CN116024368B

CN116024368B - Molecular marker closely linked with soybean plant high-efficiency gene locus and application thereof

Info

Publication number: CN116024368B
Application number: CN202211348754.7A
Authority: CN
Inventors: 李玉秋; 刘晓冬; 王英男; 齐广勋; 董岭超; 董英山; 夏正俊; 王玉民; 赵洪锟; 袁翠平
Original assignee: Jilin Academy of Agricultural Sciences
Current assignee: Jilin Academy of Agricultural Sciences
Priority date: 2022-10-31
Filing date: 2022-10-31
Publication date: 2023-08-18
Anticipated expiration: 2042-10-31
Also published as: CN116024368A

Abstract

The invention belongs to the technical field of soybean molecular breeding, and particularly discloses a molecular marker closely linked with a soybean plant high-efficiency gene locus. The molecular markers Gm07_36170131_A_G and/or Gm07_36245158_T_C, and the nucleotide sequence of Gm07_36170131_A_G is shown as SEQ ID NO:1 or SEQ ID NO:2 is shown in the figure; the nucleotide sequence of Gm07_36245158_T_C is shown in SEQ ID NO:3 or SEQ ID NO: 4. The molecular marker related to the soybean plant height is identified in the locating interval of the QTL, and the molecular marker can be used for soybean plant height character breeding.

Description

Molecular marker closely linked with soybean plant high-efficiency gene locus and application thereof

Technical Field

The invention belongs to the technical field of soybean molecular breeding, and particularly discloses a molecular marker closely linked with a soybean plant high-efficiency gene locus and application thereof.

Background

The soybean is an important grain and oil feeding crop in China and has important strategic position in national economy development. The soybean has a planting history of 5000 years in China, and is produced in northeast, north China, shaanxi, chuan and regions downstream of Yangtze river, so that more soybean is cultivated in Yangtze river basin and southwest, and the quality of the soybean in northeast is optimal. The soybean is a food most favored by nutritionists among hundreds of natural foods because of its high nutritive value, which is called "king in beans", "meat in fields", "green cow's milk", etc.

The Plant Height (PH) of soybean is one of the important factors for plant type constitution and is also an important agronomic trait affecting yield. Traditional genetic studies have shown that an increase in soybean plant height over a range can lead to an increase in yield. Therefore, the research of soybean plant height has important significance for soybean high-yield breeding. However, the quantitative genetic characters of the soybean plants are greatly influenced by environmental factors, so that the research on soybean yield characters has certain limitation. Genetic analysis of these yield traits from conventional quantitative genetics perspectives makes it difficult to determine the number, genetic effects and location of quantitative trait loci (quantitative trait locus, QTL) that control the corresponding traits. However, with the completion of whole genome sequencing of soybean, molecular biology and molecular marking technologies such as SSR (simple sequence repeats), SNP (single nucleotide polymorphism) are gradually perfected, a plurality of QTLs related to soybean plant height are found, but only a few related genes are cloned, and the analysis of a regulation mechanism of soybean plant height is slow. There are many related QTLs of plant height at present, hundreds of QTL sites of plant height are recorded on soybase, but related QTLs are not found on chromosome 7 at present.

Disclosure of Invention

In view of the technical problems, the invention provides a molecular marker closely linked with a soybean plant high-efficiency gene locus, so that molecular marker assisted selective breeding is carried out on soybean plant height, and the molecular marker assisted selective breeding can be also applied to excavating soybean plant height regulating genes.

In a first aspect of the invention, a molecular marker closely linked with a major gene locus of soybean plant height is provided, wherein the major gene locus is positioned between chromosomes 7 and 36170131-36245158 and is named qPH07-1; the molecular markers are Gm07_36170131_A_G or/and Gm07_36245158_T_C, and the qPH-1 is positioned in a 72.1kb interval between the molecular markers Gm07_36170131_A_G and Gm07_36245158_T_C;

the nucleotide sequence of Gm07_36170131_A_G is shown as SEQ ID NO:1 or SEQ ID NO:2 is shown in the figure;

the nucleotide sequence of Gm07_36245158_T_C is shown in SEQ ID NO:3 or SEQ ID NO: 4.

In a second aspect of the present invention, there is provided a primer for the molecular marker,

the forward primer sequence of Gm07_36170131_A_G is shown in SEQ ID NO:5 is shown in the figure; the reverse primer sequence is shown in SEQ ID NO:6 is shown in the figure;

the forward primer sequence of Gm07_36245158_T_C is shown in SEQ ID NO: shown in figure 7; the reverse primer sequence is shown in SEQ ID NO: shown at 8.

In a third aspect, the invention provides application of the primer in positioning and detecting soybean plant height gene qPH 07-1.

The invention provides an application of the molecular marker or the primer in soybean plant height character breeding.

In a fifth aspect, the invention provides a method for soybean plant height trait breeding, comprising the following steps:

f produced by hybridization of Changnong 16 of female parent and Jilin tea flowers of male parent ₂ Carrying out PCR amplification by taking genomic DNA of the generation group as a template and taking the primer as a primer according to claim 2;

sequencing the Gm07_36170131_A_G-F/R amplification product and the Gm07_36245158_T_C-F/R amplification product respectively when F ₂ The generation group has a molecular marker Gm07_36170131_A_G, and when the 39 th position of the amplified product Gm07_36170131_A_G from the 5' end is A in the female parent long pesticide 16, the plant is short, or F ₂ The generation group has a molecular marker Gm07_36245158_T_C, and the 30 th position of the 5' end of the amplification product Gm07_36245158_T_C is T in the female parent long pesticide 16, so that the plant is short; when F ₂ The generation group has a molecular marker Gm07_36170131_A_G, and when the 39 th position of the amplified product Gm07_36170131_A_G from the 5' end is G in flowers in the male parent Jilin vegetables, the plant is high; or F ₂ The generation group has a molecular marker Gm07_36245158_T_C, and the 30 th position of the amplification product Gm07_36245158_T_C from the 5' end is C in flowers in the male parent Jilin vegetables, so that the plant is high.

Preferably, the PCR amplification reaction system is: 20 ng/. Mu.l of DNA 4. Mu.l, rTaq enzyme 0.5. Mu.l, 3 XGC Buffer I15. Mu.ll,2.5mM dNTPs 2.5. Mu.l, 2. Mu.M forward and reverse primers 2.5. Mu.l each, ddH ₂ O was made up to 30. Mu.l.

Preferably, the PCR reaction procedure is: firstly, amplifying for 35 cycles at 94 ℃ for 5min, then at 94 ℃ for 30s,58 ℃ for 40s and 72 ℃ for 70s, and finally extending for 10min at 72 ℃ and preserving heat at 4 ℃.

In a sixth aspect of the invention, a soybean plant height typing detection kit is provided, which comprises the primer.

The seventh aspect of the invention provides an application of the detection kit in soybean plant height character breeding.

Compared with the prior art, the invention has the beneficial effects that:

1. the invention locates a QTL locus related to soybean plant height in soybean for the first time, the LOD value of the QTL locus is 3.3, the phenotype contribution rate is 13.1%, the additive effect reaches 8.7, the locus is positioned between Gm07_36170131_A_G and Gm07_36245158_T_C marks, and the physical distance is 72.1kb. Therefore, the interval is an important site for regulating soybean plant height from the aspects of the positioning of the QTL and the contribution rate of the QTL to the phenotype.

2. The molecular marker related to the soybean plant height is identified in the locating interval of the QTL, and the molecular marker can be used for soybean plant height character breeding.

Drawings

FIG. 1 is a parental strain height differential;

FIG. 2 is F ₂ A phenotype normal profile of the surrogate individual;

fig. 3 is a plant height dependent QTL localization map.

Detailed Description

In order to clearly illustrate the technical features of the present solution, the present invention will be described in detail below with reference to the accompanying drawings. The scope of the present invention is not limited to the following examples. Those skilled in the art will appreciate that various changes and modifications can be made to the invention without departing from the spirit and scope thereof.

The instruments, reagents, materials, etc. used in the examples described below are conventional instruments, reagents, materials, etc. known in the art, and are commercially available. The experimental methods, detection methods, and the like in the examples described below are conventional experimental methods, detection methods, and the like that are known in the prior art unless otherwise specified.

Example 1

Acquisition of QTL and molecular markers associated with soybean plant height

1. Genetic population construction

A pair of parents (Changnong 16 female parent, jilin tea flower male parent (male parent material is described in Yuqiu Li, YIngshan Dong, et al Positical Cloning of the Flowering Time QTLqFT-1Reveals the Link Between the Clock Related PRR Homolog With Photoperiodic Response in Soybeans[J)]Frontiers in Plant Science,2019, 10", available to the public from the Jilin province academy of agricultural sciences)), a population of isolated plant height isolates, F ₂ The population of individuals presented with a normal distribution as shown in figures 1-2.

2. Genetic map construction

At F ₂ 100 individuals are selected, and DNA of the parents and individual leaves is extracted by using a CTAB method. The samples were sequenced using an Illumina platform SoySNP8k iSelect Bead Chip chip containing 7189 SNP sites, data collated, redundant markers removed, 2407 markers had polymorphisms between parents.

Genetic mapping was performed using the Ici QTLMapping 3.2 software with a total length of 3425.7cM and an average distance between markers of 1.45cM, with an average of 120 markers per linkage group. The number of A2 linkage group markers was the largest, 256 SNP markers were included, the genetic distance was 179.2cM, and the average distance between markers was 0.7cM (Table 1). The I linkage group had 153 markers with a minimum average pitch of 0.64cM. The H linkage group (chromosome 12) had the smallest marker density, the genetic distance of 293.23cM, 100 SNP markers, and the average distance of 2.93cM. The number of B2 and L linkage group markers is minimum, 62 markers, and the average spacing is 1.35cM and 1.6cM respectively.

TABLE 1 distribution of SNP in isolated populations of JLCLH×CN 16F 2 on genetic linkage map

3. QTL positioning

1 major QTL (designated qPH 07-1), LOD 3.3, phenotype contribution 13.1% and additive effect-8.7 were detected on chromosome 7 using QTL icmapping_4.0 software complete interval mapping (ICIM), which was located between gm07_36170131 and gm07_36245158 at a physical distance of 72.1kb (table 2, fig. 3).

Table 2 QTL related information

Characteristics (1)

Chromosome of the human body

LOD

PVE(％)

Add

Dom

Chromosome location

Interval length

Plant height

7

3.3418

13.0947

-8.7291

-0.0266

Gm07：36170131-36245158

7.12kb

Example 2

Molecular marker and application

Extracting F generated by hybridization of Changnong 16 of female parent and Jilin tea flowers of male parent in seedling stage ₂ The whole genome DNA of 123 individuals in the generation group is used as a template, and primers with SNP molecular markers Gm07_36170131_A_G and Gm07_36245158_T_C are used as amplification primers for PCR amplification.

PCR reaction amplification system: DNA 4. Mu.l (20 ng/. Mu.l), rTaq enzyme 0.5. Mu.l, 3 XGC Buffer I15. Mu.l, 2.5mM dNTPs 2.5. Mu.l, forward and reverse primers (F/R) 2.5. Mu.l (2. Mu.M) each, ddH ₂ O was made up to 30. Mu.l.

PCR reaction procedure: 94 ℃ for 5min; then amplifying for 35 cycles at 94 ℃ for 30s,58 ℃ for 40s and 72 ℃ for 70 s; finally, the mixture is extended for 10min at 72 ℃ and is kept at 4 ℃.

The PCR product was subjected to 1% agarose gel electrophoresis at 140V for 20min.

PCR sequencing analysis was performed on the Gm07_36170131_A_G-F/R amplification product and the Gm07_36245158_T_C-F/R amplification product, respectively.

If F ₂ The generation group has a molecular marker Gm07_36170131_A_G, and when the 39 th position of the amplified product Gm07_36170131_A_G from the 5' end is A in the female parent long pesticide 16, the plant is short, or F ₂ When the molecular marker Gm07_36245158_T_C exists in the generation group and the 30 th position of the 5' end of the amplification product Gm07_36245158_T_C is T in the female parent long pesticide 16, the plant is short.

If F ₂ The generation group has a molecular marker Gm07_36170131_A_G, and when the 39 th position of the amplified product Gm07_36170131_A_G from the 5' end is G in flowers in the male parent Jilin vegetables, the plant is high; or F ₂ The generation group has a molecular marker Gm07_36245158_T_C, and the Gm07_36245158_T_C amplified product is positioned in the flowers of the male parent Jilin vegetables from the 30 th position of the 5' endC, the plant height is high.

The results showed that the accuracy of judgment of gm07_36170131_a_g was 85.4% and that of gm07_36245158_t_c was 80.5%. Therefore, the SNP molecular markers Gm07_36170131_A_G and Gm07_36245158_T_C can be used as co-dominant molecular markers of soybean plant height.

Wherein, the nucleotide sequence of the molecular marker Gm07_36170131_A_G is shown in SEQ ID NO:1 or SEQ ID NO:2, the nucleotide sequence of the molecular marker Gm07_36245158_T_C is shown as SEQ ID NO:3 or SEQ ID NO: 4.

The amplification primers are respectively as follows:

Gm07_36170131_A_G-F:5 'ctgccatcatcatgactgttatc3', as set forth in SEQ ID NO:5 is shown in the figure;

Gm07_36170131_A_G-R:5 'AAATACATTATTTGATCGGATACCA 3' as shown in SEQ ID NO:6 is shown in the figure;

Gm07_36245158_T_C-F:5'GGTGTCGGTGTTGAAAATGT3' as shown in SEQ ID NO: shown in figure 7;

Gm07_36245158_T_C-R:5 'tgctttgtgatctctacatgaaa3' as set forth in SEQ ID NO: shown at 8.

The above embodiments are not to be taken as limiting the scope of the invention, and any alternatives or modifications to the embodiments of the invention will be apparent to those skilled in the art and fall within the scope of the invention.

The present invention is not described in detail in the present application, and is well known to those skilled in the art.

Claims

1. A molecular marker segment closely linked with a soybean plant high-efficiency gene locus, which is characterized in that the main-efficiency gene locus is positioned between No. 7 chromosomes 36170131-36245158 and is named qPH07-1; the molecular marker fragment is Gm07_36170131_A_G or Gm07_36245158_T_C, and the qPH-1 is positioned in a 72.1kb interval between the molecular marker fragments Gm07_36170131_A_G and Gm07_36245158_T_C;

2. Use of the molecular marker fragment according to claim 1 in soybean plant height trait breeding.

3. The soybean plant height character breeding method is characterized by comprising the following steps:

f produced by hybridization of Changnong 16 of female parent and Jilin tea flowers of male parent ₂ Performing PCR amplification by taking genomic DNA of the generation group as a template and taking an amplification primer of the molecular marker fragment as a primer;

sequencing the Gm07_36170131_A_G-F/R amplification product and the Gm07_36245158_T_C-F/R amplification product respectively when F ₂ The generation group has a molecular marker fragment Gm07_36170131_A_G, and when the 39 th position of the amplified product Gm07_36170131_A_G from the 5' end is A in the female parent long pesticide 16, the plant is short, or F ₂ The generation group has a molecular marker fragment Gm07_36245158_T_C, and the 30 th position of the amplified product Gm07_36245158_T_C from the 5' end is T in the female parent long pesticide 16, so that the plant is short; or when F ₂ The generation group has a molecular marker fragment Gm07_36170131_A_G, and when the 39 th position of the amplified product Gm07_36170131_A_G from the 5' end is G in flowers in the male parent Jilin vegetables, the plant is high; or F ₂ The generation group has a molecular marker fragment Gm07_36245158_T_C, and the 30 th position of the amplified product Gm07_36245158_T_C from the 5' end is C in flowers in the male parent Jilin vegetables, so that the plant is high;

wherein, the forward primer sequence of the molecular marker fragment Gm07_36170131_A_G is shown as SEQ ID NO:5 is shown in the figure; the reverse primer sequence is shown in SEQ ID NO:6 is shown in the figure;

the forward primer sequence of the molecular marker fragment Gm07_36245158_T_C is shown in SEQ ID NO: shown in figure 7; the reverse primer sequence is shown in SEQ ID NO: shown at 8.

4. The method of claim 3, wherein the PCR amplification reaction system is: 20 ng/. Mu.l of DNA 4. Mu.l, rTaq enzyme 0.5. Mu.l, 3 XGC Buffer I15. Mu.l, 2.5mM dNTPs 2.5. Mu.l, 2. Mu.M forward and reverse primers 2.5. Mu.l, ddH respectively ₂ O supplementSufficient to 30 μl.

5. The method of claim 4, wherein the PCR reaction procedure is: firstly, amplifying for 35 cycles at 94 ℃ for 5min, then at 94 ℃ for 30s,58 ℃ for 40s and 72 ℃ for 70s, finally extending for 10min at 72 ℃, and preserving heat at 4 ℃.