CN1462806A - Molecule marker method of wheat Nanda 2419 scab resistant major gene locus - Google Patents
Molecule marker method of wheat Nanda 2419 scab resistant major gene locus Download PDFInfo
- Publication number
- CN1462806A CN1462806A CN 03131960 CN03131960A CN1462806A CN 1462806 A CN1462806 A CN 1462806A CN 03131960 CN03131960 CN 03131960 CN 03131960 A CN03131960 A CN 03131960A CN 1462806 A CN1462806 A CN 1462806A
- Authority
- CN
- China
- Prior art keywords
- major gene
- wheat
- gene loci
- nanjing university
- mark
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A major gene site resisting bakanae disease infection for wheat "Nanda 2419" and its molecular marker are disclosed. After the genetic type and invalid ear rate of each parentage for the recombinant selfing line obtained by hybridization between wheat "Wanshuibai" and "Nanda 2419" are analyzed in genetic linkage manner, said major gene sites QFhs.nau-3a and QFhs.nau-3b are found out. Detecting if the Nanda 2419 and its derivative variety contain the major gene site can predict its level resisting bakanae disease.
Description
One, technical field
The invention provides wheat Nanjing University 2419 anti gibberellic diseases and infect major gene loci and molecule marker thereof, belong to the molecular genetics field, be exclusively used in the seed selection of wheat scab disease-resistant variety and the utilization of germ plasm resource.
Two, technical background
Wheat is the important food crop of China.By the wheat scab that gibberella causes, not only cause the serious underproduction of wheat, reduce grain quality, and the toxin deoxynivalenol that this germ produces also influences people, animal health, caused very big loss to Wheat Production.In China, the harm that suffers head blight above 1/4th wheat belt is arranged, and just once be very popular every 3 ~ 5 years, only head blight generation area in 2002 promptly reaches 30,000,000 mu times.Therefore, research prevents and treats wheat scab and has also just become a urgent task on the current Wheat Production.Cultivating disease-resistant variety is to prevent and treat the safest, effective of wheat scab harm and save one of measure of cost.But traditional breeding way is wasted time and energy, and because the head blight phenotypic evaluation is very difficult, makes the wheat anti gibberellic disease breeding process slow unusually.Identify that by the location disease-resistant major gene loci comes assistant breeding effectively to address this problem.
Genetic research shows that wheat scab is controlled by a few major gene loci mainly, and its disease-resistant major gene loci position on karyomit(e) of different resistant materials is inconsistent, and be divided into anti-infect and resist expand two types.But the polymerization by the disease-resistant major gene loci of difference or introduce new anti-source and can select the good kind of resistance.
At present in the utilization of the research of scab resistance hereditary basis and breeding for disease resistance, focus mostly in Soviet Union wheat No. 3 and derive and be.Nanjing University 2419 is choosing systems of Italian wheat breed Mentana, has yielding ability preferably, and economical character is good, is one of backbone parent of China's wheat breeding.And the parent " Funo " of Mentana and Soviet Union three has the common ancestors, so may exist in the Nanjing University 2419 and scab resistance mechanism like the Su Sanxiang.
Three, disclosure of Invention Technical Problem the objective of the invention is: provide wheat Nanjing University 2419 anti gibberellic diseases to infect major gene loci and molecule marker thereof, by detecting and these anti-chain molecule markers of major gene loci that infects, can predict the scab resistance of wheat plant, accelerate the selection progress of wheat-resistance to scab.Technical scheme wheat Nanjing University 2419 anti gibberellic diseases infect major gene loci, it is characterized in that: major gene loci QFhs.nau-3a, and by mark Xgwm2 location,
Left end primer sequence CTGCAAGCCTGTGATCAACT
Right-hand member primer sequence CATTCTCAAATGATCGAACA
Amplified fragments 100bp, this major gene loci are positioned at the 3A karyomit(e) of wheat Nanjing University 2419, utilize Data desk v.5.0 software record with the incoherent probability P value of scab resistance be 0.0064, to the contribution rate 9.9% of scab resistance; Major gene loci QFhs.nau-4b, by mark Xgwm107 location,
Left end primer sequence ATTAATACCTGAGGGAGGTGC
Right-hand member primer sequence GGTCTCAGGAGCAAGAACAC
Amplified fragments 188bp, this major gene loci are positioned at the 4B karyomit(e) of wheat Nanjing University 2419, utilize Data desk v.5.0 software record with the incoherent probability P value of scab resistance be 0.0249, to the contribution rate 7.9% of scab resistance.
Above-mentioned wheat Nanjing University 2419 anti gibberellic diseases infect major gene loci, be that to obtain mark by the following method localized: (1) wheat breed Wangshuibai (♀) is hybridized with Nanjing University 2419 (♂) and is obtained hybrid F1, the F1 selfing produces F2, adopts simple grain transmission method (SSD) to obtain the F6 RIL in generation then; (2) extract the DNA that each strain of recombinant inbred lines is with the SDS method, adopt simple repeated sequence mark SSR that two parents are carried out the polymorphism screening, PCR carries out on PE9600 amplification instrument, amplified production carries out the electrophoretic separation analysis on 8% (g/ml) polyacrylamide gel, according to the molecular marker screening result, filtering out has polymorphic primer between the parent, has polymorphic primer to analyze in recombinant inbred lines between the parent, the pcr amplification program is the same, obtains colony's genotype data; (3) according to chain exchange rule, utilize colony's genotype data to make up the genetic map of wheat, used software is Mapmaker 2.0, minimum LOD value is made as 3, obtains linkage map; (4) blooming stage inoculation head blight pathogenic bacteria carries out scab resistance to each family of RIL and identifies, obtains the disease tassel yield of each family of RIL; (5) utilize Data desk v.5.0 software disease tassel yield that the colony's genotype data of each molecule marker and the scab resistance of its corresponding each family are identified carry out linkage analysis, One-way ANOVA records and the incoherent probability P value of scab resistance, the molecule marker of P＜0.05 promptly shows with a major gene loci chain: find that in Nanjing University 2419 the mark Xgwm2 of P=0.0064 and the mark Xgwm107 of P=0.0249 infect the major gene loci close linkage with anti-, promptly obtain Nanjing University 2419 anti-mark location of infecting major gene loci QFhs.nau-3a and QFhs.nau-4b.Beneficial effect wheat provided by the present invention Nanjing University 2419 anti gibberellic diseases infect major gene loci and molecule marker thereof, have the following advantages: (1) the present invention obtains to have located 2 major gene locis that anti gibberellic disease infects in the wheat breed Nanjing University 2419 in the world first, and they are soluble 15.8% scab resistance jointly.The wheat cdna group is huge, is 40 times of rice genome size, and the accurate location work of wheat anti gibberellic disease major gene loci is occupy the same domain prostatitis; (2) major gene loci locality specific, it is convenient to identify.By detecting and these anti-chain molecule markers of major gene loci that infects, promptly can predict the scab resistance of wheat plant, the genotype detection that is used for wheat breed or strain, judging whether this kind or strain have scab resistance, and then rapid screening disease-resistant variety or strain are used for wheat breeding.Major gene loci easy to detect fast, not affected by environment; (3) the assistant breeding select target is clear and definite, saves cost.In traditional breeding way, at first to collect parent and Cultivar and carry out a series of hybridization, and will carry out individual plant to scab resistance and select with disease-resistant gene.Wheat scab is carried out phenotypic evaluation will wait until blooming stage, be subjected to bigger environmental influence, the result reliability of phenotypic evaluation is low.Therefore breeding for disease resistance is not only time-consuming, and difficulty is big, the cost height.By detecting the anti gibberellic disease major gene loci, can just identify the individual plant of high anti gibberellic disease in seedling stage, eliminate other plant, not only save production cost but also improve the efficiency of selection of wheat-resistance to scab greatly.
Four, embodiment is of the present invention is described in detail as follows:
Studies show that wheat scab resistance is controlled by the minority major gene loci mainly.U.S. Anderson laboratory finds that the scab resistance of No. 3/Stoa of four major gene locis and Soviet Union wheat colony is significantly relevant, lays respectively at 2Al, 3BS, 4BS and 6BS and goes up (Anderson, 1998; Waldron, 1999; Anderson, 2000,2001).People such as U.S. Bai obtain two the scab resistance sites relevant with the RAPD mark, and Zhou integrated use SSR, AFLP in 2002 and aneuploid technology are positioned at this major gene loci that to lack be that 3BS-8 does not hold a last length to be about the chromosomal region of 8cM.Japan Ban infers that the resistance main effect gene locus of Soviet Union wheat 3 may be positioned on the 5AL.Austrian Buerstmayr (2000,2001) finds that three genome areas and the anti-extendability significant correlation of head blight are arranged, and is positioned on 3BS, 5A, the 1B.The present invention finds, there are 2 anti-major gene locis that infect in the 3A of wheat breed Nanjing University 2419 and the 4B karyomit(e), these major gene locis can be used to instruct the seed selection work of anti gibberellic disease kind, screen with chain with it molecule marker enantiopathy kind, make different disease-resistant major gene loci rapid polymerizations in same plant, thereby improve breeding efficiency greatly.Materials and methods: the structure and the phenotypic evaluation of (one) Nanjing University 2419 RILs: (1) is that acquisition F1 is hybridized in Nanjing University 2419 (♂) to the choosing of China's Jiangsu local variety Wangshuibai (♀) and Italian wheat breed Mentana, the F1 selfing produces F2,136 optional plantations of F2 individual plant, the method that adopts simple grain to pass is bred F6 generation, obtain RIL, comprise 136 familys; (2) RIL is planted in the academy of agricultural sciences, Jiangsu Province, allows its natural occurrence.Blooming back 20 days, and measuring state of an illness indexs such as disease tassel yield.It is DNA that the disease tassel yield=sick spike number/molecular marker analysis (1) of total spike number * 100% (two) recombinant inbred lines extracts each strain of recombinant inbred lines with the SDS method; (2) at first Wangshuibai and 2419 parents' of Nanjing University dna polymorphism is carried out initial analysis with 976 pairs of SSR primers.The PCR reaction volume is 25 microlitres, 10 * buffer, 2.5 microlitres wherein, 25mM MgCl
21.5 microlitre, 2.5mM dNTPs 2 microlitres, Taq enzyme (5 units/microlitre) 0.2 microlitre, template DNA 20 nanograms add water to 25 microlitres.After the SSR reaction system is 94 ℃ of pre-sex change 3min of DNA, 94 ℃ of sex change 1min, 60 ℃ of annealing 1min, 72 ℃ are extended exhibition 2min, circulate 35 times, and last 72 ℃ are extended 10min.In the enterprising performing PCR amplification of PE 9600 amplification instrument, amplified production carries out electrophoretic separation on 8% non-denaturing polyacrylamide gel (containing 7.6 gram acrylamides and 0.4 gram methylene diacrylamide in the 100ml polyacrylamide solution), on ultraviolet transilluminator, take a picture then, the record result, there is polymorphic primer in recombinant inbred lines, to analyze between the parent, the pcr amplification program is the same, obtains colony's genotype data; (3) according to chain exchange rule, utilize colony's genotype data to make up the genetic map of wheat, used software is Mapmaker 2.0, minimum LOD value is made as 3, obtains linkage map; (4) utilize Data desk v.5.0 software disease tassel yield that the colony's genotype data of each molecule marker and the scab resistance of its corresponding each family are identified carry out linkage analysis, the location major gene loci.(3) result and analysis:
Molecular marker screening is the result show, has 383 pairs of SSR primers variant between parents.Utilize Datadesk v.5.0 software disease tassel yield that the colony's genotype data of each molecule marker and the scab resistance of its corresponding each family are identified carry out linkage analysis, One-way ANOVA records and the incoherent probability P value of scab resistance and the site contribution rate R to scab resistance
2(table 2), the molecule marker of P＜0.05 are promptly chain with a major gene loci.The genotype of gained molecule marker in colony is by the genotype classification of parent's Wangshuibai and Nanjing University 2419, if the 2419 identical strains of genotype and Nanjing University are that phenotype is anti-, then the localized disease-resistant major gene loci of this mark is from Nanjing University 2419: find that in Nanjing University 2419 the mark Xgwm2 of P=0.0064 and the mark Xgwm107 of P=0.0249 infect the major gene loci close linkage with anti-, promptly obtain Nanjing University 2419 anti-marks location of infecting major gene loci QFhs.nau-3a and QFhs.nau-4b.
Be tested and appraised above-mentioned major gene loci and predict the wheat plant resistance, expectation can improve the breeding process of China's disease-resistant wheat kind rapidly.
The sequence of table 1. labeled primer and amplified fragments size
Clip size
Mark left end primer sequence right-hand member primer sequence
(bp)
Xgwm2 CTGCAAGCCTGTGATCAACT CATTCTCAAATGATCGAACA 100
Xgwm107?ATTAATACCTGAGGGAGGTGC GGTCTCAGGAGCAAGAACAC 188
The table 2. Nanjing University 2419 anti-One-way ANOVAs that infect major gene loci
Disease tassel yield
The major gene loci mark
P R
2(％)
QFhs.nau-3a Xgwm2 0.0064 9.9
QFhs.nau-4b Xgwm107 0.0249 7.9P: expression and the incoherent probability of scab resistance, P＜0.05 shows this mark and scab resistance close linkage R
2: the site is to the contribution rate of scab resistance, value is big more show relevant more with scab resistance
Claims (3)
1, wheat Nanjing University 2419 anti gibberellic diseases infect major gene loci, it is characterized in that: major gene loci QFhs.nau-3a, and by mark Xgwm2 location,
Left end primer sequence CTGCAAGCCTGTGATCAACT
Right-hand member primer sequence CATTCTCAAATGATCGAACA
Amplified fragments 100bp, this major gene loci are positioned at the 3A karyomit(e) of wheat Nanjing University 2419, utilize Data desk v.5.0 software record with the incoherent probability P value of scab resistance be 0.0064, to the contribution rate 9.9% of scab resistance; Major gene loci QFhs.nau-4b, by mark Xgwm107 location,
Left end primer sequence ATTAATACCTGAGGGAGGTGC
Right-hand member primer sequence GGTCTCAGGAGCAAGAACAC
Amplified fragments 188bp, this major gene loci are positioned at the 4B karyomit(e) of wheat Nanjing University 2419, utilize Data desk v.5.0 software record with the incoherent probability P value of scab resistance be 0.0249, to the contribution rate 7.9% of scab resistance.
2, wheat according to claim 1 Nanjing University 2419 anti gibberellic diseases infect major gene loci, it is characterized in that, these major gene locis are that to obtain mark by the following method localized: (1) wheat breed Wang Shui is hybridized from (♀) and Nanjing University 2419 (♂) and is obtained hybrid F1, the F1 selfing produces F2, adopts simple grain transmission method (SSD) to obtain the F6 RIL in generation then; (2) extract the DNA that each strain of recombinant inbred lines is with the SDS method, adopt simple repeated sequence mark SSR that two parents are carried out the polymorphism screening, PCR carries out on PE9600 amplification instrument, amplified production carries out the electrophoretic separation analysis on 8% (g/ml) polyacrylamide gel, according to the molecular marker screening result, filtering out has polymorphic primer between the parent, has polymorphic primer to analyze in recombinant inbred lines between the parent, the pcr amplification program is the same, obtains colony's genotype data; (3) according to chain exchange rule, utilize colony's genotype data to make up the genetic map of wheat, used software is Mapmaker 2.0, minimum LOD value is made as 3, obtains linkage map; (4) blooming stage inoculation head blight pathogenic bacteria carries out scab resistance to each family of RIL and identifies, obtains the disease tassel yield of each family of RIL; (5) utilize Data desk v.5.0 software disease tassel yield that the colony's genotype data of each molecule marker and the scab resistance of its corresponding each family are identified carry out linkage analysis, One-way ANOVA records and the incoherent probability P value of scab resistance, the molecule marker of P＜0.05 is promptly chain with a major gene loci, anti gibberellic disease infects the position of major gene loci and is determined by the chromosome position of molecule marker: find that in Nanjing University 2419 the mark Xgwm2 of P=0.0064 and the mark Xgwm107 of P=0.0249 infect the major gene loci close linkage with anti-, promptly obtain Nanjing University 2419 anti-mark location of infecting major gene loci QFhs.nau-3a and QFhs.nau-4b.
3, claim 1 or 2 described wheat Nanjing Universitys, 2419 anti gibberellic diseases infect the molecule marker of major gene loci, it is characterized in that: be positioned at the molecule marker that anti gibberellic disease on 3A and the 4B infects major gene loci QFhs.nau-3a, QFhs.nau-4b in the Nanjing University 2419 and be respectively Xgwm2 and Xgwm107.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 03131960 CN1246476C (en) | 2003-06-23 | 2003-06-23 | Molecule marker method of wheat Nanda 2419 scab resistant major gene locus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 03131960 CN1246476C (en) | 2003-06-23 | 2003-06-23 | Molecule marker method of wheat Nanda 2419 scab resistant major gene locus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1462806A true CN1462806A (en) | 2003-12-24 |
| CN1246476C CN1246476C (en) | 2006-03-22 |
Family
ID=29748488
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 03131960 Expired - Fee Related CN1246476C (en) | 2003-06-23 | 2003-06-23 | Molecule marker method of wheat Nanda 2419 scab resistant major gene locus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1246476C (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100336905C (en) * | 2004-05-08 | 2007-09-12 | 南京农业大学 | Wheat fertility recovery gene molecular mark and its obtaining method |
| CN103146699A (en) * | 2012-03-27 | 2013-06-12 | 南京农业大学 | Molecular marker MAG7237 of wheat fusarium head blight infection resistant gene Fhb4 and application of molecular marker MAG7237 |
| CN107338310A (en) * | 2017-07-31 | 2017-11-10 | 中国农业科学院作物科学研究所 | A kind of mark and application method for detecting wheat anti gibberellic disease gene PFT |
-
2003
- 2003-06-23 CN CN 03131960 patent/CN1246476C/en not_active Expired - Fee Related
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100336905C (en) * | 2004-05-08 | 2007-09-12 | 南京农业大学 | Wheat fertility recovery gene molecular mark and its obtaining method |
| CN103146699A (en) * | 2012-03-27 | 2013-06-12 | 南京农业大学 | Molecular marker MAG7237 of wheat fusarium head blight infection resistant gene Fhb4 and application of molecular marker MAG7237 |
| CN103146699B (en) * | 2012-03-27 | 2014-07-02 | 南京农业大学 | Molecular marker MAG7237 of wheat fusarium head blight infection resistant gene Fhb4 and application of molecular marker MAG7237 |
| CN107338310A (en) * | 2017-07-31 | 2017-11-10 | 中国农业科学院作物科学研究所 | A kind of mark and application method for detecting wheat anti gibberellic disease gene PFT |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1246476C (en) | 2006-03-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Saxena et al. | Application of SSR markers for molecular characterization of hybrid parents and purity assessment of ICPH 2438 hybrid of pigeonpea [Cajanus cajan (L.) Millspaugh] | |
| US11492668B2 (en) | Indel molecular marker closely linked to photoperiod insensitivity in pumpkins and application thereof | |
| CN108165656B (en) | Wheat molecular marker and application thereof in identification of wheat powdery mildew resistance | |
| CN105200160B (en) | A kind of relevant SNP marker of dissolved oxygen tolerance low to litopenaeus vannamei and its screening and application | |
| CN109182545B (en) | SNP marker associated with vibrio harveyi disease of large yellow croaker, primer and application thereof | |
| Fujii et al. | Parental diagnosis of satsuma mandarin (Citrus unshiu Marc.) revealed by nuclear and cytoplasmic markers | |
| Lu et al. | Identification of high-efficiency SSR markers for assessing watermelon genetic purity | |
| CN102140506B (en) | Molecular marker linked with gummy stem blight resistance gene Gsb-2 and application thereof | |
| CN106048042A (en) | Single nucleotide polymorphism marker site, primers and reagent kit for identifying peach fruit flesh color characteristic and application | |
| CN1246478C (en) | Molecule marker method of wheat Wangshuibai scab resistant major gene locus | |
| CN112899376B (en) | Method for detecting economic traits of Tibetan chicken by FOXO1 gene SNP marker and application thereof | |
| BR112013027408B1 (en) | method to identify a rust-resistant sugar cane strain | |
| CN1246479C (en) | Molecule marker method of wheat Wangshuibai scab resistant major gene locus | |
| Liu et al. | Development and validation of functional markers (tetra-primer ARMS and KASP) for the bacterial blight resistance gene xa5 in rice | |
| CN1246476C (en) | Molecule marker method of wheat Nanda 2419 scab resistant major gene locus | |
| Al-Naggar et al. | Molecular assessment of genetic diversity among Egyptian landraces of Wheat (Triticum aestivum L.) Using Microsatellite Markers | |
| Talebi et al. | Molecular characterization of'Carthamus tinctorius' and'C. oxyacanthus' germplasm using sequence related amplified polymorphism (SRAP) markers | |
| CN1246477C (en) | Molecule marker method of wheat Nanda 2419 scab resistant major gene locus | |
| de Oliveira et al. | Dominant versus codominant marker aiming to characterize Capsicum spp. | |
| CN114231639B (en) | Method for identifying or assisting in identifying area of porcine eye muscle and application thereof | |
| Dang et al. | Triploid and aneuploid hybrids obtained from hybridization between Eriobotrya japonica and E. cavaleriei | |
| US11814638B2 (en) | Marker associated with smut resistance in plant belonging to genus Saccharum and use thereof | |
| El-Fiki et al. | Molecular characterization and genetic diversity in some Egyptian wheat (Triticum aestivum L.) using microsatellite markers. | |
| CN103146699A (en) | Molecular marker MAG7237 of wheat fusarium head blight infection resistant gene Fhb4 and application of molecular marker MAG7237 | |
| Vijaykumar et al. | Molecular characterization of intergenic spacer region of 5S ribosomal RNA genes in subgenus Vigna: extensive hybridization among V. unguiculata subspecies |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |