNTP and 10mM MgCl 2 2.0 μ L, 5U Taq polymerase 0.4 μ L, 2 μ M upstream primer 0.8 μ L, 2 μ M downstream primer 0.8 μ L, and sterile deionized water 11.6 μ L.
The procedure of the PCR amplification is as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, extension for 40 seconds, 38 cycles; extending for 5min at 72 ℃; storing at 4 ℃.
The electrophoresis refers to electrophoresis on a denaturing polyacrylamide gel with the mass volume ratio of 8 percent, after mixing the PCR product with 10 mu L of loading buffer solution, sampling 3 mu L of mixture, carrying out electrophoresis at a constant voltage of 180V for 1.0-1.5h, and taking a picture after silver nitrate staining.
The gene of the invention for resisting powdery mildew of wheatPmLS5082Closely linked molecular marker in wheat powdery mildew resistance genePmLS5082The molecular positioning, map bit cloning, detection and molecular marker assisted selective breeding.
The application detects whether the wheat variety to be detected carries the powdery mildew resistance genePmLS5082The method mainly comprises the following steps:
(1) extracting genome DNA from fresh leaves of a wheat sample to be detected;
(2) carrying out PCR amplification on the wheat genome DNA by using a primer of a molecular marker YTU19-005 to obtain an amplification product;
(3) the amplified product is subjected to electrophoresis and separation, if a specific strip with the molecular weight of 210bp can be amplified, the wheat to be detected carries the powdery mildew resistance genePmLS5082(ii) a Otherwise, the wheat to be detected does not carry the wheat powdery mildew resistance genePmLS5082。
In the application, the labeled primers of the molecular marker YTU19-005 in the step (2) comprise an upstream primer YTU19-005-F and a downstream primer YTU19-005-R, the nucleotide sequence of the upstream primer YTU19-005-F is shown as SEQ ID NO. 1, and the nucleotide sequence of the downstream primer YTU19-005-R is shown as SEQ ID NO. 2.
In the application, the PCR amplification system in the step (2) is 20 mu L, and comprises 2.0 mu L of wheat genome DNA (deoxyribonucleic acid) of 30-50 ng/mu L, 2.0 mu L of 10 XPCR buffer, 0.4 mu L of 10mM dNTP and 10mM MgCl 2 2.0 μ L, 5U Taq polymerase 0.4 μ L, 2 μ M upstream primer 0.8 μ L, 2 μ M downstream primer 0.8 μ L, and sterile deionized water 11.6 μ L.
The PCR amplification procedure in the step (2) in the application is as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, extension for 40 seconds, 38 cycles; extending for 5min at 72 ℃; storing at 4 ℃.
The electrophoresis of the amplification product in the step (3) in the application refers to electrophoresis on 8% denaturing polyacrylamide gel in mass-volume ratio, after mixing the PCR product with 10 mu L of loading buffer solution, taking 3 mu L of mixture for sample application, carrying out electrophoresis at a constant voltage of 180V for 1.0-1.5h, and taking a picture after silver nitrate staining.
GenePmLS5082The broad-spectrum powdery mildew resistance gene is found in a breeding line LS5082 in China, and the gene is not reported to be finely positioned and cloned in a map position at present. The invention shows that the resistance of LS5082 wheat to powdery mildew in seedling stage is controlled by single dominant gene, named as powdery mildew resistant genePmLS5082Then using Bulked segregant RNA-Seq (BSR-Seq) to LS5082, Shimai 22 and LS5082 x Shimai 22F 2:3 Disease resistant pool consisting of 50 homozygous disease resistant and 50 homozygous susceptible families in population andBSR-Seq sequencing is carried out on the susceptible pool, a clear enrichment peak is found to exist only in a 2B chromosome 710-715Mb physical interval through differential SNP analysis in a whole genome range, a primer5.0 software is further utilized to design a molecular marker according to differential sequences existing between the resistant parent and the resistant pool in the interval, and the molecular marker YTU19-005 and the gene are screened out through detection of a genetic segregation populationPmLS5082Cosegregation, belonging to tightly linked markers.
The molecular marker YTU19-005 provided by the invention can efficiently and accurately detect and detect genesPmLS5082The large population of genetic mapping of (1) applied to the genePmLS5082And cloning genes by constructing genetic mapping large population, fine mapping and mappingPmLS5082To the genePmLS5082The deep analysis of the disease resistance mechanism has important significance; can be developed by using the present inventionPmLS5082The closely linked molecular markers YTU19-005 can be used for efficiently and accurately detectingPmLS5082Large population of genetic maps ofPmLS5082Molecular mapping, map-based cloning and molecular marker assisted selective breeding, in particular of genesPmLS5082The carrier variety LS5082 has excellent comprehensive character, no linkage drag and reduced backcross generation number, so that the molecular marker is utilized to carry out gene pairPmLS5082The high-efficiency molecular breeding is of practical significance.
The disease-resistant parent LS5082 is a breeding line (number is LS 5082) bred by Shandong agriculture university, and the disease-susceptible parent Shimai 22 is a 2011 national approved variety (national examined wheat 2011014).
Drawings
FIG. 1 shows genesPmLS5082Map of molecular marker location on chromosome 2B. The left side is the genetic distance in cM and the right side is the molecular marker.
FIG. 2 shows the results of molecular marker YTU19-005 in testing LS5082 and Shimai 22 and their filial generation segregating population.
In the figure: m: DNA marker pUC19 Msp I; 1: LS5082 (powdery mildew resistant variety, portable)PmLS5082) (ii) a 2: shimai 22 (powdery mildew susceptible variety); 3-17: f formed by LS5082 hybridization with Shimai 22 2:3 Family, wherein, 3-7: homozygous disease-resistant F 2:3 Family, 8-12: anti-influenza-isolated F 2:3 Family, 13-17: homozygous susceptible F 2:3 Family tying; black arrows to trackPmLS5082The specific band of (1).
FIG. 3 shows the result of detecting the breeding availability of partially infected main cultivars by PCR amplification with molecular marker YTU 19-005.
In the figure: m: DNA marker pUC19 Msp I; 1: LS5082 (powdery mildew resistant variety, carrying gene)PmLS5082) (ii) a 2: shimai 22 (powdery mildew susceptible variety); 3: tobacco grower 187; 4: shannong 1538; 5: shannong 202; 6: zhoumai 27; 7: midwifery 1311; 8: tobacco grower 1212; 9: jimai 229; 10: FC 009; 11: zhongyu 9398. Black arrows to trackPmLS5082The specific band of (1).
Detailed Description
The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are all conventional ones unless otherwise specified. The test materials, reagents and the like used in the examples are commercially available unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.
Example 1 development of molecular marker YTU19-005 of wheat powdery mildew resistance gene PmLS5082
1. Material
The disease-resistant parent LS5082 is a breeding line bred by Shandong agriculture university, the susceptible parent Shimai 22 is a 2011 national approved variety, the disease resistance and the susceptibility are respectively shown for wheat powdery mildew, LS5082 and Shimai 22 are hybridized, and the obtained F is F 1 Selfing to obtain F 2 Population and corresponding F 2:3 Family members.
2. Extraction of wheat genome DNA
The wheat genome DNA extraction adopts a phenol/chloroform method, and the flow is as follows:
(1) sowing the wheat seeds to be detected, taking fresh leaves, grinding the fresh leaves by liquid nitrogen, and taking about 0.4g of the fresh leaves to be placed in a 2mL centrifuge tube.
(2) mu.L of DNA extract (100 mM Tris, 50mM EDTA, 500 mM NaCl, 1.8% SDS, pH = 8.0) was added and water bath was carried out at 65 ℃ for 40-60 min.
(3) Adding 600 μ L chloroform-isoamyl alcohol (24:1, v/v), mixing, and placing on a shaking table to shake gently for 15 min.
(4) Placing into a centrifuge, centrifuging at 12000 rpm for 15 min, collecting supernatant, adding 3 times volume of precooled anhydrous ethanol, and placing in a refrigerator at-20 deg.C for precipitation for 60 min.
(5) Flocculent DNA precipitate was picked and washed 2 times with 75% pre-cooled ethanol.
(6) The DNA precipitate was picked out, placed in a 1.5 mL centrifuge tube, and air-dried in a room.
(7) The DNA pellet was dissolved by adding 60. mu.L of TE buffer (100 mM Tris-HCl, 10mM EDTA, pH = 8.0) to prepare a DNA stock solution.
(8) The DNA stock solution was diluted with ultrapure water to 10-30 ng/. mu.L and used as a working solution.
3. Identification and genetic analysis of powdery mildew resistance in seedling stage
And (3) identifying the powdery mildew resistance of the wheat in the seedling stage in a glass greenhouse with controllable temperature, humidity and illumination. The wheat seeds to be tested are sown in a hole tray (2X 2cm) with 72 holes, and 5 seeds are sown in each hole, wherein the parent LS5082, the stone wheat 22 and the LS5082 and F of the stone wheat 22 1 Identification of 10 seeds, LS5082 and F of Shimai 22 in each case 2 Population identification of 300 seeds, F 2 Identifying the single plant of the group, transplanting the single plant of the group to a field, and harvesting to obtain the corresponding F 2:3 Family, each F 2:3 20 seeds are sowed in the family. The susceptible control mingxian 169 are distributed randomly.
After sowing, the glass greenhouse conditions are controlled to be 14 h/10 h of darkness, 18-22 ℃ and 30-40% of relative humidity. Up to one leaf stage, the disease-susceptible material was inoculated with powdery mildew strain E09 which had grown on the material. The conditions for the first 24h after inoculation were controlled as follows: dark at 18-22 deg.C and relative humidity of 80-90%. Then, the conditions are controlled to be 14 h/10 h dark, the temperature is 18-22 ℃, and the relative humidity is 80-90%. 10-14 days after inoculation, the powdery mildew resistance phenotype was investigated after the first leaf of Mingxian 169 was covered with spores. The powdery mildew reaction type is recorded according to the 0-4 grade standard, wherein the disease resistance grade is 0-2 grade, and the infection grade is 3-4 grade.
The results show that 9 disease-resistant parents LS5082 and 10 disease-resistant parents F of seedlings are all disease-resistant, 9 disease-susceptible parents Shimai 22 and 10 disease-susceptible parents Shimai 1 All showed disease resistance consistent with the disease resistant parent LS5082, indicating that powdery mildew resistance in LS5082 is controlled by dominant gene. Further statistics of F 2 Colony discovery, emergence of seedlings F 2 The isolation ratio of the individual plant in the population to the influenza is 218:80, and the chi-square test conforms to the isolation ratio of the single dominant gene of 3:1 (chi-square test) 2 =0.54, P = 0.46), further F is added 2 Transplanting the population to the field to obtain corresponding F 2:3 The number of families, homozygous disease-resistant families, influenza-resistant segregation families and homozygous influenza families are respectively as follows: 76. 142 and 80, the chi-square test corresponds to the segregation ratio of the single dominant gene of 1:2:1 (chi) 2 =0.19, P = 0.91), further confirming that LS5082 is controlled by a single dominant gene, designated asPmLS5082。
Multi-strain resistance profiling of LS5082 showed that LS5082 exhibited resistance to 22 of 24 strains with different virulence wheat powdery mildew, showing broad spectrum resistance at the seedling stage. Combined with good comprehensive characters of LS5082 as a breeding line,PmLS5082has important significance for wheat powdery mildew resistant genetic breeding.PmLS5082After the gene is introduced into a main cultivar, how to efficiently and accurately detect and track the powdery mildew resistance genePmLS5082Is extremely important for realizing the breeding value.
4. BSR-Seq sequencing analysis
F according to LS5082, Shimai 22 and LS5082 hybridization with Shimai 22 1 、F 2 And F 2:3 Identifying the family, respectively selecting 50 homozygous disease-resistant F 2:3 Pedigree and 50 homozygous susceptible F 2:3 Constructing an anti-disease pool and an infection pool by using the same amount of DNA of the family, and performing BSR-Seq sequencing on the anti-disease pool and the infection pool.
5. And withPmLS5082Development of closely linked molecular markers
And (3) carrying out differential SNP analysis on the BSR-Seq result, and finding that obvious enrichment exists in a 710-715Mb physical interval on the 2B chromosome in the whole genome. Designing molecular markers by using primer5.0 software according to differential SNP and flanking sequences thereof, and preparing by detecting LS5082149F of stone wheat 22 2:3 The linkage analysis of the families showed that the molecular markers YTU19-005 and 005 were selected as shown in FIG. 1PmLS5082Cosegregation, belonging to tightly linked markers.
The primers of the molecular marker YTU19-005 comprise an upstream primer YTU19-005-F and a downstream primer YTU 19-005-R:
nucleotide sequence of the upstream primer YTU 19-005-F: 5'-3': AAGATGAACTGCGGCTGAAT, respectively;
nucleotide sequence of downstream primer YTU 19-005-R: 5'-3': CAGATGGACCTCTTCTTCGG are provided.
The PCR amplification system is 20 mu L, and comprises 2.0 mu L of wheat genome DNA (deoxyribonucleic acid) with the concentration of 30-50 ng/mu L, 2.0 mu L of 10 XPCR buffer, 0.4 mu L of 10mM dNTP and 10mM MgCl 2 2.0 μ L, 5U Taq polymerase 0.4 μ L, 2 μ M upstream primer 0.8 μ L, 2 μ M downstream primer 0.8 μ L, and sterile deionized water 11.6 μ L.
The procedure of PCR amplification is as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, extension for 40 seconds, 38 cycles; extending for 5min at 72 ℃; storing at 4 ℃.
And (3) detecting a PCR amplification product: electrophoresis was performed on 8% by mass/volume non-denaturing polyacrylamide gel (acrylamide/bisacrylamide = 29/1), and after mixing the amplification product with 10. mu.L of loading buffer, 3. mu.L of the mixture was spotted, followed by electrophoresis at a constant pressure of 180V for 1.0 to 1.5 hours, and photographing after silver nitrate staining. The amplified product molecular weight is 210bp and 225 bp fragments which are respectively specific fragments linked with disease-resistant and disease-sensitive phenotypes; the molecular weight of the amplified product is 210bp, and the amplified product is the gene for resisting wheat powdery mildewPmLS5082Closely linked molecular markers.
Example 2 wheat powdery mildew resistance GenePmLS5082Application of molecular marker YTU19-005
Powdery mildew resistance gene of wheatPmLS5082The molecular marker YTU19-005 is used for detecting the F of the disease-resistant parent LS5082, the susceptible parent Shimai 22 and the LS5082 multiplied Shimai 22 2:3 Family members.
A sample to be tested: LS5082, SHIMAI 22, and LS 5082X 15F of SHIMAI 22 2:3 Family members.
The genomic DNA of the material to be tested was extracted as a PCR amplification template by the method described in step 2 of example 1, and amplified using the upstream and downstream primers of molecular marker YTU19-005 developed in the present invention:
nucleotide sequence of the upstream primer YTU 19-005-F: 5'-3': AAGATGAACTGCGGCTGAAT, respectively;
nucleotide sequence of downstream primer YTU 19-005-R: 5'-3': CAGATGGACCTCTTCTTCGG are provided.
The PCR amplification system is 20 mu L, and comprises 2.0 mu L of wheat genome DNA 30-50 ng/mu L, 2.0 mu L of 10 XPCR buffer, 0.4 mu L of 10mM dNTP and 10mM MgCl 2 2.0 μ L, 5U Taq polymerase 0.4 μ L, 2 μ M upstream primer 0.8 μ L, 2 μ M downstream primer 0.8 μ L, and sterile deionized water 11.6 μ L.
The procedure of PCR amplification is as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, extension for 40 seconds, 38 cycles; extending for 5min at 72 ℃; storing at 4 ℃.
And (3) detecting a PCR amplification product: and (2) performing electrophoresis on a non-denaturing polyacrylamide gel with the mass-to-volume ratio of 8%, mixing the amplification product with 10 mu L of loading buffer solution, spotting 3 mu L of the mixture, performing electrophoresis at a constant voltage of 180V for 1.0-1.5h, and taking pictures after silver nitrate staining.
The results of the molecular marker detection are shown in FIG. 2. The figure shows that the disease-resistant parent LS5082 and the susceptible parent stone wheat 22 can respectively amplify a specific strip of 210bp linked with the disease-resistant phenotype and a specific strip of 225 bp linked with the susceptible phenotype, and LS5082 is multiplied by 15F of the stone wheat 22 2:3 In the family, lanes 3-7 are homozygous disease-resistant F 2:3 The family system can amplify a specific strip of 210bp linked with a disease-resistant phenotype; lanes 8-12 are anti-influenza F 2:3 The family system can simultaneously amplify a 210bp specific strip linked with a disease-resistant phenotype and a 225 bp specific strip linked with a disease-sensitive phenotype; lanes 13-17 are homozygous infected F 2:3 The pedigree can amplify a 225 bp specific band linked with the susceptible phenotype. In the figure, lane M is DNA marker pUC19MspI, black arrows being traceablePmLS5082The specific band of (1).
Example 3 wheat powdery mildew resistance GenePmLS5082Molecular marker of (2)YTU19-005 application
Powdery mildew resistance gene of wheatPmLS5082The molecular marker YTU19-005 is used for detecting whether the wheat material carries the gene or notPmLS5082And determining whether molecular marker YTU19-005 is availablePmLS5082And (3) molecular marker assisted selective breeding under different wheat backgrounds.
The sample to be tested comprises LS5082, stone wheat 22 and 9 wheat materials, wherein the 9 wheat materials are respectively as follows: nicong 187, shannong 1538, shannong 202, zhou mai 27, zhongyu 1311, nicong 1212, jimai 229, FC009, zhongyu 9398. The laboratory early-stage powdery mildew resistance identification result shows that: these 9 wheat materials all exhibited susceptibility to wheat powdery mildew strain E09.
DNA extracted from the above-mentioned material was used as a template, and the amplification was carried out using a primer of molecular marker YTU19-005 developed in the present invention:
nucleotide sequence of the upstream primer YTU 19-005-F: 5'-3': AAGATGAACTGCGGCTGAAT, respectively;
nucleotide sequence of downstream primer YTU 19-005-R: 5'-3': CAGATGGACCTCTTCTTCGG are provided.
The PCR amplification system is 20 mu L, and comprises 2.0 mu L of wheat genome DNA 30-50 ng/mu L, 2.0 mu L of 10 XPCR buffer, 0.4 mu L of 10mM dNTP and 10mM MgCl 2 2.0 μ L, 5U Taq polymerase 0.4 μ L, 2 μ M upstream primer 0.8 μ L, 2 μ M downstream primer 0.8 μ L, and sterile deionized water 11.6 μ L.
The procedure of PCR amplification is as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, extension for 40 seconds, 38 cycles; extending for 5min at 72 ℃; storing at 4 ℃.
And (3) detecting a PCR amplification product: and (2) performing electrophoresis on a non-denaturing polyacrylamide gel with the mass-to-volume ratio of 8%, mixing the amplification product with 10 mu L of loading buffer solution, spotting 3 mu L of the mixture, performing electrophoresis at a constant voltage of 180V for 1.0-1.5h, and taking pictures after silver nitrate staining.
The detection result of the molecular marker is shown in figure 3, 210bp specific bands linked with the disease-resistant phenotype can be amplified in LS5082, and 225 bp specific bands linked with the disease-resistant phenotype can be amplified in other materials which are the same as the susceptible parent Shimai 22. This is in accordance with the principle of the bookEarly laboratory powdery mildew resistance identification Shimai 22 and other 9 wheat materials were consistent in their apparent susceptibility to wheat powdery mildew strain E09. The result shows that the molecular marker YTU19-005 can be used for detecting whether the wheat variety to be detected carries genes or notPmLS5082And is suitable for molecular marker-assisted selective breeding under different disease-sensitive variety backgrounds.
Will be provided withPmLS5082The gene developed by the invention is introduced into a main cultivar of susceptible wheat by hybridizationPmLS5082The closely linked molecular markers YTU19-005 can efficiently and accurately detect large breeding groups and greatly improve the transferred disease-resistant genesPmLS5082Efficiency and accuracy of gene, acceleration of genePmLS5082The cultivation of new wheat varieties with powdery mildew resistance under different genetic backgrounds can shorten the breeding period, eliminate linkage drag and effectively improve the breeding efficiency of wheat.
The above examples are preferred embodiments of the present invention, and are intended to be illustrative of the invention and not limiting. Modifications and equivalents will occur to those skilled in the art without departing from the spirit and principles of the embodiments of the invention and are intended to be protected by the following claims.
SEQUENCE LISTING
<110> smoke desk university
<120> molecular marker closely linked with wheat powdery mildew resistance gene PmLS5082 and application thereof
<130>
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213> upstream primer YTU19-005-F
<400> 1
aagatgaact gcggctgaat 20
<210> 2
<211> 20
<212> DNA
<213> downstream primer YTU19-005-R
<400> 2
cagatggacc tcttcttcgg 20
Claims (6)
1. Amplification and wheat powdery mildew resistance genePmLS5082A primer pair of closely linked molecular markers, characterized in that: the molecular markers are YTU 19-005; the upstream primer of the molecular marker YTU19-005 is YTU19-005-F, and the nucleotide sequence is shown as SEQ ID NO. 1; the downstream primer of the molecular marker YTU19-005 is YTU19-005-R, and the nucleotide sequence is shown as SEQ ID N: 2; PCR amplification, electrophoresis and separation are carried out on the wheat genome DNA by the upstream primer and the downstream primer of the molecular marker YTU19-005, and an amplification product with the molecular weight of 210bp is obtained.
2. The gene of claim 1 for the amplification and resistance of wheat to powdery mildewPmLS5082Primer pair of closely linked molecular markers in wheat powdery mildew resistance genePmLS5082Detection and assisted breeding of powdery mildew resistance genePmLS5082Application in wheat.
3. The use of claim 2, wherein the detection of the presence of a powdery mildew resistance gene in the wheat variety to be tested is carried outPmLS5082The method mainly comprises the following steps:
(1) extracting genome DNA from fresh leaves of a wheat sample to be detected;
(2) carrying out PCR amplification on the wheat genome DNA by utilizing a primer pair of a molecular marker YTU19-005 to obtain an amplification product;
(3) the amplified product is subjected to electrophoresis and separation, if a specific strip with the molecular weight of 210bp can be amplified, the wheat to be detected carries the powdery mildew resistance genePmLS5082。
4. The use of claim 3, wherein the PCR amplification system in step (2) is 20 μ L, and comprises wheat genomic DNA of 30ng/μ L-50 ng/μ L2.0 μ L, 10 XPCR buffer 2.0 μ L, 10mM dNTP 0.4 μ L, 10mM MgCl 2 2.0 μ L, 5U Taq polymerase 0.4 μ L, 2 μ M upstream primer 0.8 μ L, 2 μ M downstream primer 0.8 μ L, and sterile deionized water 11.6 μ L.
5. The use according to claim 3 or 4, wherein the PCR amplification procedure is: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, extension for 40 seconds, 38 cycles; extension at 72 ℃ for 5 min; storing at 4 deg.C.
6. The use of claim 5, wherein the electrophoresis in step (3) is electrophoresis on 8% w/V native polyacrylamide gel at 180V for 1.0-1.5 hours.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010998856.8A CN111996283B (en) | 2020-09-22 | 2020-09-22 | Molecular marker closely linked with wheat powdery mildew resistance gene PmLS5082 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010998856.8A CN111996283B (en) | 2020-09-22 | 2020-09-22 | Molecular marker closely linked with wheat powdery mildew resistance gene PmLS5082 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111996283A CN111996283A (en) | 2020-11-27 |
| CN111996283B true CN111996283B (en) | 2022-09-27 |
Family
ID=73475664
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010998856.8A Active CN111996283B (en) | 2020-09-22 | 2020-09-22 | Molecular marker closely linked with wheat powdery mildew resistance gene PmLS5082 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111996283B (en) |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1252284C (en) * | 2002-09-27 | 2006-04-19 | 天津师范大学 | Molecular marker linked with wheat mildew-resistance gene |
| CN101570790B (en) * | 2009-05-13 | 2011-12-21 | 中国农业科学院作物科学研究所 | Powdery mildew resistant wheat auxiliary screening method and special primer thereof |
| CN104313021B (en) * | 2014-10-21 | 2017-01-18 | 山西省农业科学院作物科学研究所 | Molecular marker of wheat powdery mildew disease-resistant genes Pm51 and application of molecular marker |
-
2020
- 2020-09-22 CN CN202010998856.8A patent/CN111996283B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN111996283A (en) | 2020-11-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111334603B (en) | Specific InDel molecular marker primer for detecting OsNRAMP5 gene of rice and application thereof | |
| CN110512025B (en) | Molecular marker closely linked with wheat powdery mildew resistance gene PmJM23 and application thereof | |
| CN106811462B (en) | Indel marker linked with tomato gray leaf spot resistance gene Sm as well as amplification primer and application thereof | |
| CN106498068B (en) | Co-dominant SSR marker closely linked with tobacco TMV resistance gene N and application thereof | |
| CN110777218B (en) | Molecular marker linked with wheat powdery mildew resistance gene Pm37 and application thereof | |
| CN110468229B (en) | Coseparation molecular marker Hxjy-1 of rice broad-spectrum high-resistance bacterial leaf blight gene Xa45(t) | |
| CN110358861B (en) | Molecular marker R13I14 closely linked with rice broad-spectrum high-resistance bacterial blight gene Xa45(t) | |
| CN109797238B (en) | Two molecular markers developed based on gummy stem blight resistance identification and application thereof | |
| CN109468330B (en) | Barley yellow mosaic disease resistance gene eIF4EHOR3298And identification method and application thereof | |
| RU2717017C2 (en) | Molecular markers for blackleg resistance gene rlm2 in brassica napus and methods of use thereof | |
| CN111996283B (en) | Molecular marker closely linked with wheat powdery mildew resistance gene PmLS5082 and application thereof | |
| CN117025812A (en) | Primer for amplifying molecular marker closely linked with wheat powdery mildew resistance gene PmCG15-009 and application thereof | |
| CN113736866B (en) | SNP locus combination for detecting tomato yellow leaf curl virus resistance and application thereof | |
| CN112063740B (en) | KASP molecular marker closely linked with wheat powdery mildew resistance gene Pm37 and application thereof | |
| CN112011637B (en) | Molecular marker closely linked with wheat powdery mildew resistance gene Pm68 and application thereof | |
| CN110358862B (en) | Molecular marker Hxjy-14 closely linked with rice broad-spectrum high-resistance bacterial blight gene Xa45(t) | |
| CN109735650B (en) | Four single nucleotide polymorphism-based molecular markers for resisting gummy stem blight of melon and application thereof | |
| CN117757983B (en) | Molecular marker primer co-separated from powdery mildew resistance gene PmYD-001 of durum wheat and application thereof | |
| CN112011635B (en) | Molecular marker closely linked with wheat powdery mildew resistance gene PmDGM and application thereof | |
| CN113832249B (en) | Molecular marker for detecting specific chromosome fragment of wheat diaphysis germplasm 8425B and application thereof | |
| WO2015038470A1 (en) | Molecular markers for blackleg resistance gene rlm4 in brassica napus and methods of using the same | |
| CN113699273B (en) | SNP locus combination for detecting resistance of tomato root-knot nematode and application thereof | |
| CN116103432B (en) | Clubroot disease resistance molecular marker, detection primer and application thereof | |
| CN117344054B (en) | Molecular marker primer for amplifying wheat powdery mildew resistance gene pmXQ-0508 and application thereof | |
| CN108660230A (en) | A kind of molecular labeling SIsv0163 with millet anti-imazethapyr herbicide resistance gene close linkage |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |